The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017475	Enterobacter cloacae strain M12X01451 chromosome complete genome	4918273	967923	1008814	4918273	capsid,transposase,integrase	Enterobacteria_phage(20.0%)	38	962270:962287	1000179:1000196
962270:962287	attL	GCCCAGTTTGTTATCGTC	NA	NA	NA	NA
WP_032620201.1|967923_968484_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SCL7	Streptococcus_phage	33.5	3.4e-16
WP_061855978.1|970452_970899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021945.1|970985_971189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061855977.1|971869_972391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061855976.1|972644_972977_+	hypothetical protein	NA	K4I147	Salmonella_phage	71.8	6.6e-07
WP_095908432.1|973246_975172_+	tape measure protein	NA	A0A0S1S2C7	Klebsiella_phage	32.2	1.6e-49
WP_095907382.1|975815_976160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907383.1|976178_977195_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_061855972.1|977257_977470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061855971.1|977593_978064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061855970.1|978109_979321_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_095907384.1|979636_980815_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.9	3.1e-123
WP_013095748.1|980811_981663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058688253.1|981818_981974_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_095907385.1|981933_982872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044158865.1|982886_983891_+|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	45.5	1.1e-73
WP_077681917.1|983981_984572_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	58.1	1.2e-22
WP_095907386.1|984568_984808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095754.1|984797_985208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044158864.1|988169_988442_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	61.6	2.3e-26
WP_095907387.1|989053_990487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047023471.1|991141_991456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907389.1|991452_992262_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_095907392.1|992496_993243_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013095761.1|993253_993511_-	YjhX family toxin	NA	NA	NA	NA	NA
WP_058661778.1|993921_994245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038418758.1|994428_995100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907393.1|995318_996533_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_038418760.1|996557_997352_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_038418761.1|997451_998351_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038418762.1|998422_1000207_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	2.1e-19
1000179:1000196	attR	GCCCAGTTTGTTATCGTC	NA	NA	NA	NA
WP_013095768.1|1000327_1001437_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_029882448.1|1001555_1002737_-	amidohydrolase	NA	NA	NA	NA	NA
WP_095907394.1|1002748_1003936_-	MFS transporter	NA	NA	NA	NA	NA
WP_095907396.1|1004063_1004972_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.1	4.4e-05
WP_013095772.1|1005209_1006610_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_013095773.1|1006596_1007529_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_095907245.1|1007638_1008814_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	48.6	3.5e-103
>prophage 2
NZ_CP017475	Enterobacter cloacae strain M12X01451 chromosome complete genome	4918273	1140681	1208175	4918273	tail,holin,protease,tRNA,plate,portal,terminase,head,integrase,capsid	Cronobacter_phage(58.82%)	74	1135521:1135542	1192668:1192689
1135521:1135542	attL	CCCCTCACCCTAACCCTCTCCC	NA	NA	NA	NA
WP_010428207.1|1140681_1141161_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_095907424.1|1141360_1142155_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_094916001.1|1142303_1144802_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.5	1.0e-112
WP_095907425.1|1146446_1148171_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	56.7	6.8e-180
WP_095907427.1|1148174_1148717_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	55.5	7.1e-43
WP_095907429.1|1148688_1149411_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	36.9	3.7e-31
WP_095908434.1|1149410_1149926_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	40.3	1.4e-19
WP_147720027.1|1149940_1152277_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	51.4	6.6e-146
WP_095907430.1|1152288_1152882_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	66.3	7.0e-76
WP_095907432.1|1152874_1154059_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	69.0	2.1e-156
WP_095907433.1|1154051_1154387_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	59.6	2.8e-29
WP_095907435.1|1154383_1156498_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	42.1	4.4e-149
WP_095907436.1|1156499_1156679_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	67.4	2.2e-09
WP_095907437.1|1156687_1156957_-|tail	putative phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_095907439.1|1157062_1157443_-	hypothetical protein	NA	A0A2I6PD12	Escherichia_phage	36.0	9.2e-05
WP_095907441.1|1157442_1157781_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	86.1	1.6e-45
WP_048962605.1|1157767_1158079_-|holin	holin	holin	NA	NA	NA	NA
WP_095907443.1|1158083_1158542_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	53.4	1.8e-39
WP_095907444.1|1158544_1159687_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	63.2	9.5e-130
WP_147720029.1|1159689_1160388_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	60.1	8.0e-71
WP_095907448.1|1160381_1160858_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	39.7	9.1e-26
WP_095907450.1|1160854_1161328_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	55.8	3.8e-32
WP_095907452.1|1161431_1162136_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	60.9	4.5e-74
WP_095907453.1|1162138_1163173_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	53.8	1.8e-95
WP_095907454.1|1163201_1164263_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	43.0	6.5e-32
WP_095907456.1|1164438_1166256_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.4	1.5e-185
WP_095907458.1|1166252_1167317_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	60.3	1.2e-123
WP_072203346.1|1167373_1167640_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	55.7	3.3e-25
WP_095907460.1|1167686_1167905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907461.1|1168014_1170627_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	36.9	8.5e-126
WP_095907462.1|1170619_1171519_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	56.3	1.3e-97
WP_095907463.1|1171515_1171743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907464.1|1171742_1172717_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	61.3	1.0e-103
WP_095907465.1|1172786_1173176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907466.1|1173192_1173414_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	48.5	4.2e-10
WP_095907467.1|1173550_1173778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147720031.1|1173786_1174038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908435.1|1174034_1174370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907468.1|1174619_1174919_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	55.6	9.7e-26
WP_095907469.1|1174988_1176011_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	50.2	2.9e-93
WP_013095907.1|1176097_1176508_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_020685017.1|1176504_1176957_-	NfeD family protein	NA	NA	NA	NA	NA
WP_008499312.1|1176953_1177868_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_038982815.1|1178030_1178702_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.7	9.8e-26
WP_020685020.1|1178694_1179477_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_013095911.1|1179525_1180380_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_062856591.1|1180438_1181209_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013095913.1|1181237_1181861_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_013095914.1|1181831_1182518_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	2.2e-33
WP_095907470.1|1182514_1184929_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013095916.1|1185111_1186257_+	porin	NA	NA	NA	NA	NA
WP_095907471.1|1186380_1187451_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_095907472.1|1187546_1188614_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_013095919.1|1188610_1189120_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_020685024.1|1189281_1189467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013095921.1|1189532_1189742_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_023620084.1|1189882_1190605_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_020685026.1|1190608_1191103_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_020685027.1|1191277_1192663_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.1e-44
WP_095907473.1|1192752_1193280_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
1192668:1192689	attR	CCCCTCACCCTAACCCTCTCCC	NA	NA	NA	NA
WP_020685029.1|1193354_1194371_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_014830936.1|1194454_1195954_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_013095928.1|1196189_1196402_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_013095929.1|1196403_1197270_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.5	6.5e-30
WP_013095930.1|1197581_1198145_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_013095931.1|1198213_1198759_+	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
WP_013095932.1|1198793_1199486_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_095907474.1|1199500_1202065_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_020685033.1|1202078_1203083_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_013095935.1|1203092_1203617_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_013095936.1|1203668_1204301_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_095907475.1|1205106_1205829_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_095907476.1|1205853_1206552_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094085173.1|1207344_1208175_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP017475	Enterobacter cloacae strain M12X01451 chromosome complete genome	4918273	1653714	1751680	4918273	tail,protease,tRNA,plate,portal,terminase	Enterobacteria_phage(26.19%)	99	NA	NA
WP_013097296.1|1653714_1654494_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_013097295.1|1654497_1655820_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_013097294.1|1655800_1656505_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_095907584.1|1656504_1660953_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_095907585.1|1661132_1662956_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_013097290.1|1663130_1663682_+	YcbK family protein	NA	NA	NA	NA	NA
WP_013097289.1|1663702_1664350_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_029882979.1|1664407_1665598_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_047023996.1|1665782_1666871_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.1	1.0e-101
WP_045902761.1|1667476_1668877_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	1.1e-79
WP_029882976.1|1669042_1670245_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.6	4.9e-44
WP_095907586.1|1670429_1671722_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	94.9	2.1e-242
WP_095907587.1|1671766_1672024_-	excisionase family protein	NA	S4TND0	Salmonella_phage	90.0	6.8e-36
WP_095907588.1|1672007_1672394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063855844.1|1672393_1672972_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	67.7	7.5e-75
WP_048703186.1|1673014_1673842_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.7	1.1e-111
WP_045326846.1|1673838_1674033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907589.1|1674044_1674455_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	68.4	2.6e-45
WP_147720036.1|1674444_1675038_-	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	47.5	9.8e-38
WP_095907592.1|1675256_1675622_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	86.7	1.6e-51
WP_047063474.1|1675614_1675830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908439.1|1676021_1676249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147720038.1|1676352_1676580_-	hypothetical protein	NA	Q8W649	Enterobacteria_phage	36.5	3.2e-05
WP_095907593.1|1676717_1677374_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	74.8	1.5e-95
WP_095907594.1|1677480_1677696_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	74.2	8.8e-21
WP_095907596.1|1678335_1679958_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	88.3	1.8e-275
WP_095907597.1|1679954_1680926_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	80.4	4.4e-152
WP_095907598.1|1680922_1681705_+	antitermination protein	NA	F1C595	Cronobacter_phage	75.2	3.5e-107
WP_095907599.1|1682300_1683248_+	Shiga toxin subunit A	NA	Q777W4	Enterobacteria_phage	86.0	3.3e-152
WP_095907600.1|1683257_1683527_+	Shiga toxin Stx1 subunit B	NA	Q94LZ9	Enterobacteria_phage	92.1	3.1e-39
WP_095907601.1|1683761_1684475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907602.1|1684939_1685242_+	hypothetical protein	NA	O64361	Escherichia_phage	67.3	4.1e-32
WP_095907603.1|1685241_1685778_+	lysozyme	NA	K7PM52	Enterobacteria_phage	90.2	3.1e-91
WP_095908440.1|1685774_1686293_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	81.3	9.7e-74
WP_095907604.1|1687213_1687645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147720040.1|1687649_1687868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907606.1|1688055_1688550_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	68.9	3.7e-54
WP_095907607.1|1688549_1690679_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.9	5.1e-302
WP_057071484.1|1690675_1690891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907608.1|1690899_1692420_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	56.0	1.3e-155
WP_095907609.1|1692409_1694488_+|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	57.9	1.5e-197
WP_095907610.1|1694557_1694893_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	44.5	5.2e-12
WP_095907611.1|1694892_1695249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907612.1|1695250_1695913_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.2	2.5e-21
WP_095907613.1|1695921_1696476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907614.1|1696468_1697092_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	38.6	9.4e-15
WP_095907615.1|1697130_1698600_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	37.1	2.5e-74
WP_095907616.1|1698596_1699103_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_095907617.1|1699159_1699447_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_095907618.1|1699561_1701421_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	31.7	4.2e-26
WP_053085150.1|1701417_1701888_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.1	4.2e-15
WP_048701713.1|1701862_1702078_+|tail	tail protein X	tail	NA	NA	NA	NA
WP_095907619.1|1702079_1703198_+	late control protein D	NA	R9TNM7	Vibrio_phage	33.4	1.9e-37
WP_047463054.1|1703236_1703599_+	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	49.1	1.3e-21
WP_095907620.1|1703573_1704491_+|plate	baseplate J/gp47 family protein	plate	A0A088FQL4	Escherichia_phage	49.2	5.6e-64
WP_095907621.1|1704483_1705047_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	45.0	1.6e-29
WP_095908442.1|1706367_1706883_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	56.1	2.2e-33
WP_095907622.1|1706972_1707245_-	colicin immunity protein	NA	NA	NA	NA	NA
WP_157735657.1|1707241_1708531_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_095908443.1|1708840_1709827_-	SppA protein	NA	NA	NA	NA	NA
WP_029882975.1|1710693_1713306_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	2.4e-19
WP_038419036.1|1713357_1714128_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	1.5e-30
WP_048972455.1|1714124_1714916_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_095907624.1|1714925_1716071_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_023619891.1|1716067_1717030_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095907625.1|1717022_1717598_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_013097269.1|1717847_1718858_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_020689696.1|1719023_1719566_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_095907626.1|1719562_1720672_-	YcbX family protein	NA	V5UTY8	Synechococcus_phage	42.0	2.9e-06
WP_095907627.1|1720772_1722881_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_095907628.1|1722893_1724801_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	7.3e-50
WP_095907629.1|1724814_1726068_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_095907630.1|1726072_1727713_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_095907631.1|1727709_1728276_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_013097261.1|1728532_1728700_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_013097260.1|1728772_1729291_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_038985584.1|1729359_1731120_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_013097258.1|1731306_1731759_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_044158562.1|1731822_1732878_-	porin OmpA	NA	NA	NA	NA	NA
WP_013097256.1|1733232_1733742_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_095907632.1|1733959_1734586_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_095907633.1|1734542_1736705_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_013097253.1|1736724_1737171_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_095907634.1|1737293_1739348_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.5	4.6e-18
WP_013097251.1|1739431_1739890_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_047351962.1|1739970_1740633_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_020689684.1|1740803_1741220_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_013097248.1|1741253_1741571_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_095907635.1|1741631_1742822_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_013097246.1|1742914_1743196_+	acylphosphatase	NA	NA	NA	NA	NA
WP_047351965.1|1743192_1743522_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_095907636.1|1743591_1744143_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_095907637.1|1744153_1745311_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_095907638.1|1745312_1748030_-	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_047351968.1|1748102_1748609_-	fimbrial protein	NA	NA	NA	NA	NA
WP_095907639.1|1748683_1749433_-	fimbrial protein	NA	NA	NA	NA	NA
WP_047351970.1|1749735_1750491_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047351971.1|1750487_1750964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013097244.1|1751020_1751680_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	8.9e-48
>prophage 4
NZ_CP017475	Enterobacter cloacae strain M12X01451 chromosome complete genome	4918273	2991563	3032099	4918273	tail,transposase,terminase,head	Cronobacter_phage(37.21%)	53	NA	NA
WP_095907962.1|2991563_2992232_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	58.1	2.4e-77
WP_095907963.1|2992242_2992560_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.8	1.9e-24
WP_095907964.1|2992559_2992799_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	70.5	1.2e-26
WP_095908452.1|2992912_2993275_+	GtrA family protein	NA	U5P0S6	Shigella_phage	82.5	7.6e-49
WP_095907965.1|2993271_2994189_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.1	8.3e-161
WP_095907966.1|2994189_2995827_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	36.4	1.4e-86
WP_095907967.1|2995850_2998070_-	hypothetical protein	NA	B1GS50	Salmonella_phage	68.4	3.8e-58
WP_095907968.1|2998129_3000607_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	89.6	0.0e+00
WP_095907969.1|3000593_3000986_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	89.5	2.8e-65
WP_095907970.1|3000995_3001466_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	91.7	2.0e-78
WP_016245414.1|3001465_3001963_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	3.5e-89
WP_017693207.1|3002004_3002232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907971.1|3002242_3004918_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	39.7	1.1e-104
WP_095908453.1|3004961_3005291_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	57.5	1.8e-25
WP_095907972.1|3005399_3006095_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	56.2	8.2e-68
WP_032104685.1|3006145_3006898_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	45.1	3.4e-43
WP_095907973.1|3006967_3007357_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	49.2	1.2e-31
WP_032668719.1|3007353_3007722_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	78.7	1.4e-47
WP_095907975.1|3007963_3008314_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.2	5.8e-38
WP_006820518.1|3008313_3008487_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
WP_045907349.1|3008486_3008867_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	7.0e-29
WP_095907976.1|3008869_3009235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006808954.1|3009244_3010342_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.5	7.6e-161
WP_095907977.1|3010352_3010787_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	72.2	2.8e-50
WP_095907978.1|3010790_3011987_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	48.0	1.4e-91
WP_044704353.1|3012079_3012274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907979.1|3012305_3013316_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.4	2.2e-114
WP_063452463.1|3013233_3014682_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	50.8	4.3e-119
WP_095907980.1|3014693_3016262_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.0	1.3e-302
WP_063618545.1|3016258_3016909_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	91.7	1.7e-104
WP_095907981.1|3017028_3017541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907982.1|3017587_3017806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064347.1|3018011_3018530_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
WP_047642424.1|3018826_3019204_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	39.3	8.8e-16
WP_080298902.1|3019200_3019731_-	lysozyme	NA	I6PBN2	Cronobacter_phage	62.9	9.1e-51
WP_032141950.1|3019708_3020029_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	79.0	3.7e-39
WP_087451024.1|3020824_3021945_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_045286848.1|3022665_3023103_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.9	4.6e-77
WP_058691359.1|3023390_3023588_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_095907983.1|3023657_3024053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032628892.1|3024185_3024842_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.9	1.6e-17
WP_095907984.1|3024845_3025511_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	45.7	1.0e-46
WP_095907985.1|3025522_3026233_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	35.2	5.5e-19
WP_006809793.1|3026244_3026397_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
WP_095907986.1|3026393_3028175_+	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	50.5	3.5e-123
WP_095907987.1|3028386_3028704_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	58.4	8.7e-33
WP_095907988.1|3028700_3028892_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	64.4	2.7e-13
WP_045897004.1|3028888_3029131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131657929.1|3029446_3029839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907989.1|3029801_3030041_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	4.9e-12
WP_095907990.1|3030050_3030407_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_015571535.1|3030512_3030758_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	67.9	9.4e-27
WP_045348797.1|3030803_3032099_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	68.9	5.1e-180
>prophage 5
NZ_CP017475	Enterobacter cloacae strain M12X01451 chromosome complete genome	4918273	3123911	3132173	4918273		Enterobacteria_phage(37.5%)	8	NA	NA
WP_095908017.1|3123911_3124958_-	glycosyltransferase	NA	A0A1V0SL50	Klosneuvirus	25.0	3.1e-10
WP_095908018.1|3124958_3125879_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	26.9	1.3e-15
WP_095908019.1|3125875_3126436_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.2	1.3e-47
WP_095908020.1|3126439_3127318_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_095908021.1|3127370_3128270_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.8	2.0e-29
WP_095908022.1|3128269_3129355_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.5	9.1e-98
WP_013097865.1|3129709_3130606_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	9.0e-43
WP_048971164.1|3130781_3132173_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	4.8e-19
>prophage 6
NZ_CP017475	Enterobacter cloacae strain M12X01451 chromosome complete genome	4918273	3302792	3311875	4918273		Pseudomonas_phage(33.33%)	7	NA	NA
WP_020690664.1|3302792_3305078_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	64.0	1.0e-284
WP_013098012.1|3305185_3306316_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	6.0e-177
WP_013098013.1|3306315_3306570_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	67.9	5.1e-28
WP_095908055.1|3306689_3308381_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9J5	Catovirus	30.7	1.2e-24
WP_095908056.1|3308274_3309831_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9J5	Catovirus	28.0	1.0e-17
WP_095908057.1|3309862_3310792_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013098017.1|3310816_3311875_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	7.7e-09
>prophage 7
NZ_CP017475	Enterobacter cloacae strain M12X01451 chromosome complete genome	4918273	3626368	3724753	4918273	tail,holin,transposase,tRNA,plate,integrase,capsid	Burkholderia_virus(34.09%)	101	3694680:3694697	3733897:3733914
WP_008502493.1|3626368_3627136_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_013098350.1|3627167_3627707_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3627722_3627971_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_013098351.1|3628087_3629449_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014832951.1|3629615_3630407_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_028028086.1|3630425_3631712_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_013098354.1|3631764_3632358_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_013098356.1|3632480_3633359_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_058682797.1|3633444_3635106_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003863121.1|3635244_3635583_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_095908117.1|3635691_3635979_-	RnfH family protein	NA	NA	NA	NA	NA
WP_023325904.1|3635968_3636445_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008502505.1|3636562_3637045_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_087451024.1|3637684_3638805_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_095908118.1|3638889_3640119_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.6	3.5e-207
WP_095908119.1|3640213_3642715_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_095908120.1|3642707_3643784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087451024.1|3643870_3644990_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_147720044.1|3645388_3646375_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_095908123.1|3648311_3649112_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_094916261.1|3649092_3649404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094916275.1|3649790_3650258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095908455.1|3650275_3650668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095908124.1|3650780_3651791_-	taurine catabolism dioxygenase TauD	NA	NA	NA	NA	NA
WP_013098375.1|3651878_3652418_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_062935020.1|3652407_3653763_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_095908125.1|3653871_3655098_-	MFS transporter	NA	NA	NA	NA	NA
WP_095908126.1|3655094_3655700_-	L-threonylcarbamoyladenylate synthase	NA	NA	NA	NA	NA
WP_038980933.1|3655712_3656939_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013098380.1|3656949_3657426_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_023620864.1|3657661_3658441_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_013098382.1|3658479_3659073_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_013098383.1|3659056_3659971_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095908456.1|3660311_3661718_+	MFS transporter	NA	NA	NA	NA	NA
WP_013098385.1|3662076_3662433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095908127.1|3663128_3673769_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_013098387.1|3673852_3675256_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_045294745.1|3675252_3677445_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.2	6.0e-32
WP_094084808.1|3677455_3678625_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_072207871.1|3678948_3679386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040023501.1|3679519_3680251_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013098393.1|3680349_3680769_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_038420464.1|3680850_3682032_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_095908128.1|3682051_3682939_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095908129.1|3683036_3683639_+	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_038420951.1|3683676_3684666_-	transketolase family protein	NA	NA	NA	NA	NA
WP_013098399.1|3684674_3685520_-	transketolase	NA	NA	NA	NA	NA
WP_095908130.1|3685532_3686282_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_095908131.1|3686317_3687649_-	MFS transporter	NA	NA	NA	NA	NA
WP_013098402.1|3687864_3688785_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095908132.1|3689498_3690080_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	9.9e-67
WP_095908457.1|3690129_3690660_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.8	6.5e-41
WP_095908133.1|3690659_3691259_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	55.3	2.7e-59
WP_095908134.1|3691230_3691839_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	62.9	1.8e-66
WP_095908135.1|3691838_3692819_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	71.5	1.5e-67
WP_095908136.1|3692821_3693400_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	1.3e-66
WP_095908137.1|3693392_3694496_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	54.0	2.9e-107
WP_095908138.1|3694486_3694834_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
3694680:3694697	attL	AGGTGCAGATTGCTGCCG	NA	NA	NA	NA
WP_064783922.1|3694888_3695401_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	37.8	2.7e-20
WP_095908139.1|3695400_3696570_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	48.1	1.2e-87
WP_011410692.1|3696557_3696773_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.6e-17
WP_095908140.1|3696769_3697654_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.5	8.9e-51
WP_095908141.1|3697653_3700119_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.0	6.5e-168
WP_095908142.1|3700214_3700349_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_055311824.1|3700314_3700629_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032438844.1|3700727_3701009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048994552.1|3700998_3701292_-	hypothetical protein	NA	A0A1B1PEE7	Pectobacterium_phage	43.5	1.9e-10
WP_001062395.1|3701293_3701815_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.8	1.0e-67
WP_095908143.1|3701814_3703242_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	78.4	5.7e-217
WP_031626631.1|3703231_3703486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032637440.1|3703482_3703947_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	52.3	3.7e-40
WP_000271666.1|3703946_3704393_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
WP_095908144.1|3704394_3704751_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_095908145.1|3704761_3705715_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.6	3.4e-64
WP_095908146.1|3705728_3706826_-	peptidase	NA	A4JWJ9	Burkholderia_virus	49.0	5.6e-95
WP_011410686.1|3707040_3707499_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.6	1.3e-29
WP_095908147.1|3707501_3708323_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	61.5	9.9e-97
WP_095908148.1|3708303_3709800_-	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	61.3	4.5e-172
WP_095908149.1|3709799_3711323_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.4	2.6e-183
WP_095908150.1|3711319_3711865_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.0	2.7e-58
WP_006122433.1|3711864_3712176_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_000175096.1|3712168_3712501_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_095908151.1|3712497_3713148_-	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	29.2	8.3e-06
WP_095908152.1|3713131_3713860_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.2	1.9e-62
WP_095908153.1|3713862_3714213_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.9	6.9e-23
WP_095908154.1|3714588_3715155_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_095908155.1|3715398_3716169_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.7	5.8e-99
WP_063930249.1|3716226_3716493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054181123.1|3716613_3716979_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016191701.1|3717068_3717257_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	69.4	1.8e-17
WP_020803508.1|3717309_3717615_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	59.0	7.1e-24
WP_095908156.1|3717624_3718533_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	54.1	3.4e-74
WP_095908157.1|3718536_3720306_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.6	2.0e-227
WP_095908158.1|3720316_3721483_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.9	6.3e-121
WP_000835317.1|3721485_3721755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803510.1|3721772_3722384_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	7.2e-76
WP_095908159.1|3722462_3722675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095908160.1|3722664_3722868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095908161.1|3723044_3723737_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.6	2.2e-25
WP_071890037.1|3723733_3723949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281697.1|3724363_3724753_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	53.4	3.8e-30
3733897:3733914	attR	AGGTGCAGATTGCTGCCG	NA	NA	NA	NA
>prophage 8
NZ_CP017475	Enterobacter cloacae strain M12X01451 chromosome complete genome	4918273	3997552	4054142	4918273	transposase,protease,tRNA,plate,integrase	Faecalibacterium_phage(20.0%)	54	4010712:4010728	4054220:4054236
WP_003860035.1|3997552_3998050_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_013098661.1|3998144_3998852_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_013098662.1|3998904_3999636_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_023620782.1|3999655_4000603_+	glutathione synthase	NA	NA	NA	NA	NA
WP_013098664.1|4000689_4001250_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006811925.1|4001249_4001666_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_029883139.1|4001676_4002657_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_023620785.1|4002674_4003376_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_013098667.1|4003397_4003964_+	YggT family protein	NA	NA	NA	NA	NA
WP_020687057.1|4003960_4004248_+	YggU family protein	NA	NA	NA	NA	NA
WP_095908227.1|4004260_4004854_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_020687055.1|4004846_4005995_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_023621456.1|4006224_4006941_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_003862421.1|4006997_4007324_-	YggL family protein	NA	NA	NA	NA	NA
WP_020689542.1|4007323_4008043_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_038983528.1|4008181_4009240_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_013098674.1|4009265_4009538_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_013098675.1|4009594_4010671_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
4010712:4010728	attL	CCCTCTCCCTTTGGGAG	NA	NA	NA	NA
WP_013098677.1|4010944_4012201_+	nucleoside permease	NA	NA	NA	NA	NA
WP_095908228.1|4012234_4013038_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_095908229.1|4013015_4013555_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_095908230.1|4013557_4015075_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_013098681.1|4015085_4015961_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_013098682.1|4015957_4016251_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_013098683.1|4016267_4017290_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_023621451.1|4017300_4018164_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013098685.1|4018181_4019543_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_126850964.1|4020004_4021525_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013098687.1|4021514_4022207_+	response regulator	NA	NA	NA	NA	NA
WP_023621449.1|4022305_4024441_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_013098689.1|4024623_4025337_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_095908232.1|4025729_4026692_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_095908233.1|4028337_4029135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908235.1|4030182_4030851_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	32.3	2.0e-23
WP_095908236.1|4030945_4031881_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.1	5.5e-51
WP_095908462.1|4031984_4032293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908237.1|4032417_4032816_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	5.6e-05
WP_095908463.1|4032808_4032988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908238.1|4033351_4033633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908239.1|4033946_4034837_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_095908240.1|4035868_4036315_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_157735664.1|4036445_4036913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908243.1|4037505_4038762_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_095908244.1|4039346_4039844_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_020689513.1|4040413_4040932_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_095908464.1|4041399_4042098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095908246.1|4043026_4043632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095908248.1|4044727_4045339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095908465.1|4045732_4046545_-	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_095908249.1|4046638_4048501_-	bifunctional glutathionylspermidine amidase/synthase	NA	A0A219Y9C1	Aeromonas_phage	23.2	8.5e-19
WP_013098701.1|4048685_4049555_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_048971475.1|4049715_4050048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147720050.1|4050318_4052427_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	48.4	9.8e-64
WP_095907283.1|4052987_4054142_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
4054220:4054236	attR	CTCCCAAAGGGAGAGGG	NA	NA	NA	NA
>prophage 9
NZ_CP017475	Enterobacter cloacae strain M12X01451 chromosome complete genome	4918273	4126376	4183395	4918273	tail,lysis,transposase,protease,tRNA,plate,portal,terminase,head,integrase,capsid	Salmonella_phage(66.67%)	64	4136941:4136959	4170407:4170425
WP_095908273.1|4126376_4128371_-|protease	serine protease	protease	Q2A0D0	Sodalis_phage	24.8	1.8e-19
WP_029883055.1|4128719_4129400_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013098775.1|4129431_4130445_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	8.2e-109
WP_001144069.1|4130681_4130897_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014833324.1|4131013_4132759_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.2	3.7e-77
WP_013098777.1|4132924_4134772_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_095908274.1|4134861_4136037_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	48.6	1.0e-102
WP_020689452.1|4136163_4136670_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4136941:4136959	attL	TGGCAGCAAAATGGCAGCA	NA	NA	NA	NA
WP_015386379.1|4137007_4137226_-	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.6e-25
WP_015386378.1|4137295_4138396_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	91.0	1.5e-180
WP_015386377.1|4138392_4138878_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	88.2	1.7e-72
WP_095908275.1|4138877_4142321_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.2	0.0e+00
WP_095908276.1|4142313_4142433_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	89.7	5.7e-14
WP_007848877.1|4142447_4142750_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_007848874.1|4142804_4143320_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_007848866.1|4143329_4144502_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
WP_032665797.1|4144582_4145335_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	50.6	1.5e-62
WP_058651076.1|4145393_4145981_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	84.6	1.4e-84
WP_095908466.1|4146462_4146879_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	54.7	7.4e-16
WP_095908278.1|4146859_4147297_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	55.9	2.5e-38
WP_095908279.1|4147298_4148681_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	72.2	1.3e-144
WP_014884893.1|4148677_4149283_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	94.0	8.1e-112
WP_058670697.1|4149275_4150184_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.0e-143
WP_095908280.1|4150170_4150530_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	88.1	4.2e-52
WP_032665787.1|4150526_4151105_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	2.0e-104
WP_095908281.1|4151173_4151620_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.7	3.4e-59
WP_039025357.1|4151612_4152044_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	88.1	1.3e-68
WP_045334056.1|4152139_4152568_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	85.0	4.0e-57
WP_095908282.1|4152564_4153080_-	lysozyme	NA	E5G6N1	Salmonella_phage	75.3	6.9e-72
WP_014884902.1|4153060_4153276_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_000868184.1|4153279_4153483_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_014884903.1|4153482_4153950_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_006777754.1|4154048_4154702_-|terminase	Small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_045261922.1|4154705_4155854_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	67.6	3.2e-133
WP_059446323.1|4155869_4156697_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	56.0	7.7e-73
WP_017382378.1|4156846_4158610_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
WP_095908283.1|4158609_4159662_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.6	5.4e-156
WP_004205801.1|4159706_4160045_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_063849401.1|4160044_4161019_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.5	5.5e-54
WP_095908284.1|4161365_4162265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095908285.1|4162402_4162636_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	90.9	6.4e-33
WP_032706399.1|4162647_4162836_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	4.6e-26
WP_095908286.1|4162997_4165406_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.1	0.0e+00
WP_095908287.1|4166256_4166484_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	3.3e-34
WP_095908288.1|4166483_4166717_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	79.2	2.7e-23
WP_000963477.1|4166784_4167126_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	86.7	2.6e-51
WP_015386352.1|4167089_4167290_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_015386351.1|4167297_4167807_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_023206292.1|4167841_4168078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908289.1|4168165_4168816_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	33.5	1.5e-26
WP_023206294.1|4168841_4169387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023206295.1|4169392_4170406_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_095908290.1|4170667_4171513_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
4170407:4170425	attR	TGGCAGCAAAATGGCAGCA	NA	NA	NA	NA
WP_095908291.1|4172090_4172468_-	toxin CbtA	NA	NA	NA	NA	NA
WP_095908292.1|4172519_4172879_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_095908293.1|4172974_4173196_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_095908294.1|4173207_4173687_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_095908295.1|4173698_4174160_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	35.5	9.1e-15
WP_095908296.1|4174170_4174419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908297.1|4174418_4175237_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.1	2.5e-39
WP_095908298.1|4175362_4175836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908299.1|4175998_4178842_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_095908300.1|4179329_4180205_-	GTPase family protein	NA	NA	NA	NA	NA
WP_087451024.1|4182274_4183395_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 1
NZ_CP017473	Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence	169226	4926	87107	169226	transposase,lysis,coat,integrase	Shigella_phage(29.41%)	56	4909:4949	18637:18677
4909:4949	attL	TGAATCGCCACGGATAATCTAGACACTTCCGAGCCGTTGAT	NA	NA	NA	NA
WP_085949497.1|4926_6074_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_095907054.1|6775_7726_-	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	68.8	1.4e-22
WP_095907055.1|9438_10065_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	1.6e-54
WP_095907056.1|10232_10970_-	YadA-like family protein	NA	A0A1V0DXR3	Yersinia_phage	36.0	7.2e-06
WP_095907058.1|11755_12745_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.2	1.3e-47
WP_095907059.1|13017_13593_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	55.1	1.2e-45
WP_095907060.1|17442_18297_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.8	3.0e-80
WP_095907061.1|18293_18578_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	43.7	7.6e-12
WP_095907163.1|18636_19236_+	ParA family plasmid-partitioning AAA ATPase	NA	NA	NA	NA	NA
18637:18677	attR	ATCAACGGCTCGGAAGTGTCTAGATTATCCGTGGCGATTCA	NA	NA	NA	NA
WP_079815492.1|19348_19528_+	Par-like protein	NA	NA	NA	NA	NA
WP_095907062.1|19563_19767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907063.1|19929_24702_-	AIDA repeat-containing protein	NA	NA	NA	NA	NA
WP_095907064.1|24685_25915_-	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_095907065.1|27349_27655_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_095907066.1|27656_27875_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_095907164.1|30136_31066_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.9e-73
WP_095907069.1|31147_31729_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_095907165.1|32084_32279_-	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	42.9	3.2e-06
WP_095907070.1|33621_33801_-	hypothetical protein	NA	A0A2L1IVB6	Escherichia_phage	86.7	3.0e-06
WP_095907071.1|34134_34248_-|lysis	colicin release lysis protein	lysis	NA	NA	NA	NA
WP_157735640.1|34328_34637_+	colicin immunity protein Cui	NA	NA	NA	NA	NA
WP_157735641.1|34662_34860_+	colicin immunity protein Cui	NA	NA	NA	NA	NA
WP_095907074.1|35651_36080_+	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_095907075.1|36648_37692_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_147720008.1|38094_38340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907076.1|39307_41674_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_095907077.1|41692_43735_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_095907061.1|44267_44552_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	43.7	7.6e-12
WP_095907060.1|44548_45403_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.8	3.0e-80
WP_095907078.1|45920_46898_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_095907079.1|47098_47740_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_095907080.1|47815_48538_+	molecular chaperone	NA	NA	NA	NA	NA
WP_095907081.1|48553_51049_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_095907082.1|51045_51981_+	fimbrial protein	NA	NA	NA	NA	NA
WP_095907083.1|52343_52661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907084.1|54253_55762_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_147720010.1|58023_58218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907085.1|58346_58985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907086.1|58972_59308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735642.1|59610_59778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907087.1|61135_61390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907088.1|61525_61870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907089.1|62514_63522_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_095907090.1|63533_64208_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_095907091.1|67011_68034_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	91.8	3.7e-186
WP_095907092.1|68810_69575_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095907093.1|69772_71041_-	MFS transporter	NA	NA	NA	NA	NA
WP_095907094.1|72215_73706_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_095907095.1|74388_79764_-	AIDA repeat-containing protein	NA	NA	NA	NA	NA
WP_095907064.1|79747_80977_-	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_095907096.1|81732_82365_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.2	5.6e-07
WP_000840805.1|82418_82619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095907166.1|82764_83718_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.8	8.0e-74
WP_157735643.1|85794_85932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735645.1|86009_86180_+	colicin immunity protein Cui	NA	NA	NA	NA	NA
WP_095907098.1|86231_87107_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.7	4.1e-72
>prophage 2
NZ_CP017473	Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence	169226	123516	153749	169226	transposase,integrase	Shigella_phage(33.33%)	28	121044:121064	143711:143731
121044:121064	attL	AAGGGCCGGGCAGAGACAGCT	NA	NA	NA	NA
WP_095907172.1|123516_124494_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.3	3.5e-24
WP_095907129.1|124590_124842_+	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_095907130.1|124838_125093_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_095907131.1|126016_126517_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	28.6	1.3e-06
WP_095907132.1|126559_126985_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.2	3.9e-12
WP_095907133.1|127246_127552_+	chorismate mutase	NA	NA	NA	NA	NA
WP_095907134.1|128015_128246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907135.1|130225_131203_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.8	3.0e-84
WP_095907136.1|131199_132405_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.8	1.1e-163
WP_147720012.1|134526_135516_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.3	1.6e-101
WP_095907138.1|135813_136209_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_095907139.1|137043_137550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907061.1|137609_137894_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	43.7	7.6e-12
WP_095907060.1|137890_138745_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.8	3.0e-80
WP_095907140.1|138758_139274_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095907141.1|139631_139940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017694173.1|139974_140205_-	partitioning protein	NA	NA	NA	NA	NA
WP_095907142.1|140257_140878_-	ParA family protein	NA	A2I303	Vibrio_virus	33.3	2.0e-17
WP_095907143.1|142879_143383_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_147720014.1|144196_145372_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
143711:143731	attR	AAGGGCCGGGCAGAGACAGCT	NA	NA	NA	NA
WP_095907145.1|145440_147702_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_095907146.1|147818_148619_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_095907147.1|148626_149505_-	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_095907148.1|150021_150492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095907149.1|150575_151148_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	38.3	8.1e-29
WP_095907150.1|151308_152163_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095907060.1|152613_153468_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.8	3.0e-80
WP_095907061.1|153464_153749_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	43.7	7.6e-12
