The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023371	Escherichia coli strain 1283 chromosome, complete genome	4677088	1059840	1073023	4677088		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1059840_1060602_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1060595_1061222_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1061361_1062501_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1062563_1063556_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1063649_1065014_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1065102_1065879_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1065883_1066522_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1066518_1067781_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1067777_1068686_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1068881_1069649_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1069699_1070356_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1070461_1073023_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP023371	Escherichia coli strain 1283 chromosome, complete genome	4677088	1673247	1683465	4677088	transposase	Enterobacteria_phage(75.0%)	11	NA	NA
WP_000569356.1|1673247_1674174_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1674178_1674910_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1674890_1674998_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1675057_1675789_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1676010_1677696_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1677692_1678412_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1678458_1678929_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000741419.1|1678968_1679439_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	3.6e-75
WP_103758571.1|1679480_1680177_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	1.1e-131
WP_001446943.1|1680331_1682332_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292769.1|1682328_1683465_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 3
NZ_CP023371	Escherichia coli strain 1283 chromosome, complete genome	4677088	1779454	1787335	4677088	transposase	Escherichia_phage(42.86%)	7	NA	NA
WP_023149888.1|1779454_1780861_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	2.8e-38
WP_023149889.1|1781084_1782149_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	7.5e-105
WP_004175258.1|1782175_1783045_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_004175259.1|1783076_1783967_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175260.1|1783981_1784536_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_044067410.1|1784715_1785882_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	1.2e-111
WP_096058022.1|1786354_1787335_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.2e-184
>prophage 4
NZ_CP023371	Escherichia coli strain 1283 chromosome, complete genome	4677088	2904131	2989892	4677088	lysis,tRNA,portal,capsid,terminase,plate,tail,head,protease,integrase	Salmonella_phage(60.0%)	88	2897094:2897109	2992463:2992478
2897094:2897109	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|2904131_2905424_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2905514_2906858_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2906868_2907480_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|2907638_2911628_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2911762_2912257_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2912801_2913767_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043592.1|2913889_2915656_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_001202175.1|2915656_2917378_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|2917419_2918124_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2918408_2918627_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|2919311_2921588_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2921618_2921939_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2922261_2922486_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188144.1|2922558_2924505_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746443.1|2924501_2925617_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001380339.1|2925767_2926724_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599825.1|2926720_2928379_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|2928804_2929500_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|2929994_2930894_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|2931037_2932690_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178676.1|2932701_2933670_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815337.1|2933802_2935521_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000566366.1|2935557_2936559_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|2936569_2938000_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|2938098_2939112_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001252135.1|2939108_2939939_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|2939935_2940259_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|2940384_2940900_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|2941117_2941846_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|2941863_2942595_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|2942601_2943318_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|2943317_2943986_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001352074.1|2944276_2945008_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149682.1|2945206_2946334_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_000389260.1|2946374_2946863_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|2946922_2947768_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|2947764_2948718_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|2948727_2949861_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126072.1|2949955_2951068_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|2951418_2951895_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|2951982_2952885_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|2952945_2953668_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|2953651_2953939_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|2954098_2954356_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|2954385_2954763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|2955032_2956718_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|2956953_2957172_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_040082401.1|2957262_2958363_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.1	1.1e-172
WP_032248587.1|2958359_2958845_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_096058028.1|2958841_2961919_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|2961911_2962031_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_032248585.1|2962045_2962348_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.9	1.6e-39
WP_001207660.1|2962402_2962918_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|2962927_2964100_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_040082412.1|2964242_2964809_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	8.4e-87
WP_001340317.1|2965315_2965549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032248699.1|2965529_2965940_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	4.9e-20
WP_001086824.1|2967456_2968062_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_000268280.1|2968054_2968963_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_000177590.1|2968949_2969309_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993775.1|2969305_2969884_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829141.1|2969952_2970399_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_001039935.1|2970391_2970823_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_001080935.1|2970918_2971347_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
WP_000727853.1|2971343_2971721_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001396370.1|2971722_2972196_-	lysozyme	NA	E5G6N1	Salmonella_phage	89.7	5.4e-79
WP_000171568.1|2972215_2972431_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2972434_2972638_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|2972637_2973102_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_032248697.1|2973197_2973848_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.4	3.6e-110
WP_000742511.1|2973851_2974910_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216257.1|2974926_2975760_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_001098431.1|2975902_2977669_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_032248696.1|2977668_2978697_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.5	6.9e-172
WP_032248695.1|2978728_2980402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032248694.1|2980722_2981883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001154428.1|2982053_2982242_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	93.4	5.1e-25
WP_096058029.1|2982395_2984810_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
WP_032183034.1|2984806_2985664_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	7.3e-159
WP_000752619.1|2985660_2985888_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244224.1|2985887_2986121_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|2986188_2986530_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|2986647_2986944_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460893.1|2986951_2987461_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|2987525_2987729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346406.1|2987874_2988444_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000900883.1|2988459_2988651_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001459604.1|2988839_2989892_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.1e-105
2992463:2992478	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 5
NZ_CP023371	Escherichia coli strain 1283 chromosome, complete genome	4677088	3533604	3646660	4677088	lysis,portal,capsid,terminase,tail,holin,head,integrase	Enterobacteria_phage(40.68%)	110	3594971:3595017	3642758:3642804
WP_000131044.1|3533604_3535638_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3535766_3536354_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3536367_3537840_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3537853_3539524_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3539736_3540405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3540647_3541343_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3541335_3542763_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3542773_3543493_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3544019_3544874_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3545099_3546425_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3546533_3546770_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3546781_3547375_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3547964_3548816_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000020221.1|3548955_3553212_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3554327_3554429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3554792_3555056_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3555055_3555196_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3555230_3555458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730972.1|3557674_3558262_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3558319_3558988_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3559013_3561539_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3561528_3563172_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3563140_3563851_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3564163_3564493_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3564740_3565355_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3565772_3566462_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3566458_3567415_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|3567411_3569610_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3569619_3570576_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3570554_3570965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032739138.1|3571638_3573174_+	recombinase family protein	NA	NA	NA	NA	NA
WP_032673146.1|3573174_3574047_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_044067310.1|3574055_3574928_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_044067311.1|3574931_3576536_-	sporadically distributed, TIGR04141 family protein	NA	NA	NA	NA	NA
WP_001415597.1|3576556_3577189_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_012134292.1|3577185_3578298_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_044067315.1|3578290_3579679_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.4	2.4e-50
WP_077253585.1|3579678_3579957_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_044067317.1|3580635_3581148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157695.1|3581619_3582714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044067131.1|3582706_3583951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279388.1|3584134_3584572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044067136.1|3584540_3585812_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_044067138.1|3586116_3586782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044067140.1|3586839_3587253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052044.1|3587350_3587749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096058033.1|3587749_3589381_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_044067885.1|3589377_3590691_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032739159.1|3590692_3591898_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001075424.1|3592278_3592485_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001412615.1|3592575_3593433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001412614.1|3593581_3594796_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.4	3.8e-129
3594971:3595017	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001619161.1|3595764_3596610_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	38.0	5.0e-35
WP_001041461.1|3596602_3597001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957441.1|3597000_3597666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000834404.1|3598596_3600486_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001185479.1|3601088_3602120_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	37.3	1.2e-11
WP_061363451.1|3605977_3606577_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	7.5e-110
WP_061363450.1|3606643_3610042_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.1	0.0e+00
WP_122991788.1|3610102_3610705_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_061363449.1|3610641_3611385_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	2.6e-144
WP_032271385.1|3611390_3612089_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	2.2e-129
WP_000847352.1|3612088_3612418_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	1.1e-57
WP_000840239.1|3612414_3614976_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.4	0.0e+00
WP_000459458.1|3614968_3615403_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479155.1|3615384_3615807_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_001446995.1|3615822_3616563_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	2.1e-130
WP_000683105.1|3616570_3616966_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975085.1|3616962_3617541_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	5.9e-80
WP_000753001.1|3617552_3617906_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
WP_000158886.1|3617917_3618313_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.9	1.2e-52
WP_000063273.1|3618354_3619380_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_001380322.1|3619435_3619768_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_000123280.1|3619777_3621097_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
WP_096058034.1|3621077_3622679_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.0e-307
WP_000198149.1|3622675_3622882_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027290.1|3622878_3624804_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453576.1|3624778_3625324_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001663509.1|3625712_3625946_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3626002_3626413_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3626763_3626916_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001446997.1|3626903_3627341_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	95.9	3.0e-68
WP_001197767.1|3627337_3627814_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.5	1.9e-84
WP_001120502.1|3627817_3628153_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_021548833.1|3628229_3629282_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.3	6.3e-205
WP_000917724.1|3629432_3629636_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001446998.1|3629904_3630846_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_001208502.1|3630867_3631317_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_085949407.1|3631352_3631721_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_001571227.1|3631735_3632725_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	9.5e-195
WP_001061412.1|3632732_3633530_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	1.5e-150
WP_061363473.1|3633549_3633939_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	1.3e-67
WP_000210148.1|3633935_3634262_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.0e-52
WP_001573323.1|3634261_3634756_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000104985.1|3634752_3635709_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	96.5	7.6e-149
WP_001250269.1|3635698_3635878_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515847.1|3636053_3636605_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_000205494.1|3636642_3636843_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3636940_3637567_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000559916.1|3637794_3638310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3638779_3639142_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_096058035.1|3639207_3640032_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.9e-149
WP_000008200.1|3640159_3640696_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3640686_3641049_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|3641048_3641354_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_077873866.1|3641269_3641704_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_000051887.1|3641580_3642744_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|3642948_3644202_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3642758:3642804	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3644213_3645317_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|3645604_3646660_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
>prophage 6
NZ_CP023371	Escherichia coli strain 1283 chromosome, complete genome	4677088	3656794	3723386	4677088	transposase,tRNA,plate	uncultured_Caudovirales_phage(20.0%)	56	NA	NA
WP_000006255.1|3656794_3657292_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|3657467_3658217_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3658426_3658687_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3658689_3658968_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3659123_3659864_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3659834_3660602_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3660807_3661386_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3661625_3664070_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|3664112_3664586_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3664739_3665510_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3665550_3666687_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3667117_3667510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|3667487_3671720_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_000103354.1|3671795_3673937_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3674146_3674665_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3675359_3675860_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3675894_3676119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3676169_3677645_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3677651_3678065_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3678068_3679919_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3679882_3680965_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113719.1|3680989_3682270_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3682266_3682791_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246442.1|3682793_3684125_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3684129_3684891_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3684899_3687665_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3687661_3688405_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3688409_3689822_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|3689930_3693365_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3693375_3694728_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3694751_3695234_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|3695277_3696192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236645.1|3696201_3696681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|3696817_3697603_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|3698139_3698871_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3698935_3699403_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|3699399_3700122_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3700155_3700911_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3700982_3702341_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|3702388_3703012_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|3703015_3703816_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3704056_3704971_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3704967_3705771_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|3711531_3712107_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3712294_3713326_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3713318_3713972_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3714011_3714827_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3714944_3715349_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_001260712.1|3716941_3718660_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|3718713_3719538_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|3719737_3720448_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|3720461_3720884_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3720880_3721426_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3721591_3721792_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3721778_3722039_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|3722087_3723386_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP023372	Escherichia coli strain 1283 plasmid p109, complete sequence	109207	53987	85331	109207	transposase,protease	Stx2-converting_phage(28.57%)	31	NA	NA
WP_023149734.1|53987_55559_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_072142979.1|56262_56496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|56739_56889_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|57172_57430_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032336874.1|57665_57740_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000410951.1|59499_60720_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000440183.1|60730_61642_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000154545.1|61726_62731_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514417.1|62778_64182_+	YfcC family protein	NA	NA	NA	NA	NA
WP_001496175.1|64262_64742_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080227.1|65098_65320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624725.1|65350_65701_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_059330006.1|65697_66060_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_032152936.1|66898_67477_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000005489.1|67889_68243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|68714_69737_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000083821.1|70141_70399_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|70633_70708_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_048266445.1|70700_71558_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|72496_73150_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|73242_73500_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|73432_73834_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|73970_76868_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|76962_77568_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|78344_78737_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|78874_79759_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|79790_80990_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|81068_81746_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|81777_82020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|83641_84346_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001467509.1|84419_85331_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.7	5.2e-179
