The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023357	Escherichia coli strain 317 chromosome, complete genome	5035905	1376573	1383713	5035905		Escherichia_phage(83.33%)	6	NA	NA
WP_001279002.1|1376573_1377212_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	3.7e-83
WP_000590411.1|1377208_1378471_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|1378467_1379376_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001298167.1|1379571_1380339_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001141304.1|1380389_1381046_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_000106696.1|1381151_1383713_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 2
NZ_CP023357	Escherichia coli strain 317 chromosome, complete genome	5035905	1972102	1981544	5035905		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569381.1|1972102_1973029_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	2.6e-08
WP_096037539.1|1973033_1973765_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1973745_1973853_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|1973912_1974644_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001295431.1|1974865_1976551_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1976547_1977267_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1977313_1977784_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1977824_1978286_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_021552841.1|1978410_1980411_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	94.5	0.0e+00
WP_021552840.1|1980407_1981544_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.9e-162
>prophage 3
NZ_CP023357	Escherichia coli strain 317 chromosome, complete genome	5035905	1993566	2057449	5035905	integrase,head,holin,portal,plate,lysis,terminase,tail,capsid,tRNA	Escherichia_phage(34.88%)	71	2020906:2020933	2055916:2055943
WP_096037540.1|1993566_1995600_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	2.0e-53
WP_001005448.1|1995731_1996841_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001046487.1|1997103_1997385_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830479.1|1997678_1998221_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677332.1|1998301_1998976_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945380.1|1998991_2001472_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405729.1|2001487_2002522_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|2002603_2002942_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_096037541.1|2003160_2003985_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|2004105_2004378_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195581.1|2004600_2005389_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822281.1|2005385_2006186_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001297940.1|2006250_2007069_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434049.1|2007120_2007867_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011943.1|2007840_2008806_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846205.1|2008802_2009807_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	2.2e-13
WP_000858523.1|2009803_2011081_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|2011337_2012390_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289800.1|2012616_2013471_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853833.1|2013499_2014762_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182909.1|2014771_2015224_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823289.1|2015254_2015539_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_021516270.1|2015542_2016898_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_125097882.1|2016945_2018064_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|2018084_2018864_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807341.1|2018945_2019845_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_001441996.1|2020260_2020578_+	hypothetical protein	NA	NA	NA	NA	NA
2020906:2020933	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_096037542.1|2021012_2022026_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	5.4e-193
WP_001306384.1|2022141_2022441_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|2022555_2022831_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217684.1|2023008_2023509_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_000557701.1|2023572_2023797_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277895.1|2023796_2024099_+	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	96.0	5.0e-46
WP_001113264.1|2024098_2024323_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|2024319_2024595_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_096037543.1|2024584_2026897_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	96.7	0.0e+00
WP_000237502.1|2026951_2028199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000017834.1|2028185_2030006_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_059217470.1|2030348_2031383_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	7.9e-200
WP_096037544.1|2031382_2033155_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085948.1|2033328_2034183_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_059329788.1|2034241_2035315_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI8	Enterobacteria_phage	99.4	4.3e-201
WP_000203428.1|2035318_2036062_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_000988633.1|2036161_2036671_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|2036670_2036874_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|2036877_2037159_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|2037158_2037656_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_096037545.1|2037670_2038096_+	protein lysA	NA	U5N096	Enterobacteria_phage	97.2	9.5e-59
WP_096037546.1|2038083_2038509_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	6.1e-66
WP_072174950.1|2038480_2038654_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_059327998.1|2038616_2039084_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	1.3e-80
WP_024245776.1|2039076_2039529_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_042023919.1|2039609_2040689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037547.1|2040834_2041470_+|plate	phage baseplate assembly protein V	plate	Q858V7	Yersinia_virus	98.1	7.6e-113
WP_000127164.1|2041466_2041814_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121504.1|2041818_2042727_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.2e-161
WP_001285335.1|2042719_2043250_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.3	7.3e-101
WP_000104708.1|2043260_2045996_+|tail	tail protein	tail	Q858V4	Yersinia_virus	81.7	0.0e+00
WP_001164151.1|2045999_2046527_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	92.0	4.9e-89
WP_000711880.1|2046948_2047791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042023923.1|2047897_2048482_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.5	3.0e-07
WP_096037548.1|2048504_2048882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037549.1|2049212_2050403_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	97.7	1.1e-221
WP_001251408.1|2050415_2050934_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2050990_2051266_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_096037550.1|2051298_2051418_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	5.2e-15
WP_096037551.1|2051410_2053858_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_001744561.1|2053872_2054352_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	2.5e-84
WP_096037552.1|2054351_2055515_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	1.8e-205
WP_000468308.1|2055596_2055815_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476019.1|2056087_2057449_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
2055916:2055943	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
>prophage 4
NZ_CP023357	Escherichia coli strain 317 chromosome, complete genome	5035905	3026077	3069799	5035905	integrase,head,portal,lysis,terminase,tail,capsid,tRNA	Enterobacteria_phage(51.92%)	59	3055596:3055610	3066590:3066604
WP_000654175.1|3026077_3026356_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	9.9e-25
WP_001519693.1|3026352_3028413_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_096037577.1|3028471_3031954_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_000090917.1|3032014_3032647_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_001519691.1|3032583_3033327_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152619.1|3033332_3034031_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847330.1|3034030_3034360_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_000840199.1|3034356_3036924_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.5	0.0e+00
WP_000459484.1|3036916_3037351_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000479168.1|3037332_3037755_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	1.2e-69
WP_001298481.1|3037770_3038511_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.6e-128
WP_000683140.1|3038518_3038914_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	4.2e-69
WP_000985116.1|3038910_3039489_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752960.1|3039500_3039854_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000158869.1|3039865_3040261_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063225.1|3040302_3041328_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	6.9e-188
WP_001298472.1|3041383_3041716_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_000123275.1|3041725_3043045_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.0e-231
WP_001298484.1|3043025_3044627_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	3.5e-311
WP_000198149.1|3044623_3044830_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027310.1|3044826_3046752_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000867508.1|3046726_3047272_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.9	1.2e-79
WP_000881607.1|3047834_3048017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3048223_3048550_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|3049030_3049324_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|3049414_3049597_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135283.1|3049813_3050311_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_000839596.1|3050310_3050526_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|3051114_3052197_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|3052385_3052769_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971056.1|3052854_3052995_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3052991_3053354_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774485.1|3053350_3053641_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
WP_000224917.1|3053633_3053804_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
WP_001053041.1|3053803_3054259_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_000182282.1|3054526_3054904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000608370.1|3054900_3055329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788796.1|3055407_3056121_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
3055596:3055610	attL	CTTCACGCGCCAGCT	NA	NA	NA	NA
WP_001546578.1|3056117_3057047_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	5.6e-112
WP_001546577.1|3057133_3057673_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	1.5e-61
WP_001067458.1|3057742_3057973_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858971.1|3058077_3058767_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	6.2e-92
WP_000654526.1|3058889_3059912_+	hypothetical protein	NA	U5P4L0	Shigella_phage	52.3	3.3e-97
WP_000841195.1|3059933_3060440_+	hypothetical protein	NA	U5P455	Shigella_phage	34.0	4.1e-08
WP_000233576.1|3060920_3061127_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3061202_3061499_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100844.1|3061504_3062290_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186848.1|3062286_3062967_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001546576.1|3062963_3063092_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	92.9	1.7e-16
WP_001308571.1|3063320_3063602_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000763374.1|3063700_3063922_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|3063921_3064248_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|3064231_3064471_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|3064610_3064847_+	excisionase	NA	NA	NA	NA	NA
WP_001546574.1|3064836_3065979_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.7	8.1e-206
WP_000444487.1|3066092_3067343_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
3066590:3066604	attR	CTTCACGCGCCAGCT	NA	NA	NA	NA
WP_096037578.1|3067514_3068168_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3068177_3068639_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|3068692_3069799_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP023357	Escherichia coli strain 317 chromosome, complete genome	5035905	3076872	3127663	5035905	integrase,head,holin,portal,terminase,tail,capsid	Escherichia_phage(40.43%)	57	3083806:3083823	3135892:3135909
WP_000531594.1|3076872_3078009_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799399.1|3077992_3078856_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_042022540.1|3079496_3080171_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	77.7	1.6e-97
WP_096037579.1|3080167_3080392_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096037580.1|3080401_3081862_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	70.1	7.7e-100
WP_042022545.1|3082003_3082144_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_042022546.1|3082341_3085818_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	86.2	0.0e+00
3083806:3083823	attL	GGTGATGGCGCTGGTCAC	NA	NA	NA	NA
WP_072019665.1|3086061_3086700_-|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	97.8	1.6e-94
WP_034173014.1|3086597_3087341_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	4.0e-145
WP_042022549.1|3087346_3088045_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	89.2	2.1e-119
WP_034172976.1|3088250_3089414_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	4.2e-141
WP_042022550.1|3089639_3089969_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	81.7	8.4e-47
WP_086522870.1|3089965_3092548_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.9	0.0e+00
WP_086522869.1|3092528_3092942_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	1.2e-42
WP_042022552.1|3092968_3093397_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.6	1.6e-42
WP_096037581.1|3093412_3094162_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	96.0	1.0e-132
WP_096037582.1|3094169_3094565_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	81.7	7.4e-58
WP_042022554.1|3094561_3095095_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.0e-57
WP_042022556.1|3095110_3095464_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_042022558.1|3095456_3095840_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_042022562.1|3095891_3096920_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	2.9e-114
WP_000256840.1|3096977_3097325_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_096037583.1|3097361_3098867_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_001374583.1|3098856_3100449_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_000258997.1|3100445_3100652_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_096037584.1|3100635_3102564_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	2.4e-258
WP_096037585.1|3102535_3103045_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_077781212.1|3104016_3104550_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_122997789.1|3104706_3104892_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	1.6e-18
WP_042022572.1|3105410_3105944_-	lysozyme	NA	A0A088CC28	Shigella_phage	93.2	2.9e-97
WP_042022574.1|3105948_3106164_-|holin	holin	holin	G9L6J5	Escherichia_phage	98.6	2.0e-33
WP_042022576.1|3106241_3106547_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_052434569.1|3106570_3106747_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	62.3	5.2e-11
WP_042022578.1|3106909_3108853_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	69.4	1.7e-264
WP_042022580.1|3110995_3112054_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.7	4.3e-193
WP_042022581.1|3112204_3112402_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	5.2e-28
WP_042022582.1|3112576_3113290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037587.1|3113543_3114209_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	1.8e-59
WP_042022587.1|3114205_3114565_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	1.1e-36
WP_096037588.1|3114577_3115627_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.7e-109
WP_042022591.1|3115628_3115907_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	5.7e-12
WP_042022595.1|3116042_3116300_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_042022597.1|3117474_3117687_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	4.9e-32
WP_042022598.1|3117736_3118093_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_086522856.1|3118150_3118576_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	2.6e-64
WP_042022600.1|3118616_3119702_-	DNA-binding protein	NA	V5URT9	Shigella_phage	61.0	5.9e-113
WP_000344866.1|3119781_3120177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034173003.1|3120411_3120837_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032223163.1|3120820_3121144_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	8.0e-10
WP_042022608.1|3121269_3121746_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_034173016.1|3122065_3122218_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_052434572.1|3122217_3122589_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	49.0	4.0e-05
WP_000449168.1|3123304_3123493_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3123489_3123678_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_096037589.1|3123773_3126245_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_042022621.1|3126306_3126576_+	excisionase	NA	NA	NA	NA	NA
WP_042022623.1|3126544_3127663_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	45.0	2.4e-85
3135892:3135909	attR	GTGACCAGCGCCATCACC	NA	NA	NA	NA
>prophage 6
NZ_CP023357	Escherichia coli strain 317 chromosome, complete genome	5035905	3481517	3516831	5035905	integrase,portal,lysis,terminase,coat	Enterobacteria_phage(59.32%)	59	3513395:3513411	3521418:3521434
WP_096037595.1|3481517_3481778_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	95.3	4.4e-35
WP_096037596.1|3481867_3483865_-	DNA transfer protein	NA	Q716G2	Shigella_phage	96.7	0.0e+00
WP_021527634.1|3483864_3485259_-	hypothetical protein	NA	A0A220NR03	Salmonella_phage	65.2	2.4e-151
WP_021527635.1|3485271_3485925_-	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	59.3	8.5e-59
WP_021527636.1|3485899_3486379_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.7	4.2e-63
WP_021527637.1|3486378_3487332_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.2	5.9e-93
WP_001122392.1|3487331_3488750_-	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.8	1.9e-276
WP_021527638.1|3488759_3489221_-	phage DNA stabilization protein	NA	A5VW70	Enterobacteria_phage	99.3	2.7e-83
WP_001389518.1|3489201_3489390_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_001462595.1|3489431_3490685_-|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.6	2.7e-234
WP_021527640.1|3490703_3491597_-	phage scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	95.6	1.0e-123
WP_021527641.1|3491687_3493886_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.3	0.0e+00
WP_021552855.1|3493887_3495303_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.4	7.5e-278
WP_000113731.1|3495299_3495740_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|3495742_3495985_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000877024.1|3496241_3496772_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_021527643.1|3496974_3497412_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	97.2	3.2e-70
WP_024186729.1|3497408_3497906_-	lysozyme	NA	I6R0P2	Salmonella_phage	98.8	4.9e-91
WP_000286100.1|3497883_3498087_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_021527644.1|3498578_3499091_-	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	99.4	1.4e-96
WP_000027543.1|3499285_3499804_-	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	98.8	5.9e-95
WP_000994517.1|3499800_3499989_-	protein ninH	NA	A5VW84	Enterobacteria_phage	95.2	1.0e-25
WP_001008194.1|3499985_3500348_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	2.7e-62
WP_096037597.1|3500344_3500635_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	4.9e-51
WP_021527646.1|3500627_3500840_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	2.8e-35
WP_021527647.1|3500832_3501042_-	protein ninF	NA	G9L691	Escherichia_phage	95.7	4.5e-30
WP_021527648.1|3501001_3501403_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	99.2	4.1e-72
WP_001254220.1|3501405_3501582_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_021527649.1|3501578_3501989_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	1.0e-70
WP_021527650.1|3501991_3502258_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	63.8	6.6e-26
WP_021527651.1|3502275_3502482_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	4.6e-27
WP_001036028.1|3502554_3502824_-	hypothetical protein	NA	G9L682	Escherichia_phage	100.0	2.9e-45
WP_021527652.1|3502823_3504260_-	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	99.6	8.8e-274
WP_096037598.1|3504249_3505149_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	99.3	1.0e-163
WP_000166207.1|3505141_3505288_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000189606.1|3505320_3505617_-	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_001535911.1|3505738_3505969_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	100.0	7.9e-36
WP_024226607.1|3506048_3506756_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	100.0	4.8e-132
WP_021556103.1|3507017_3507461_+	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	1.6e-45
WP_001278766.1|3507577_3508072_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_000972063.1|3508372_3508507_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|3508491_3508644_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000604111.1|3508728_3509037_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_021527656.1|3509033_3509945_+	hypothetical protein	NA	K7PKG9	Enterobacteria_phage	99.3	2.8e-169
WP_021527657.1|3509928_3510411_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.9	1.0e-77
WP_024186733.1|3510422_3510737_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
WP_021527658.1|3510753_3511035_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	3.7e-43
WP_021527659.1|3511031_3511196_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_021527660.1|3511192_3511615_+	hypothetical protein	NA	G8EYH3	Enterobacteria_phage	73.0	6.1e-42
WP_021527661.1|3511611_3511923_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	91.0	1.1e-45
WP_021527662.1|3511915_3512560_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	97.7	3.7e-131
WP_021571722.1|3512556_3513156_+	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	76.0	3.5e-27
WP_021527664.1|3513152_3513692_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	83.6	1.7e-60
3513395:3513411	attL	TGTGCTGGCGCTGCTGG	NA	NA	NA	NA
WP_000212745.1|3513693_3513981_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_024189442.1|3514401_3514935_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.9	1.3e-52
WP_000492058.1|3514996_3515239_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	78.8	5.8e-29
WP_032165504.1|3515357_3515525_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	3.7e-27
WP_001325331.1|3515564_3515783_+	excisionase	NA	Q77WA4	Escherichia_phage	98.6	3.7e-35
WP_049045042.1|3515760_3516831_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.1e-201
3521418:3521434	attR	CCAGCAGCGCCAGCACA	NA	NA	NA	NA
>prophage 7
NZ_CP023357	Escherichia coli strain 317 chromosome, complete genome	5035905	4032220	4087045	5035905	transposase,plate,protease	Streptococcus_phage(20.0%)	45	NA	NA
WP_000406621.1|4032220_4032907_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024186735.1|4033083_4033362_-	microcin McmA	NA	NA	NA	NA	NA
WP_085961388.1|4034837_4035987_+|transposase	IS3-like element ISEc16 family transposase	transposase	U5P429	Shigella_phage	40.9	5.2e-51
WP_001335133.1|4036864_4037899_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	43.4	1.4e-71
WP_071587598.1|4038179_4038422_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_021552738.1|4039419_4041840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094283866.1|4042009_4043540_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	2.8e-44
WP_000282079.1|4043748_4044312_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335706.1|4045281_4046715_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000120393.1|4046963_4047191_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_021552736.1|4047296_4047524_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000258743.1|4048215_4049853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893298.1|4051036_4052290_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001285288.1|4052301_4053405_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749900.1|4053693_4054749_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_000174703.1|4054787_4055189_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189578.1|4055246_4056491_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291991.1|4056582_4057041_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292999.1|4057301_4058759_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602124.1|4058815_4059430_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001335538.1|4059426_4060578_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
WP_001059895.1|4060755_4061208_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000554758.1|4061618_4061912_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226168.1|4061963_4063019_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001298192.1|4063089_4063860_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_096037610.1|4063819_4065559_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006241.1|4065780_4066278_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000093934.1|4066453_4067203_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225679.1|4067514_4068255_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001298195.1|4068225_4068993_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4069197_4069776_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973131.1|4070015_4072460_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532690.1|4072502_4072976_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_096037611.1|4073129_4073870_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001298174.1|4074140_4074629_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000227712.1|4074722_4075226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513317.1|4076476_4076767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528851.1|4076741_4078181_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000571853.1|4078173_4079220_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000053627.1|4079326_4081309_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.2e-24
WP_001142963.1|4081529_4082048_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000041480.1|4082757_4083261_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000111582.1|4083283_4084768_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001189667.1|4084772_4085198_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000863399.1|4085203_4087045_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 1
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	0	3721	100008		Rhodobacter_phage(50.0%)	3	NA	NA
WP_000312330.1|1501_2134_+	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	8.1e-30
WP_077781167.1|2304_2508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042021185.1|2746_3721_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	44.8	2.0e-72
>prophage 2
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	8148	16140	100008		Vibrio_phage(25.0%)	11	NA	NA
WP_096037668.1|8148_8712_+	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	39.3	2.3e-20
WP_096037669.1|9223_9457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037670.1|9521_10055_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.8	6.8e-46
WP_000005990.1|10112_10346_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_096037671.1|10409_12368_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	2.1e-20
WP_000845914.1|12422_12857_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_042021717.1|12853_13573_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000775238.1|13847_14009_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_096037723.1|14491_14686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069934604.1|14912_15200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042021726.1|15318_16140_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	2.0e-44
>prophage 3
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	23935	24157	100008		Vibrio_virus(100.0%)	1	NA	NA
WP_001278695.1|23935_24157_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
>prophage 4
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	33038	33461	100008		Salmonella_phage(100.0%)	1	NA	NA
WP_059320930.1|33038_33461_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	86.7	7.9e-66
>prophage 5
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	52365	53112	100008		Xanthomonas_phage(100.0%)	1	NA	NA
WP_096037699.1|52365_53112_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.6	3.2e-09
>prophage 6
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	60010	67051	100008	protease	Enterobacteria_phage(33.33%)	6	NA	NA
WP_096037705.1|60010_60550_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	36.4	7.1e-11
WP_096037726.1|60912_61239_+	reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096037706.1|61238_62045_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	27.5	6.9e-10
WP_096037707.1|62870_63506_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096037708.1|63608_64862_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_096037709.1|64861_67051_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.8	2.6e-27
>prophage 7
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	73617	77580	100008	transposase	Escherichia_phage(33.33%)	3	NA	NA
WP_157740259.1|73617_74571_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	9.2e-179
WP_096037715.1|75724_76369_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.1e-54
WP_042020968.1|76353_77580_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.6	1.8e-62
>prophage 8
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	82712	86828	100008		Enterobacterial_phage(100.0%)	1	NA	NA
WP_096037719.1|82712_86828_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.1	0.0e+00
>prophage 9
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	93598	94928	100008		Enterobacteria_phage(100.0%)	2	NA	NA
WP_157740265.1|93598_94363_+	hypothetical protein	NA	Q9LA53	Enterobacteria_phage	71.1	6.0e-64
WP_042021198.1|94445_94928_+	hypothetical protein	NA	Q9MCI7	Enterobacteria_phage	66.7	4.4e-52
>prophage 10
NZ_CP023358	Escherichia coli strain 317 plasmid p100, complete sequence	100008	98533	99340	100008	integrase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_077781165.1|98533_99340_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	98.2	1.6e-54
