The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023386	Escherichia coli strain 1190 chromosome, complete genome	4900891	1137142	1144282	4900891		Escherichia_phage(83.33%)	6	NA	NA
WP_001278992.1|1137142_1137781_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
WP_000590400.1|1137777_1139040_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_000847985.1|1139036_1139945_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1140140_1140908_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141344.1|1140958_1141615_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	3.9e-51
WP_001272916.1|1141720_1144282_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 2
NZ_CP023386	Escherichia coli strain 1190 chromosome, complete genome	4900891	1181047	1296191	4900891	terminase,portal,tail,tRNA,plate,capsid,head,lysis,integrase	Escherichia_phage(20.75%)	115	1223156:1223171	1275267:1275282
WP_000047169.1|1181047_1183678_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1183912_1184098_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|1185388_1185955_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287455.1|1185951_1186380_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|1186452_1188009_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|1188158_1188674_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1188737_1190276_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|1190292_1191465_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1191591_1192122_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119745.1|1192212_1192548_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1192537_1193275_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000169334.1|1193398_1194583_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216531.1|1195035_1196028_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774975.1|1196085_1197150_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985490.1|1197142_1198345_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777950.1|1198700_1199660_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.2	2.9e-132
WP_000246562.1|1199669_1201814_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	3.8e-196
WP_000080944.1|1201786_1202197_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|1202193_1202439_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|1202686_1203016_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1203167_1203512_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492658.1|1203548_1203998_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1204665_1205070_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229454.1|1205116_1205641_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|1205650_1205950_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1206132_1206291_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522417.1|1206374_1206824_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
WP_000156815.1|1206824_1207487_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001469552.1|1207507_1208908_-	GABA permease	NA	NA	NA	NA	NA
WP_000097678.1|1209145_1210426_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
WP_000772849.1|1210439_1211888_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271899.1|1211910_1213179_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001469551.1|1213198_1214176_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000491450.1|1214511_1216764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526532.1|1219871_1220039_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	73.8	3.5e-09
WP_001131441.1|1220301_1220421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024186566.1|1220485_1225054_+	adhesin-like autotransporter YpjA/EhaD	NA	NA	NA	NA	NA
1223156:1223171	attL	ACCTTTTCCATTGCCG	NA	NA	NA	NA
WP_000162574.1|1225791_1226274_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600189.1|1226405_1226882_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1226871_1227162_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1227223_1227565_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880913.1|1227713_1229375_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1229460_1230339_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1230461_1231055_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1231109_1232396_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1232416_1233208_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1233374_1234736_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1234984_1235233_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1235251_1235800_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1235830_1236598_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1236639_1236987_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000948616.1|1237192_1237915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972008.1|1237952_1238171_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	81.9	8.6e-32
WP_000884169.1|1238247_1239420_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.3	9.0e-168
WP_000978925.1|1239422_1239887_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	78.4	4.5e-62
WP_000069481.1|1239898_1242328_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	79.5	6.2e-280
WP_000763326.1|1242320_1242440_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_000361834.1|1242481_1242754_-|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	78.8	1.3e-29
WP_001207671.1|1242816_1243335_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	80.2	3.0e-75
WP_001286665.1|1243347_1244535_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.8	1.0e-190
WP_001195984.1|1244599_1245178_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	80.8	3.5e-80
WP_000982368.1|1245204_1245705_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.5	4.0e-56
WP_001030515.1|1245704_1246307_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.7	4.9e-93
WP_001106837.1|1246278_1246719_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.3	1.6e-53
WP_000208951.1|1246740_1247700_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	50.8	6.4e-87
WP_000066790.1|1247696_1248308_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	1.5e-94
WP_001273711.1|1248300_1249209_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	82.1	4.6e-135
WP_000213440.1|1249213_1249561_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	2.8e-40
WP_001097317.1|1249557_1250199_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.6	2.3e-96
WP_001366609.1|1250275_1251619_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997681.1|1251656_1252124_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.4	8.3e-48
WP_000277801.1|1252116_1252584_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	9.7e-57
WP_000849742.1|1252691_1253105_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	60.6	7.6e-37
WP_000534553.1|1253101_1253611_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.1	2.1e-76
WP_000524754.1|1253594_1253816_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001019825.1|1253806_1254010_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	79.1	6.1e-24
WP_000177981.1|1254009_1254510_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	2.9e-59
WP_000224817.1|1254607_1255366_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	66.4	6.6e-79
WP_001224498.1|1255369_1256575_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	62.0	1.4e-126
WP_001085420.1|1256606_1257470_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	63.1	1.5e-98
WP_000214162.1|1257634_1259404_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	80.8	8.5e-287
WP_000042185.1|1259403_1260432_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.8	4.1e-164
WP_000609549.1|1260488_1261175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235290.1|1261171_1262155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000232871.1|1262526_1262709_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	83.3	3.9e-22
WP_001366581.1|1262898_1265046_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	88.2	0.0e+00
WP_000786065.1|1265047_1265269_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	79.5	2.2e-27
WP_001246240.1|1265268_1265496_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	96.0	3.8e-30
WP_000085637.1|1265565_1265766_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	95.5	3.3e-30
WP_000916540.1|1265752_1265980_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	89.3	2.5e-34
WP_000459330.1|1265987_1266497_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	94.1	2.4e-85
WP_000188833.1|1266532_1266757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021529281.1|1266882_1267461_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	49.5	2.5e-46
WP_000111946.1|1267465_1268503_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	76.5	4.8e-157
WP_001408077.1|1268492_1269422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589822.1|1269625_1270108_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969047.1|1270123_1271350_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1271339_1271858_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1272007_1272373_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|1272581_1273652_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225222.1|1273662_1274784_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200110.1|1274827_1275988_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
1275267:1275282	attR	ACCTTTTCCATTGCCG	NA	NA	NA	NA
WP_001386991.1|1276087_1276135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1276238_1276580_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1276850_1277588_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079109.1|1277722_1278703_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040165.1|1278699_1279431_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1279560_1282134_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841106.1|1287935_1289234_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
WP_001221085.1|1289230_1289554_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1289599_1290955_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082985.1|1291068_1293729_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|1293760_1294459_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1294527_1294947_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997418.1|1295153_1296191_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP023386	Escherichia coli strain 1190 chromosome, complete genome	4900891	1524714	1567809	4900891	terminase,lysis,portal,holin,coat,integrase	Enterobacteria_phage(60.0%)	59	1529347:1529362	1567985:1568000
WP_001559548.1|1524714_1526148_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.3	5.3e-29
WP_001274877.1|1526363_1527278_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197031.1|1527349_1528597_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001316510.1|1528676_1528829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163428.1|1529126_1529327_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
1529347:1529362	attL	GGAATCGAACCTGCAA	NA	NA	NA	NA
WP_001281200.1|1529450_1529795_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_016262221.1|1529821_1529989_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.8e-26
WP_096057884.1|1530088_1530700_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	68.6	2.6e-33
WP_001593200.1|1530701_1531001_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.4e-56
WP_096057885.1|1530997_1531543_-	hypothetical protein	NA	J9Q748	Salmonella_phage	82.1	4.6e-82
WP_096057886.1|1531539_1531971_-	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	83.9	6.0e-61
WP_001214452.1|1531967_1532132_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_001111299.1|1532142_1532439_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	3.9e-51
WP_000951323.1|1532462_1532846_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_000031367.1|1532845_1533451_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_001308813.1|1533707_1533983_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
WP_053878831.1|1534219_1534516_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	98.0	2.1e-49
WP_000394305.1|1534555_1534807_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	1.4e-41
WP_096057887.1|1535097_1535481_-	antitermination protein	NA	G9L671	Escherichia_phage	99.2	1.5e-63
WP_001245922.1|1535928_1536363_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|1536378_1537218_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_094322871.1|1537330_1538044_-	LexA family transcriptional regulator	NA	A4KWS0	Enterobacteria_phage	99.6	1.8e-131
WP_000437871.1|1538144_1538345_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_000189606.1|1538482_1538779_+	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_000166207.1|1538811_1538958_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000067067.1|1538950_1539811_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.3	9.6e-159
WP_001331794.1|1539918_1541799_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	100.0	0.0e+00
WP_000736913.1|1541876_1542317_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000113772.1|1542453_1542630_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001543886.1|1542632_1543034_+	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	98.5	6.0e-71
WP_001563210.1|1542993_1543203_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_096057889.1|1543195_1543918_+	DNA-binding protein	NA	K7PL51	Enterobacteria_phage	92.5	3.3e-120
WP_096057890.1|1543917_1544208_+	DUF1364 domain-containing protein	NA	K7P7N7	Enterobacteria_phage	99.0	5.8e-52
WP_001008194.1|1544204_1544567_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|1544563_1544752_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235461.1|1544748_1545372_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|1546344_1546668_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1546651_1547128_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_096057892.1|1547124_1547562_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.9	6.5e-71
WP_021527496.1|1547549_1547702_+	hypothetical protein	NA	K7PHR3	Enterobacteria_phage	98.0	3.6e-21
WP_089583698.1|1547906_1548431_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.8	1.2e-87
WP_000807789.1|1548730_1548973_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
WP_089616539.1|1548976_1549264_+	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	2.2e-06
WP_032178582.1|1549273_1549453_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	93.2	4.6e-23
WP_000729920.1|1549476_1549965_+	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_000417850.1|1549942_1551442_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	1.2e-305
WP_096057893.1|1551442_1553608_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.4	0.0e+00
WP_000373006.1|1553621_1554533_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_027662812.1|1554532_1555828_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	2.7e-242
WP_096057894.1|1555872_1556097_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	69.3	4.0e-24
WP_001054834.1|1556074_1556575_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_096057895.1|1556575_1557994_+	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	98.7	7.8e-275
WP_096057896.1|1557993_1558947_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.2	1.3e-92
WP_096057897.1|1558946_1559402_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.2e-87
WP_096057898.1|1559404_1560097_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	97.8	4.3e-109
WP_096057899.1|1560106_1561438_+	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	99.1	7.7e-216
WP_096057900.1|1561438_1563832_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.6	0.0e+00
WP_086200620.1|1565743_1566337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096057901.1|1566651_1567809_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.4	2.0e-220
1567985:1568000	attR	GGAATCGAACCTGCAA	NA	NA	NA	NA
>prophage 4
NZ_CP023386	Escherichia coli strain 1190 chromosome, complete genome	4900891	1806332	1815775	4900891		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569373.1|1806332_1807259_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783103.1|1807263_1807995_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1807975_1808083_-	protein YohO	NA	NA	NA	NA	NA
WP_001240388.1|1808142_1808874_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	8.2e-111
WP_001295431.1|1809095_1810781_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1810777_1811497_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1811543_1812014_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1812055_1812517_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001604659.1|1812641_1814642_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
WP_001468956.1|1814638_1815775_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	4.5e-164
>prophage 5
NZ_CP023386	Escherichia coli strain 1190 chromosome, complete genome	4900891	2342471	2410169	4900891	terminase,portal,tail,protease,lysis,integrase	Enterobacteria_phage(44.0%)	77	2354653:2354668	2391655:2391670
WP_001260849.1|2342471_2343293_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233092.1|2343392_2343476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743948.1|2343568_2343904_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091841.1|2344300_2345554_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019557.1|2345660_2346554_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225257.1|2346688_2347909_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2348033_2348729_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071556282.1|2348681_2349974_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148702.1|2350132_2350747_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
WP_000526478.1|2350789_2351644_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2351645_2352263_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
2354653:2354668	attL	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_000041647.1|2354758_2357185_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001295396.1|2357383_2357689_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|2357796_2358507_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2358509_2359070_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705205.1|2359104_2359446_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2359580_2359907_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001469153.1|2360112_2361327_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|2361338_2362358_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2362415_2362526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774504.1|2362545_2363826_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|2363860_2364097_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001774503.1|2364184_2366656_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001296931.1|2366748_2366940_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2366936_2367125_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_157740064.1|2367611_2368187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2368188_2368344_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448563.1|2368510_2368918_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2369001_2369232_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705346.1|2369215_2369737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2369717_2370683_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001774502.1|2370723_2371146_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	3.4e-61
WP_001774471.1|2371383_2372718_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	2.0e-06
WP_157740066.1|2373310_2373418_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	1.1e-08
WP_000884073.1|2373462_2373675_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000980999.1|2373891_2374143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309521.1|2374209_2374488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774470.1|2374489_2375539_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	5.7e-113
WP_001047131.1|2375552_2376305_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
WP_120795389.1|2376582_2376672_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2376726_2376939_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2377239_2377455_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2378208_2378424_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_001309518.1|2378407_2378740_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.3	1.1e-25
WP_001092973.1|2378736_2379270_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	8.4e-97
WP_001071769.1|2379266_2379764_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2380126_2380339_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|2380349_2380538_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2380685_2380841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2381013_2381187_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2381482_2381689_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000421823.1|2382239_2382779_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
WP_023277784.1|2382787_2384887_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
WP_001072975.1|2384883_2385096_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985929.1|2385095_2386604_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_096057908.1|2386548_2388576_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.2	0.0e+00
WP_023140705.1|2388662_2388986_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
WP_001283153.1|2388978_2389254_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_023140704.1|2389265_2389844_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079419.1|2389840_2390242_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_021560209.1|2390252_2390996_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001300035.1|2391056_2391443_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|2391451_2391781_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
2391655:2391670	attR	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_021574610.1|2391752_2394818_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_000447253.1|2394817_2395147_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_096057909.1|2395156_2395855_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	5.1e-134
WP_096057910.1|2395860_2396604_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	4.3e-147
WP_001399694.1|2396501_2397149_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_096057911.1|2397209_2400608_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.3	0.0e+00
WP_096057912.1|2400674_2401274_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_096057913.1|2401338_2404737_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	6.3e-12
WP_000885601.1|2404736_2405312_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	97.4	4.1e-105
WP_000078177.1|2405409_2406000_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2406316_2406550_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2406618_2406732_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2407336_2408620_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527815.1|2408708_2410169_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.0	2.5e-42
>prophage 6
NZ_CP023386	Escherichia coli strain 1190 chromosome, complete genome	4900891	2822174	2879038	4900891	terminase,portal,tail,tRNA,plate,protease,transposase,head,holin,integrase	Shigella_phage(55.77%)	73	2845208:2845224	2886437:2886453
WP_001469313.1|2822174_2822498_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	1.8e-41
WP_095501568.1|2822600_2822792_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	4.4e-24
WP_000834396.1|2823575_2825465_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_071556291.1|2825498_2825690_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	83.3	1.9e-14
WP_010376608.1|2826222_2826570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001045545.1|2826535_2827144_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.3	7.6e-94
WP_019843047.1|2827143_2827893_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.7	1.2e-53
WP_000383560.1|2827896_2828481_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785316.1|2828471_2829530_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.6	8.1e-200
WP_000424732.1|2829516_2829942_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000643721.1|2829941_2830490_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.7	3.6e-95
WP_000999527.1|2830489_2831569_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	6.9e-207
WP_001469317.1|2831565_2832894_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	98.6	2.7e-245
WP_000679480.1|2832952_2833483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807179.1|2833574_2835407_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	97.4	5.3e-300
WP_000661054.1|2835548_2835818_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|2835817_2836174_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155713.1|2836173_2837670_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.0	4.5e-273
WP_096057916.1|2837653_2837824_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000779279.1|2837832_2838393_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000235781.1|2838389_2838896_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	6.5e-91
WP_000702406.1|2838870_2839281_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	98.5	7.7e-74
WP_000927711.1|2839277_2839601_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601358.1|2839603_2839804_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.0e-26
WP_001193635.1|2841072_2841723_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.6	2.4e-117
WP_000466255.1|2841700_2842942_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|2842941_2843124_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_103852454.1|2843135_2844632_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.2	4.8e-299
WP_000929184.1|2844865_2845360_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
2845208:2845224	attL	TTCTTCAGCGAACCACT	NA	NA	NA	NA
WP_001135215.1|2845485_2845836_-	HNH endonuclease	NA	U5P4L6	Shigella_phage	95.7	7.5e-62
WP_115770954.1|2845862_2846135_-	peptidase	NA	Q8SBD8	Shigella_phage	98.9	4.8e-40
WP_001469324.1|2846019_2846412_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	96.9	1.1e-61
WP_001157006.1|2846395_2846872_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	95.6	1.0e-85
WP_001120491.1|2846875_2847202_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	6.8e-57
WP_000862379.1|2847499_2848315_+	toll/interleukin-1 receptor domain-containing protein	NA	K7PLZ9	Enterobacterial_phage	59.6	6.2e-83
WP_087604723.1|2848355_2848724_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	82.5	1.1e-52
WP_024185234.1|2848738_2849728_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	3.4e-192
WP_001061405.1|2849735_2850533_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.6e-150
WP_000767111.1|2850552_2850942_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_000210156.1|2850938_2851265_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_001440426.1|2851264_2851759_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	1.6e-86
WP_000104947.1|2851755_2852697_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	9.5e-144
WP_001250271.1|2852686_2852866_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	6.0e-15
WP_000515851.1|2853041_2853599_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.8	1.1e-96
WP_000649477.1|2853642_2853843_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848744.1|2853933_2854608_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	2.7e-132
WP_000549626.1|2854842_2855049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|2855020_2855455_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000135680.1|2855923_2856286_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081255.1|2856351_2857176_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	7.3e-148
WP_000008223.1|2857304_2857853_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	96.6	2.8e-95
WP_021552251.1|2857896_2858142_+	phage excisionase	NA	NA	NA	NA	NA
WP_000741312.1|2858122_2859250_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.3	1.1e-122
WP_001177766.1|2859365_2860262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180570.1|2860236_2860701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340437.1|2861222_2861837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000444487.1|2861960_2863211_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248703.1|2863382_2864036_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476085.1|2864045_2864507_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001469332.1|2864560_2865667_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2865702_2866344_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2866347_2867718_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|2867887_2868559_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735413.1|2868558_2870019_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2870094_2871216_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359452.1|2871264_2872491_-	peptidase T	NA	NA	NA	NA	NA
WP_000531596.1|2872740_2873877_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|2873860_2874718_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000580316.1|2874714_2875509_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759309.1|2875505_2876552_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_001366277.1|2876609_2877071_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000720218.1|2877067_2877853_+	membrane protein	NA	NA	NA	NA	NA
WP_000399660.1|2878057_2879038_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2886437:2886453	attR	TTCTTCAGCGAACCACT	NA	NA	NA	NA
>prophage 7
NZ_CP023386	Escherichia coli strain 1190 chromosome, complete genome	4900891	3069788	3157886	4900891	terminase,portal,tail,tRNA,plate,protease,capsid,head,holin,integrase	Enterobacteria_phage(68.97%)	90	3101879:3101898	3139704:3139723
WP_001469538.1|3069788_3070574_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899598.1|3070709_3071465_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3071465_3072359_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011612.1|3072512_3073259_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3073255_3073438_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056542.1|3073489_3074722_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570552.1|3074758_3075745_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551266.1|3075741_3077490_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705748.1|3077526_3079791_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3079998_3080283_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3080442_3082116_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3082226_3082910_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001353317.1|3083082_3083847_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445213.1|3084015_3085299_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057132.1|3085369_3086458_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	2.0e-81
WP_000642852.1|3086656_3087349_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001469537.1|3087478_3089239_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3089644_3090502_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292809.1|3090556_3092839_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111043.1|3093030_3093771_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000918526.1|3093980_3095411_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109286.1|3095620_3096769_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3097083_3097710_+	hydrolase	NA	NA	NA	NA	NA
WP_000534643.1|3097744_3098608_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213096.1|3098609_3099227_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	2.9e-77
WP_000850305.1|3099237_3101682_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
3101879:3101898	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000023738.1|3101981_3102974_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.5	2.0e-104
WP_000247830.1|3103043_3103385_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	47.1	2.5e-17
WP_001204238.1|3103488_3104010_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096057918.1|3104014_3104437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287827.1|3104443_3104635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096057919.1|3104770_3105121_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	94.0	1.6e-56
WP_000158971.1|3105131_3105419_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|3105430_3105673_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|3105669_3105783_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000543036.1|3105876_3106287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3106310_3106514_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|3106510_3106777_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_021514993.1|3106773_3107073_+	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.1e-40
WP_001036814.1|3107084_3107297_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	86.6	7.6e-25
WP_021514992.1|3107293_3108118_+|protease	serine protease	protease	A0A0A7NPW9	Enterobacteria_phage	96.3	8.7e-125
WP_106884340.1|3108173_3108794_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	2.6e-09
WP_021563452.1|3108790_3109156_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	2.5e-60
WP_157740070.1|3109162_3111985_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.8	0.0e+00
WP_033806518.1|3112061_3113021_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_000211256.1|3113025_3113337_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_001561007.1|3113400_3113736_+	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	95.4	2.6e-51
WP_024169082.1|3113902_3114313_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_096057920.1|3114309_3114654_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000236495.1|3115265_3115790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096057921.1|3115804_3116851_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.5e-202
WP_096057922.1|3116850_3118602_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_001262655.1|3118756_3119593_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055125.1|3119615_3120668_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	93.7	2.7e-187
WP_096057923.1|3120713_3121514_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	1.4e-124
WP_001388919.1|3121616_3122111_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.5e-89
WP_096057924.1|3122110_3122311_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.3e-31
WP_000104350.1|3122313_3122637_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_096057925.1|3122633_3123026_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000780561.1|3123022_3123430_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	1.4e-64
WP_096057926.1|3123567_3124035_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	2.2e-85
WP_000356339.1|3124027_3124663_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_096057927.1|3124659_3125241_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	2.9e-103
WP_000213447.1|3125237_3125588_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001508666.1|3125591_3126488_+|plate	baseplate J-like family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	4.6e-156
WP_096057928.1|3126480_3127008_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	87.7	3.1e-83
WP_001508667.1|3127018_3129676_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	71.6	1.7e-278
WP_000885638.1|3129675_3130293_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_136755949.1|3130989_3131478_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	5.2e-85
WP_096057930.1|3131490_3134298_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.4	0.0e+00
WP_000333503.1|3134284_3134440_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_042028455.1|3134448_3134823_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	1.5e-36
WP_000290462.1|3134878_3135391_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005406.1|3135390_3136575_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.4e-224
WP_096057931.1|3136732_3137842_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	2.4e-194
WP_001057124.1|3138036_3138702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000488101.1|3138851_3139112_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078911.1|3139302_3139443_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	4.5e-18
WP_000886683.1|3139745_3141038_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
3139704:3139723	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000067755.1|3141128_3142472_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3142482_3143094_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_019843100.1|3143252_3147398_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3147532_3148027_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3148571_3149537_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043584.1|3149659_3151426_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202145.1|3151426_3153148_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.3	9.9e-22
WP_001241678.1|3153189_3153894_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3154178_3154397_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3155258_3157535_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3157565_3157886_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 8
NZ_CP023386	Escherichia coli strain 1190 chromosome, complete genome	4900891	3872062	3948973	4900891	transposase,tRNA,plate,protease	Ralstonia_phage(11.11%)	60	NA	NA
WP_000420957.1|3872062_3873199_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000425547.1|3873479_3873878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000981126.1|3873878_3874127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001605072.1|3878185_3878635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001605069.1|3882361_3884470_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001142958.1|3884679_3885198_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037390.1|3885894_3886395_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000718847.1|3886429_3886636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056997.1|3886704_3888180_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611735.1|3888186_3888600_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393830.1|3888603_3890454_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348802.1|3890417_3891500_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113718.1|3891524_3892805_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3892801_3893326_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246418.1|3893328_3894660_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343291.1|3894664_3895426_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614408.1|3895434_3898200_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.9	1.0e-81
WP_000088865.1|3898196_3898940_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240537.1|3898944_3900357_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122987793.1|3900465_3903900_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087587.1|3903910_3905263_+	membrane protein	NA	NA	NA	NA	NA
WP_000002621.1|3905286_3905769_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_024186579.1|3905996_3906728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236629.1|3906737_3907205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086162.1|3907353_3908139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024185250.1|3908674_3909406_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	1.5e-40
WP_000917883.1|3909470_3909938_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|3909934_3910657_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052732.1|3910690_3911446_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3911517_3912876_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211700.1|3912922_3913693_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3913770_3914571_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648583.1|3914811_3915726_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997027.1|3915722_3916526_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
WP_001140178.1|3922285_3922858_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3923045_3924077_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3924069_3924723_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3924762_3925578_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3925695_3926100_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000093980.1|3926096_3926804_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260707.1|3926914_3928633_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001469015.1|3928685_3929510_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239194.1|3929539_3930250_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|3930263_3930686_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185309.1|3930682_3931228_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3931393_3931594_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062311.1|3931580_3931841_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176528.1|3931889_3933188_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3933252_3933642_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020990.1|3933698_3935840_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055746.1|3935938_3936898_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3936910_3940393_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569428.1|3940429_3941026_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.5	6.7e-26
WP_000139686.1|3941022_3942171_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3942170_3942959_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3942962_3943418_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139287.1|3943522_3944548_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3944551_3945037_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3945158_3947591_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3947620_3948973_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 9
NZ_CP023386	Escherichia coli strain 1190 chromosome, complete genome	4900891	4292197	4361200	4900891	transposase,tRNA,protease	Vibrio_phage(18.75%)	56	NA	NA
WP_000998019.1|4292197_4293583_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|4293821_4295180_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937727.1|4295558_4295768_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
WP_000555341.1|4295930_4296188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4297937_4298459_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068913.1|4298455_4299409_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|4299495_4301820_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|4301864_4302767_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4302763_4303762_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684855.1|4303758_4304715_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
WP_000175457.1|4304715_4305483_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4306039_4306297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947616.1|4307230_4308386_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001293436.1|4308540_4310538_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|4310600_4311014_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|4310948_4312116_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_032147325.1|4312429_4312687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|4312739_4312865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|4312907_4314026_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000179691.1|4314037_4315255_-	MFS transporter	NA	NA	NA	NA	NA
WP_000547193.1|4315881_4317210_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001318460.1|4321767_4322787_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000896738.1|4322790_4323354_-	gluconokinase	NA	NA	NA	NA	NA
WP_001197411.1|4323570_4324602_+	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000998695.1|4324625_4325390_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001128347.1|4325452_4326772_+	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_001309159.1|4326838_4327837_+	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001294573.1|4327914_4329417_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
WP_001295681.1|4329577_4330660_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|4330659_4331760_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|4332026_4333538_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|4333891_4334335_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416387.1|4334334_4337190_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000079655.1|4337245_4338442_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059412.1|4338634_4339138_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4339183_4339600_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012907.1|4339761_4340766_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000036448.1|4340821_4342417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326836.1|4342539_4342992_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256681.1|4343136_4343730_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500687.1|4343800_4344514_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|4344644_4345040_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|4345320_4345455_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|4345458_4346394_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4346406_4346868_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4346940_4347327_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000399660.1|4347604_4348585_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000471889.1|4348812_4351509_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4351649_4351703_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181312.1|4351887_4352835_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001299664.1|4352953_4354375_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001366536.1|4354424_4356080_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187791.1|4356473_4358612_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106226.1|4358769_4359234_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_001232255.1|4359278_4359665_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162171.1|4359847_4361200_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
