The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018630	Clostridium chauvoei strain 12S0467 chromosome, complete genome	2885628	522509	585073	2885628	integrase,transposase	Planktothrix_phage(25.0%)	48	524208:524224	586917:586933
WP_079480999.1|522509_523748_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.9	1.7e-52
WP_021874693.1|523948_525301_-	methyl-accepting transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.0	5.8e-09
524208:524224	attL	TCATTAATATTTTCTAA	NA	NA	NA	NA
WP_021874694.1|525471_526554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481036.1|527126_528566_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_021874695.1|528744_529584_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021874696.1|529631_530315_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_079481066.1|530298_531021_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	1.2e-34
WP_021874698.1|531204_532041_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021874699.1|532236_534765_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_021874700.1|535207_536704_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_021874701.1|536900_538334_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021874702.1|538345_539587_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021874703.1|539643_539997_+	DUF1667 domain-containing protein	NA	NA	NA	NA	NA
WP_096145479.1|540405_541110_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	38.0	7.1e-35
WP_079481068.1|541208_541829_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_021874706.1|541825_542674_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	1.7e-14
WP_079481069.1|542677_543052_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021874708.1|543186_544365_-	cation transporter	NA	NA	NA	NA	NA
WP_021874709.1|544547_545843_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_021874710.1|545989_554482_+	cyclic beta 1-2 glucan synthetase	NA	NA	NA	NA	NA
WP_021874711.1|554702_555638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874712.1|555653_556910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874713.1|557411_558101_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079481070.1|558499_560020_+	L-lactate permease	NA	NA	NA	NA	NA
WP_021874715.1|560049_560838_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_021874716.1|560850_562041_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_021874717.1|562043_563444_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_021874719.1|563831_565151_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.5	2.4e-12
WP_021874720.1|565263_565404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874721.1|565482_565641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874722.1|565736_565946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874723.1|566039_566813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481071.1|566884_567376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874725.1|567727_569017_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_021874726.1|569045_569720_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_079481072.1|569947_571723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481073.1|571715_573230_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_096145478.1|573570_574131_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021874730.1|574135_575476_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_161493076.1|575631_575916_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	43.3	1.4e-05
WP_021874732.1|575948_576290_+	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_079481036.1|576620_578060_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_079481687.1|578383_579823_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_079481076.1|580299_580992_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	2.1e-23
WP_131431558.1|580988_582182_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_161493077.1|582184_583213_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_021874736.1|583303_583591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481077.1|583858_585073_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
586917:586933	attR	TTAGAAAATATTAATGA	NA	NA	NA	NA
>prophage 2
NZ_CP018630	Clostridium chauvoei strain 12S0467 chromosome, complete genome	2885628	707972	739957	2885628	holin,transposase	Synechococcus_phage(25.0%)	29	NA	NA
WP_079481109.1|707972_708710_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_021874844.1|708813_709284_+	acetobutylicum phosphotransbutyrylase	NA	NA	NA	NA	NA
WP_021874845.1|709460_711068_+	phosphotransferase	NA	NA	NA	NA	NA
WP_021874846.1|711088_712036_+	DMT family transporter	NA	NA	NA	NA	NA
WP_021874847.1|712038_712722_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_021874848.1|712944_713748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021874849.1|713769_714189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096145424.1|714326_715043_+	transaldolase	NA	A0A0E3F5V4	Synechococcus_phage	34.5	6.8e-17
WP_021874851.1|715071_715518_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_079481110.1|715544_715832_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_021874853.1|715844_717224_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_021874854.1|717308_719441_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_021874855.1|719602_719875_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021874856.1|719892_720711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021874857.1|720725_722057_+	AAA family ATPase	NA	A0A139ZPD0	Marinitoga_camini_virus	26.7	9.0e-23
WP_021874858.1|722942_723593_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.1	1.4e-32
WP_079481112.1|724356_725148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161493079.1|725131_725617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874863.1|726288_726855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021874864.1|727337_728261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021874868.1|729895_731737_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	25.2	1.7e-24
WP_021874869.1|732014_734042_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_021874871.1|734393_734999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021874872.1|735261_735954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481114.1|736082_736964_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481115.1|736993_737839_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481116.1|737868_738159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481117.1|738188_739082_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481115.1|739111_739957_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP018630	Clostridium chauvoei strain 12S0467 chromosome, complete genome	2885628	1270705	1283786	2885628		Cyanophage(25.0%)	12	NA	NA
WP_021875361.1|1270705_1271644_+	SPFH/Band 7/PHB domain protein	NA	A0A2K9KZA2	Tupanvirus	34.9	1.7e-23
WP_079481268.1|1271709_1272120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008677523.1|1272409_1272565_+	cytochrome c551	NA	NA	NA	NA	NA
WP_021875363.1|1272869_1273025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161493087.1|1273258_1273564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021875365.1|1274233_1277980_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.4	2.4e-28
WP_021875366.1|1277992_1278472_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.0	1.8e-29
WP_021875367.1|1278471_1279176_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	42.1	2.4e-43
WP_021875368.1|1279228_1280656_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	33.3	1.6e-57
WP_021875369.1|1280665_1281667_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SQF5	Cyanophage	45.9	5.3e-68
WP_079481269.1|1281654_1282266_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	4.6e-22
WP_021875371.1|1282283_1283786_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.2	9.1e-64
>prophage 4
NZ_CP018630	Clostridium chauvoei strain 12S0467 chromosome, complete genome	2885628	1727053	1735770	2885628	integrase	uncultured_Mediterranean_phage(33.33%)	9	1733675:1733690	1738175:1738190
WP_079481387.1|1727053_1728214_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	29.4	3.5e-07
WP_021875775.1|1728352_1728931_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_021875776.1|1728940_1729441_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_079481388.1|1729500_1730112_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.5	5.2e-18
WP_021875778.1|1730104_1730848_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.0	1.0e-07
WP_021875779.1|1730958_1732212_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.6	4.5e-32
WP_021875780.1|1732311_1733616_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	57.6	2.9e-130
1733675:1733690	attL	AAATTATAGTATTTCT	NA	NA	NA	NA
WP_021875781.1|1733677_1734844_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_021875782.1|1734891_1735770_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.7	2.0e-23
1738175:1738190	attR	AAATTATAGTATTTCT	NA	NA	NA	NA
>prophage 5
NZ_CP018630	Clostridium chauvoei strain 12S0467 chromosome, complete genome	2885628	1991782	2018613	2885628	tail,capsid,integrase,coat,portal,terminase	Clostridium_phage(42.11%)	34	1996478:1996496	2024772:2024790
WP_021876032.1|1991782_1992034_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_079481462.1|1992138_1993194_-	hypothetical protein	NA	A0A1L6BY22	Clostridium_phage	38.6	1.9e-20
WP_021876034.1|1993264_1993672_-	hypothetical protein	NA	I2E8W8	Clostridium_phage	46.8	5.0e-25
WP_021876035.1|1993691_1993925_-	hemolysin XhlA	NA	NA	NA	NA	NA
WP_021876036.1|1993935_1995789_-	SGNH/GDSL hydrolase family protein	NA	A0A0S2SXG8	Bacillus_phage	21.9	8.7e-16
WP_021876037.1|1995790_1996069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876038.1|1996069_1997503_-	phage minor structural protein	NA	A0A1B2APX2	Phage_Wrath	44.4	6.8e-85
1996478:1996496	attL	ATTTATATTTTTTTCTATA	NA	NA	NA	NA
WP_079481463.1|1997502_1998207_-	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	39.2	1.4e-38
WP_021876039.1|1998203_2000963_-|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	52.6	3.0e-81
WP_079481464.1|2001276_2001579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876041.1|2001649_2002207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876042.1|2002207_2002561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481465.1|2002561_2002972_-	hypothetical protein	NA	A0A0A7AQU9	Bacillus_phage	40.2	6.6e-09
WP_079481466.1|2002964_2003279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876045.1|2003275_2003596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096177145.1|2003639_2004527_-	hypothetical protein	NA	A0A0A7AQF5	Bacillus_phage	52.3	2.2e-73
WP_021876047.1|2004542_2005136_-	hypothetical protein	NA	A0A0A7S0J5	Clostridium_phage	47.4	1.5e-25
WP_021876048.1|2005323_2005599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481467.1|2005812_2006124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481468.1|2006116_2007475_-|capsid	minor capsid protein	capsid	H7BWE7	unidentified_phage	33.8	7.5e-25
WP_079481469.1|2007464_2008928_-|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	41.0	8.8e-96
WP_079481470.1|2009020_2010331_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	1.9e-137
WP_079481471.1|2010323_2011097_-	hypothetical protein	NA	A0A1L2BWH4	Clostridium_phage	38.1	7.1e-36
WP_021876054.1|2011136_2011715_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	50.8	1.9e-46
WP_021876055.1|2012134_2012773_-|integrase	tyrosine-type recombinase/integrase	integrase	F6K8Q2	Clostridium_phage	40.6	2.6e-28
WP_021876056.1|2013161_2013551_-	hypothetical protein	NA	A0A0A7RTL7	Clostridium_phage	40.2	8.5e-22
WP_079481472.1|2013932_2014163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876059.1|2014149_2014347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876060.1|2014348_2015653_-	replicative DNA helicase	NA	O80281	Escherichia_phage	41.8	1.0e-79
WP_079481473.1|2016662_2017154_-	transcriptional regulator	NA	A0A2K9V3J3	Faecalibacterium_phage	40.2	3.9e-24
WP_021876063.1|2017333_2017525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876064.1|2017589_2017763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161493099.1|2017874_2018066_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021876066.1|2018238_2018613_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WJ60	Clostridium_phage	40.8	6.9e-13
2024772:2024790	attR	TATAGAAAAAAATATAAAT	NA	NA	NA	NA
>prophage 6
NZ_CP018630	Clostridium chauvoei strain 12S0467 chromosome, complete genome	2885628	2627723	2675763	2885628	protease,transposase,coat,integrase	Clostridium_phage(25.0%)	47	2647300:2647359	2669313:2669472
WP_079481631.1|2627723_2628254_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.3	2.3e-17
WP_021876588.1|2628311_2629346_-	MreB/Mrl family cell shape determining protein	NA	NA	NA	NA	NA
WP_021876589.1|2629473_2629725_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	57.3	3.1e-17
WP_079481632.1|2629808_2630552_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_021876591.1|2630741_2631791_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	38.5	1.5e-36
WP_079481633.1|2631965_2633225_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_131431660.1|2633246_2633894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876594.1|2634086_2634494_-	ATP synthase epsilon chain	NA	NA	NA	NA	NA
WP_021876595.1|2634508_2635897_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_021876596.1|2635912_2636764_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_021876597.1|2636800_2638315_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_021876598.1|2638325_2638865_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_021876599.1|2638867_2639347_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_021876600.1|2639387_2639621_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_021876601.1|2639640_2640321_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_079481635.1|2640321_2640684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876603.1|2641409_2642591_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_021876604.1|2642709_2643861_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	29.2	4.3e-29
WP_021876605.1|2643878_2644373_-	hypothetical protein	NA	A0A2H5BMD7	Streptomyces_phage	38.6	2.6e-15
WP_021876606.1|2644555_2645185_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_021876607.1|2645231_2645681_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_079481036.1|2645859_2647299_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2647300:2647359	attL	TAAATCATAAAATCAAATATTGATTAAGTTTTTGCCTCCGTTACCGAAGGTCTTTTTAGC	NA	NA	NA	NA
WP_021876608.1|2647591_2648635_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	36.3	1.8e-47
WP_079481636.1|2648654_2649242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876610.1|2649298_2650384_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_079481637.1|2650447_2652205_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_079481638.1|2652230_2652818_-	thymidine kinase	NA	A0A249XXF6	Clostridium_phage	51.6	1.0e-50
WP_021876613.1|2653101_2653308_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_021876614.1|2653445_2654555_+	diacylglycerol synthase	NA	NA	NA	NA	NA
WP_021876615.1|2654569_2655964_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_021876616.1|2656345_2657953_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	8.6e-153
WP_079481639.1|2658122_2658428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876618.1|2658564_2658981_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_079481640.1|2658990_2659980_-	DUF814 domain-containing protein	NA	NA	NA	NA	NA
WP_079481641.1|2660060_2660714_-	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_079481642.1|2660775_2661618_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_079481643.1|2661758_2664383_-	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_021876623.1|2664363_2665200_-	cyanophycinase	NA	NA	NA	NA	NA
WP_021876624.1|2665379_2666960_-	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_079481644.1|2667457_2667694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481036.1|2667872_2669312_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_021876625.1|2669676_2670561_-	sporulation peptidase YabG	NA	NA	NA	NA	NA
2669313:2669472	attR	TAAATCATAAAATCAAATATTGATTAAGTTTTTGCCTCCGTTACCGAAGGTCTTTTTAGCATATTCAATTTTAAAATTTTCTTAGATATTATAAAGATATTTTTAACTATTATTCCAAATTAGCCATAAGCTATTTTTTCATACGAAACTTTACACTATC	NA	NA	NA	NA
WP_021876626.1|2670650_2671652_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_021876627.1|2671757_2672879_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_079481875.1|2672929_2673976_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_131431664.1|2673968_2674703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876630.1|2674770_2675763_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
