The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017177	Salmonella enterica strain FORC_056 chromosome, complete genome	4686230	1415080	1421133	4686230		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1415080_1415248_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1415263_1415407_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1416396_1418319_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1418336_1418591_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1418559_1418949_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1420191_1421133_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP017177	Salmonella enterica strain FORC_056 chromosome, complete genome	4686230	1657565	1666735	4686230	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569168.1|1657565_1658513_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_001261696.1|1659207_1659315_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|1659374_1660106_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|1660328_1662014_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1662010_1662730_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1662776_1663244_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1663300_1663831_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1664002_1664461_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1664701_1666735_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP017177	Salmonella enterica strain FORC_056 chromosome, complete genome	4686230	1733929	1744436	4686230		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1733929_1735333_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1735510_1736404_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1736780_1737866_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1737865_1738765_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1738812_1739691_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1739691_1740243_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1740248_1741223_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1741238_1742012_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1742016_1743096_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1743122_1744436_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP017177	Salmonella enterica strain FORC_056 chromosome, complete genome	4686230	1857358	1904854	4686230	head,protease,portal,integrase,capsid,terminase,holin,plate,transposase,tail	Salmonella_phage(77.78%)	60	1860259:1860273	1908449:1908463
WP_001680077.1|1857358_1858633_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_001675175.1|1859296_1859587_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
WP_000598920.1|1859958_1860756_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1860259:1860273	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|1861047_1862037_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1862038_1862281_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061370.1|1862305_1862875_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|1862871_1863735_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|1863731_1864025_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|1864296_1864656_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|1864652_1865168_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|1865164_1865395_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1865465_1866005_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|1866099_1867017_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000078504.1|1867586_1867838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|1867913_1868099_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|1868304_1869000_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001191666.1|1869097_1869322_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|1869350_1869905_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|1869901_1871059_+	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|1871055_1871280_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1871276_1872251_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1872247_1872721_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|1872717_1873599_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1873607_1873997_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|1874013_1874874_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|1874881_1875871_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|1875884_1876637_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|1876686_1877760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|1877772_1878345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|1878433_1878823_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|1878809_1879091_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|1879090_1879708_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|1879704_1880244_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|1880267_1880618_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|1880764_1881202_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_000257219.1|1881201_1882932_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_077905357.1|1883203_1884298_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|1884290_1884893_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|1884902_1886132_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|1886211_1886535_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|1886531_1886936_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|1886907_1887420_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|1887416_1887977_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|1887980_1888145_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|1888134_1889631_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|1889630_1889987_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1889983_1890310_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|1890394_1892323_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|1892356_1893697_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|1893693_1894752_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|1894751_1895285_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|1895289_1895703_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_000785580.1|1895695_1896775_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
WP_001207832.1|1896777_1897365_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|1897351_1898914_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_000760554.1|1898913_1899483_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|1899767_1900775_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1900987_1901209_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|1902551_1903370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|1903831_1904854_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
1908449:1908463	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP017177	Salmonella enterica strain FORC_056 chromosome, complete genome	4686230	2437030	2452974	4686230	tRNA,holin	Escherichia_phage(62.5%)	21	NA	NA
WP_001082296.1|2437030_2437465_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2437514_2437853_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000802786.1|2438698_2439244_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2439240_2439522_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2439511_2439700_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2439621_2440017_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2442187_2442724_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2442720_2443011_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2443010_2443610_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|2444133_2444346_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|2444715_2445648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2445644_2446199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2446360_2446690_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2446962_2447430_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2447814_2447970_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2448077_2448599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2449036_2449258_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2449342_2449660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2449687_2450305_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2450621_2451557_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2451600_2452974_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP017177	Salmonella enterica strain FORC_056 chromosome, complete genome	4686230	2677399	2693513	4686230	lysis,integrase,holin,tail	Salmonella_phage(30.77%)	16	2674029:2674058	2693649:2693678
2674029:2674058	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|2677399_2678263_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|2680903_2681599_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2681688_2682222_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2683116_2683596_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2683613_2684066_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2684049_2684379_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2684654_2685341_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2685701_2686151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2686523_2687048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2687144_2687834_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2687963_2688191_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2688187_2688787_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|2688850_2689156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2689787_2691767_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2692180_2692459_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2692433_2693513_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2693649:2693678	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP017177	Salmonella enterica strain FORC_056 chromosome, complete genome	4686230	2865905	2906603	4686230	protease,tail	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|2865905_2866586_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2867204_2867864_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2867950_2868280_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2868276_2868558_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2868606_2869386_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2869411_2869960_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2870174_2871386_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2871443_2871761_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|2871805_2872222_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2872392_2873055_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2873149_2873608_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_016764765.1|2873643_2875698_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.3	1.9e-19
WP_001261222.1|2875821_2876268_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2876286_2878440_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2878426_2879032_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2879248_2879758_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2880114_2881167_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2881238_2881691_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2881876_2883637_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2883705_2884224_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2884323_2884491_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2884746_2885310_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2885306_2886947_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2886951_2888205_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2888219_2890127_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2890139_2892248_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2892346_2893456_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2893452_2893995_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2894160_2895171_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2895378_2897991_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2898417_2898609_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2898879_2899566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2899925_2900552_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2901199_2902168_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2902393_2902642_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2902645_2903227_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2903226_2904936_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2904932_2905559_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2905542_2906172_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|2906192_2906603_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP017177	Salmonella enterica strain FORC_056 chromosome, complete genome	4686230	2977882	2985195	4686230	integrase,protease	Ralstonia_phage(16.67%)	7	2972679:2972693	2983931:2983945
2972679:2972693	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2977882_2978260_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2978421_2978619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2978831_2981108_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2981138_2981459_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2981782_2982004_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2982133_2984080_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2983931:2983945	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2984076_2985195_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP017178	Salmonella enterica strain FORC_056 plasmid unnamed1, complete sequence	59371	45730	52638	59371	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|45730_46153_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|46152_47427_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_077681951.1|47508_48486_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000427676.1|48482_49688_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|50102_51044_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|51040_51646_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|51702_52038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|52221_52638_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
