The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023392	Lactococcus raffinolactis strain WiKim0068 chromosome, complete genome	2217417	16522	82980	2217417	integrase,tRNA,capsid,plate,holin,portal,tail,protease,head,terminase	Lactococcus_phage(26.67%)	59	16031:16046	18312:18327
16031:16046	attL	AACAAGTAATAAAAAT	NA	NA	NA	NA
WP_096040487.1|16522_17320_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	27.2	1.1e-15
WP_157738460.1|17401_17914_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096039169.1|17873_19394_-	hypothetical protein	NA	NA	NA	NA	NA
18312:18327	attR	ATTTTTATTACTTGTT	NA	NA	NA	NA
WP_096039170.1|19390_20830_-	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	27.2	9.1e-29
WP_096039171.1|20917_24142_-	type I restriction-modification system endonuclease	NA	A0A097BY72	Enterococcus_phage	28.6	1.1e-05
WP_061774409.1|24554_26378_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.6	3.2e-18
WP_061774392.1|26454_26868_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.4	5.1e-25
WP_061774393.1|26995_27430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039173.1|27430_28198_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	2.0e-11
WP_096039174.1|28187_29027_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096039175.1|29063_30065_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096039176.1|30114_30579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039177.1|30795_32424_+	fibronectin/fibrinogen-binding protein	NA	A0A0P0YM59	Yellowstone_lake_phycodnavirus	33.9	1.2e-08
WP_061774399.1|32679_33657_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_061774400.1|33890_34610_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096040488.1|34667_35777_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_096039178.1|35840_36692_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_096040489.1|36699_38202_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_096039179.1|38365_39301_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_061775358.1|39293_39989_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.8	1.3e-28
WP_061775357.1|40064_41165_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_096039180.1|41187_42243_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_096039181.1|42277_42808_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_096039182.1|42970_45256_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_096039183.1|45475_46348_+	phosphoesterase	NA	NA	NA	NA	NA
WP_031365692.1|46413_46941_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_061775352.1|47049_47289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039184.1|47323_47938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061775350.1|47981_48536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157738461.1|48552_50580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039186.1|50915_52955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061774786.1|53160_53418_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_096039187.1|53436_54042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039188.1|56335_57217_-	ROK family protein	NA	NA	NA	NA	NA
WP_061774789.1|57327_59274_-	PTS sugar transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_157738462.1|59478_60951_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.3	6.1e-20
WP_096039190.1|60989_61946_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_096039191.1|62872_64837_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	37.2	4.4e-66
WP_096039192.1|65193_65751_-	hypothetical protein	NA	A0A0N6WMQ4	Lactococcus_phage	32.1	7.1e-14
WP_096039193.1|65762_66095_-|holin	holin	holin	A0A1X9IGI3	Lactococcus_phage	61.8	3.1e-33
WP_096039194.1|66107_67832_-|plate	BppU family phage baseplate upper protein	plate	V9VDC8	Lactococcus_phage	67.1	2.7e-75
WP_096039195.1|67812_68964_-	hypothetical protein	NA	A0A2K9VBZ3	Lactobacillus_phage	42.3	3.3e-45
WP_157738463.1|69075_70143_-	hypothetical protein	NA	A0A1C8E983	Bacillus_phage	47.3	1.6e-86
WP_096039197.1|70139_70832_-|tail	phage tail protein	tail	A0A1B0T6A0	Bacillus_phage	40.0	4.2e-40
WP_096039198.1|70835_73571_-	hypothetical protein	NA	E3W8G4	Leuconostoc_phage	52.3	2.1e-90
WP_096039199.1|73692_73890_-	hypothetical protein	NA	Q0H231	Geobacillus_phage	46.0	2.1e-05
WP_096039200.1|73895_74255_-	hypothetical protein	NA	D2XR24	Bacillus_phage	52.9	1.5e-28
WP_096039201.1|74323_74911_-|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	47.6	5.0e-42
WP_096039202.1|74942_76127_-	hypothetical protein	NA	C5J968	Streptococcus_phage	39.6	5.2e-14
WP_096039203.1|76127_76484_-	hypothetical protein	NA	A0A290FZT5	Caldibacillus_phage	52.9	4.1e-23
WP_096039204.1|76480_76789_-|head	phage head closure protein	head	Q9AZY2	Lactococcus_phage	43.0	3.7e-12
WP_096039205.1|76788_77064_-	hypothetical protein	NA	Q9AZY3	Lactococcus_phage	63.5	2.7e-22
WP_096039206.1|77056_77245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039207.1|77299_78520_-|capsid	phage major capsid protein	capsid	A0A249XUE5	Enterococcus_phage	34.8	7.0e-38
WP_157738464.1|78510_79092_-|head,protease	HK97 family phage prohead protease	head,protease	Q9AZY6	Lactococcus_phage	65.4	5.6e-62
WP_096039208.1|79088_80297_-|portal	phage portal protein	portal	Q9AZY7	Lactococcus_phage	56.4	1.1e-115
WP_096039209.1|80318_82130_-|terminase	terminase large subunit	terminase	Q9AZY8	Lactococcus_phage	52.0	4.1e-167
WP_096039210.1|82130_82502_-	hypothetical protein	NA	A0A0U4JV93	Exiguobacterium_phage	52.2	2.1e-14
WP_096039211.1|82659_82980_-	HNH endonuclease	NA	A0A2I7SC48	Paenibacillus_phage	54.5	3.5e-21
>prophage 2
NZ_CP023392	Lactococcus raffinolactis strain WiKim0068 chromosome, complete genome	2217417	158953	167927	2217417		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
WP_061774451.1|158953_160021_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.0	2.0e-20
WP_096039265.1|160413_160845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039266.1|160858_162028_-	nucleotide sugar dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	49.7	7.8e-95
WP_061774454.1|162354_162825_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	52.9	1.2e-41
WP_096039267.1|162839_165143_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.9	4.2e-92
WP_031365773.1|165355_165592_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_096039268.1|165775_166699_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.0	2.8e-87
WP_061774457.1|166941_167166_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_096039269.1|167165_167927_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	2.0e-30
>prophage 3
NZ_CP023392	Lactococcus raffinolactis strain WiKim0068 chromosome, complete genome	2217417	186188	202879	2217417	capsid,plate,holin,portal,tail,protease,head,terminase	Lactococcus_phage(38.89%)	19	NA	NA
WP_096039280.1|186188_186524_-|holin	holin	holin	A0A1X9IGI3	Lactococcus_phage	62.2	1.1e-33
WP_096039281.1|186534_187707_-|plate	BppU family phage baseplate upper protein	plate	D2IYX9	Enterococcus_phage	44.3	1.8e-27
WP_167372291.1|187699_190018_-	hypothetical protein	NA	A0A1C8E983	Bacillus_phage	45.8	3.4e-86
WP_096039283.1|190014_190710_-|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	35.6	1.7e-28
WP_096039284.1|190713_193449_-	hypothetical protein	NA	E3W8G4	Leuconostoc_phage	52.3	6.1e-90
WP_096039199.1|193570_193768_-	hypothetical protein	NA	Q0H231	Geobacillus_phage	46.0	2.1e-05
WP_096039200.1|193773_194133_-	hypothetical protein	NA	D2XR24	Bacillus_phage	52.9	1.5e-28
WP_096039201.1|194201_194789_-|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	47.6	5.0e-42
WP_096039285.1|194820_195993_-	hypothetical protein	NA	Q9AZY0	Lactococcus_phage	41.9	6.1e-15
WP_096039286.1|195993_196347_-	hypothetical protein	NA	A0A2H4JAN0	uncultured_Caudovirales_phage	43.5	6.7e-18
WP_096039287.1|196346_196658_-|head	phage head closure protein	head	Q9AZY2	Lactococcus_phage	50.7	2.8e-12
WP_096039288.1|196654_196933_-	hypothetical protein	NA	Q9AZY3	Lactococcus_phage	59.8	2.3e-21
WP_096039289.1|196925_197114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039290.1|197171_198404_-|capsid	phage major capsid protein	capsid	A0A249XUE5	Enterococcus_phage	35.1	3.2e-38
WP_157738467.1|198394_198976_-|head,protease	HK97 family phage prohead protease	head,protease	Q9AZY6	Lactococcus_phage	64.9	4.5e-59
WP_096039291.1|198976_200185_-|portal	phage portal protein	portal	Q9AZY7	Lactococcus_phage	59.5	1.8e-115
WP_167372292.1|200208_202026_-|terminase	terminase large subunit	terminase	Q9AZY8	Lactococcus_phage	52.2	8.2e-168
WP_096039293.1|202031_202400_-	hypothetical protein	NA	Q0H265	Geobacillus_phage	51.9	1.1e-15
WP_096039211.1|202558_202879_-	HNH endonuclease	NA	A0A2I7SC48	Paenibacillus_phage	54.5	3.5e-21
>prophage 4
NZ_CP023392	Lactococcus raffinolactis strain WiKim0068 chromosome, complete genome	2217417	380367	389939	2217417	integrase	Lactococcus_phage(80.0%)	13	378468:378494	389150:389176
378468:378494	attL	CAAGGGCTAGTTAAAAGGCTAGTTAAA	NA	NA	NA	NA
WP_096039409.1|380367_380832_-	hypothetical protein	NA	Q9AZI4	Lactococcus_phage	48.6	1.4e-10
WP_096039410.1|381267_382914_-	DNA primase	NA	Q9AZI5	Lactococcus_phage	72.7	3.2e-235
WP_096039411.1|382924_383722_-	hypothetical protein	NA	Q9AZI6	Lactococcus_phage	66.7	2.5e-105
WP_096039412.1|383725_384055_-	hypothetical protein	NA	Q9AZI7	Lactococcus_phage	71.7	1.3e-36
WP_096039413.1|384098_384290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039414.1|384299_384515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039415.1|384528_384813_-	hypothetical protein	NA	Q9AZJ1	Lactococcus_phage	60.2	2.3e-21
WP_096039416.1|384809_385322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039417.1|385560_386259_-	hypothetical protein	NA	R9QNB1	Lactococcus_phage	54.9	5.0e-57
WP_096039418.1|386305_386500_-	transcriptional regulator	NA	R9QNG3	Lactococcus_phage	45.2	6.1e-05
WP_096039419.1|386653_387442_+	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	35.3	2.3e-05
WP_096039420.1|387952_389143_+|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	46.6	1.2e-90
WP_167372334.1|389366_389939_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.6	4.6e-16
389150:389176	attR	CAAGGGCTAGTTAAAAGGCTAGTTAAA	NA	NA	NA	NA
>prophage 5
NZ_CP023392	Lactococcus raffinolactis strain WiKim0068 chromosome, complete genome	2217417	535487	541823	2217417		Streptococcus_phage(83.33%)	8	NA	NA
WP_096039494.1|535487_536414_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	73.9	1.1e-123
WP_061775217.1|536547_537159_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	57.1	4.0e-66
WP_061775224.1|537354_538191_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_167372337.1|538314_539175_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	67.2	6.1e-97
WP_096040505.1|539174_539501_-	DUF972 family protein	NA	M1PFV3	Streptococcus_phage	41.9	4.4e-16
WP_061775215.1|539512_540283_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_061775214.1|540325_541189_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.1	2.8e-65
WP_061775213.1|541175_541823_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	60.0	7.6e-68
>prophage 6
NZ_CP023392	Lactococcus raffinolactis strain WiKim0068 chromosome, complete genome	2217417	1524267	1563559	2217417	integrase,capsid,plate,holin,portal,tail,head,terminase	Lactococcus_phage(37.14%)	48	1523580:1523594	1553641:1553655
1523580:1523594	attL	GTCGATGATGATGAG	NA	NA	NA	NA
WP_061775465.1|1524267_1525974_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-29
WP_096040065.1|1525973_1527878_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	2.1e-49
WP_096040066.1|1527972_1529103_-|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	35.8	7.6e-47
WP_096040067.1|1529226_1530228_-	Abi family protein	NA	X2L062	Streptococcus_phage	39.6	6.5e-58
WP_096040068.1|1530526_1530901_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	90.3	1.7e-56
WP_096040069.1|1530962_1531550_-	hypothetical protein	NA	Q9AZF6	Lactococcus_phage	54.1	5.5e-57
WP_096040070.1|1531562_1531907_-	helix-turn-helix domain-containing protein	NA	A0A1X9IGD3	Lactococcus_phage	79.8	2.8e-45
WP_031366573.1|1532327_1532519_+	hypothetical protein	NA	Q9AZF4	Lactococcus_phage	74.6	5.6e-19
WP_061774530.1|1532533_1532734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040071.1|1532741_1533014_-	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	43.7	2.1e-11
WP_096040072.1|1533204_1533390_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	52.5	1.7e-09
WP_096040073.1|1533462_1533696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040074.1|1533707_1533935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040075.1|1533931_1534204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040076.1|1534323_1534770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040077.1|1534773_1535316_+	HNH endonuclease	NA	A0A218KBW3	Bacillus_phage	41.7	9.6e-32
WP_096040078.1|1535312_1536479_+	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	51.2	1.2e-100
WP_096040079.1|1536511_1537069_+	DUF2815 family protein	NA	Q4ZD46	Staphylococcus_phage	54.3	1.2e-42
WP_096040081.1|1537316_1539236_+	DNA polymerase	NA	D2J043	Enterococcus_phage	55.5	7.5e-188
WP_096040082.1|1539253_1541638_+	DNA primase	NA	D2J048	Enterococcus_phage	52.6	4.7e-115
WP_096040083.1|1541929_1542217_+	VRR-NUC domain-containing protein	NA	D2J049	Enterococcus_phage	46.2	3.9e-16
WP_096040527.1|1542294_1543539_+	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	56.1	2.4e-134
WP_167372312.1|1543625_1543781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167372313.1|1544054_1544432_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096040085.1|1544623_1545328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040086.1|1545427_1545889_+	helix-turn-helix domain-containing protein	NA	Q9AYX3	Lactococcus_phage	69.8	9.0e-55
WP_096040087.1|1545881_1547252_+|terminase	phage terminase large subunit	terminase	B5SP27	Lactococcus_phage	85.6	3.1e-236
WP_096040088.1|1547266_1548721_+|portal	phage portal protein	portal	A0A1S5SAI0	Streptococcus_phage	55.1	1.3e-144
WP_157738520.1|1548713_1550417_+	hypothetical protein	NA	A0A1P8BLD7	Lactococcus_phage	52.2	5.2e-164
WP_096040090.1|1550420_1550639_+	hypothetical protein	NA	A0A1P8BLD4	Lactococcus_phage	81.9	9.5e-31
WP_096040091.1|1550824_1551388_+	scaffolding protein	NA	D2J060	Enterococcus_phage	37.1	2.5e-22
WP_096040092.1|1551405_1552320_+|capsid	capsid protein	capsid	Q20DD4	Lactobacillus_phage	53.4	1.6e-82
WP_096040093.1|1552643_1553174_+	hypothetical protein	NA	D2J063	Enterococcus_phage	46.6	3.0e-38
WP_096040094.1|1553170_1553488_+|head,tail	phage head-tail adapter protein	head,tail	A0A1S5S9Y9	Streptococcus_phage	35.6	5.5e-11
WP_096040095.1|1553487_1553886_+	HK97 gp10 family phage protein	NA	A0A1S5SAB8	Streptococcus_phage	59.4	2.5e-37
1553641:1553655	attR	GTCGATGATGATGAG	NA	NA	NA	NA
WP_096040096.1|1553885_1554263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040097.1|1554263_1554884_+	hypothetical protein	NA	A0A1S5S9Y8	Streptococcus_phage	48.7	1.1e-47
WP_096040098.1|1554939_1555182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040099.1|1555178_1555700_+	hypothetical protein	NA	D2J068	Enterococcus_phage	27.5	7.1e-08
WP_143188716.1|1555768_1556017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157738521.1|1555973_1558271_+|tail	phage tail protein	tail	A5GYM8	Lactococcus_phage	68.8	9.9e-78
WP_096040101.1|1558272_1559133_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_157738522.1|1559162_1559663_+	hypothetical protein	NA	B6D7I8	Listeria_phage	33.8	3.2e-13
WP_096040103.1|1559659_1560703_+	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	34.7	3.2e-47
WP_096040104.1|1560713_1561586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040105.1|1561607_1562009_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	62.3	3.2e-40
WP_096040106.1|1562005_1563271_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTP4	Lactococcus_phage	60.2	2.5e-139
WP_167372314.1|1563388_1563559_+	hypothetical protein	NA	A0A182BQ76	Lactococcus_phage	61.1	3.1e-05
>prophage 7
NZ_CP023392	Lactococcus raffinolactis strain WiKim0068 chromosome, complete genome	2217417	2085205	2094127	2217417		Enterococcus_phage(28.57%)	10	NA	NA
WP_061774280.1|2085205_2087023_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	37.2	1.7e-88
WP_096040406.1|2087144_2087837_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	50.0	1.4e-64
WP_061774282.1|2087936_2088578_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_061774283.1|2088681_2088900_+	glutaredoxin-like protein NrdH	NA	A0A1W6JHV4	Lactococcus_phage	47.6	1.3e-11
WP_061774284.1|2088896_2089253_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	D9J0S1	Brochothrix_phage	35.2	3.7e-16
WP_061774285.1|2089257_2091411_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.4	5.2e-254
WP_167372353.1|2091531_2092491_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	67.1	1.1e-123
WP_096040408.1|2092546_2093416_-	glutathione-dependent reductase	NA	NA	NA	NA	NA
WP_004260832.1|2093451_2093589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096040409.1|2093716_2094127_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	46.6	1.1e-30
>prophage 1
NZ_CP023394	Lactococcus raffinolactis strain WiKim0068 plasmid pWiKim0068-2, complete sequence	27065	0	17370	27065	transposase	Staphylococcus_phage(42.86%)	14	NA	NA
WP_096040596.1|229_1186_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_096040581.1|1318_2200_+	ROK family protein	NA	NA	NA	NA	NA
WP_096040582.1|2939_5927_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.2	1.2e-19
WP_096040583.1|5966_7514_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.3	7.4e-101
WP_096040584.1|7510_8749_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.2	4.6e-29
WP_096040585.1|8762_9608_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_072353702.1|10604_11024_+	helix-turn-helix transcriptional regulator	NA	A0A0D4DD29	Staphylococcus_phage	35.3	4.4e-08
WP_096040586.1|11365_12649_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_072353682.1|12766_13609_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	47.9	4.8e-54
WP_096040587.1|13713_13926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040588.1|14103_14784_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.6e-108
WP_096040589.1|15016_16192_-	dipeptidyl aminopeptidase	NA	NA	NA	NA	NA
WP_096040597.1|16307_16610_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040087761.1|16824_17370_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.9	3.1e-30
>prophage 2
NZ_CP023394	Lactococcus raffinolactis strain WiKim0068 plasmid pWiKim0068-2, complete sequence	27065	21352	21631	27065		Hokovirus(100.0%)	1	NA	NA
WP_096040598.1|21352_21631_+	ATP-binding domain-containing protein	NA	A0A1V0SG90	Hokovirus	44.4	3.0e-05
