The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023423	Enterococcus faecium strain K60-39 chromosome, complete genome	2739582	697530	706002	2739582		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|697530_698175_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|698189_698519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|698532_699471_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|699506_700331_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|700323_700671_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|700739_701612_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|701720_702842_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|702895_703498_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|703812_706002_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 2
NZ_CP023423	Enterococcus faecium strain K60-39 chromosome, complete genome	2739582	725086	766237	2739582	portal,holin,protease,transposase,capsid,head,terminase,integrase,tail	Enterococcus_phage(30.0%)	57	725703:725738	766539:766574
WP_002289451.1|725086_725431_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002289452.1|725443_725737_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
725703:725738	attL	AAGTGTCTGTTTATCCAGTAGCTCAAGAAGCTTAAT	NA	NA	NA	NA
WP_002301539.1|725829_726978_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	40.1	3.0e-67
WP_002305409.1|726989_727301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321996.1|727353_727749_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002305405.1|727784_728129_-	helix-turn-helix transcriptional regulator	NA	A0A126GGL0	Streptococcus_phage	52.6	1.2e-24
WP_002349274.1|728429_728651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305403.1|728777_729554_+	hypothetical protein	NA	B2ZYU5	Staphylococcus_phage	54.8	2.8e-72
WP_002305401.1|729550_729745_+	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.9	1.2e-08
WP_002349273.1|729746_730031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305400.1|730051_730240_+	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002305399.1|730565_730805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305398.1|730810_731497_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	71.4	2.6e-90
WP_002305397.1|731499_732330_+	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002305396.1|732346_733198_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305394.1|733194_733554_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002290675.1|733568_733730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305393.1|733726_734032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|734031_734388_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|734347_734593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|734777_735245_+	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002349267.1|735519_735756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305389.1|735779_736121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020944850.1|736113_736293_-	YegP family protein	NA	NA	NA	NA	NA
WP_002305387.1|736514_737162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|737421_737766_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002296599.1|737770_738052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|738154_738469_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|738446_740141_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|740160_741339_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|741301_741988_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|741987_743148_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_010729262.1|743157_744033_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	73.9	1.6e-129
WP_002286523.1|744029_744341_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|744330_744684_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|744673_745075_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|745067_745472_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002305379.1|745483_746089_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.6	1.1e-33
WP_002286510.1|746108_746471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|746473_746656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305374.1|746672_750092_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	41.5	8.7e-78
WP_002305373.1|750142_750880_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002305372.1|750889_753181_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.2	1.7e-90
WP_010729263.1|753204_755307_+	hypothetical protein	NA	A0A0M4RT83	Enterococcus_phage	39.0	1.3e-63
WP_002286491.1|755469_755916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|755917_756055_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|756092_756386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|756382_756607_+|holin	holin	holin	NA	NA	NA	NA
WP_002286484.1|756603_757629_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|758568_759730_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002302440.1|760164_761466_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002286474.1|762154_762562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|762575_762977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|762978_763350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305364.1|763385_763688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305361.1|763783_764578_-	DUF4428 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	32.9	4.3e-12
WP_002297404.1|764986_766237_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
766539:766574	attR	AAGTGTCTGTTTATCCAGTAGCTCAAGAAGCTTAAT	NA	NA	NA	NA
>prophage 3
NZ_CP023423	Enterococcus faecium strain K60-39 chromosome, complete genome	2739582	799846	901132	2739582	tRNA,transposase,protease,holin,capsid,plate,head,terminase,integrase,tail	Enterococcus_phage(11.9%)	111	850640:850658	886608:886626
WP_002286621.1|799846_802645_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|802693_804220_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|804234_804882_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|805065_805395_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|805571_806300_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|806315_807329_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|807328_808606_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|808668_811371_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|811522_811840_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|811869_812190_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|812297_813758_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|813825_814047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|814077_814260_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|814259_814673_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|814795_815977_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|816507_817647_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002303012.1|817945_818581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|818693_819329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|819362_819824_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|819953_820385_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|820402_820723_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|821021_821798_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|821812_822016_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|822031_822370_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|822356_822536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|822578_823049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|823135_823834_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|824011_824353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|824345_825017_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|825022_825709_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|825711_826461_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002304429.1|826472_826742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303016.1|826904_827204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303017.1|827203_827506_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
WP_002303018.1|827545_827911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303020.1|828537_828726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347162.1|828733_828928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303022.1|828960_829173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303023.1|829297_829501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303024.1|829497_829770_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
WP_002303025.1|829770_829956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123838300.1|829942_830290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303026.1|830249_830726_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
WP_002349221.1|830871_831600_-	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
WP_002303029.1|831647_831926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303030.1|831927_832314_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
WP_002304435.1|832310_832691_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_002303032.1|832802_833255_+	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
WP_002303033.1|833251_834979_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
WP_002297218.1|835985_837281_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002349220.1|837717_838293_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
WP_002303037.1|838305_839670_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
WP_002303039.1|839671_839953_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	4.7e-22
WP_002303041.1|839930_840257_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002303043.1|840246_840585_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
WP_002303045.1|840574_840940_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002303047.1|840946_841573_+|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
WP_002303049.1|841572_842037_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
WP_002303051.1|842231_844541_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
WP_002349218.1|844552_845257_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002347164.1|845253_848013_+	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.7	1.6e-50
WP_002332773.1|848025_848934_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002303523.1|848933_849551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|849554_850004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|850003_850498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347165.1|850511_850943_+	hypothetical protein	NA	NA	NA	NA	NA
850640:850658	attL	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002303475.1|850944_851082_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002303476.1|851118_851412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|851408_851633_+|holin	holin	holin	NA	NA	NA	NA
WP_002303477.1|851629_852649_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002302747.1|853425_853725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302745.1|853730_853961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|854210_854411_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002296840.1|854727_855915_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002286469.1|856189_857422_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|857676_858246_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286465.1|858423_858864_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|859021_859786_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|859817_860741_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|860816_861956_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|861948_862749_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|862748_863576_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|863553_864288_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|864387_865254_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|865267_865840_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|865861_866890_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|866987_867839_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002302719.1|867872_869906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289081.1|871438_872245_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289079.1|872256_873477_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289078.1|873466_875053_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002289076.1|875091_877230_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289074.1|877597_878581_-	serine hydrolase	NA	NA	NA	NA	NA
WP_002302725.1|878958_880350_+	sugar transferase	NA	NA	NA	NA	NA
WP_002289071.1|880365_881406_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289069.1|881424_882510_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289068.1|882542_883505_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002347167.1|883497_884931_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002302730.1|884927_885998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292875.1|885984_887406_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
886608:886626	attR	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002289359.1|887418_888426_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292874.1|888437_889442_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289362.1|889438_890587_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002289363.1|890559_891237_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002326811.1|891226_892369_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289366.1|892381_893359_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_031315448.1|893354_894266_+	oxidoreductase	NA	NA	NA	NA	NA
WP_002289370.1|894266_895019_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289372.1|895023_895971_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_002286097.1|897927_898881_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|899953_901132_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP023423	Enterococcus faecium strain K60-39 chromosome, complete genome	2739582	1174036	1183097	2739582		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1174036_1175332_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1175511_1175889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1176144_1176873_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1176872_1177127_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1177128_1177800_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1177800_1180023_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1180007_1181447_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1181478_1182522_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1182518_1183097_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 5
NZ_CP023423	Enterococcus faecium strain K60-39 chromosome, complete genome	2739582	1454234	1505355	2739582	transposase,protease	Streptococcus_phage(28.57%)	58	NA	NA
WP_002296623.1|1454234_1455530_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002303262.1|1455980_1456223_-	DUF3781 domain-containing protein	NA	NA	NA	NA	NA
WP_002303421.1|1456768_1457299_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002303420.1|1457480_1458137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303419.1|1458263_1458737_-	trimethoprim-resistant dihydrofolate reductase DfrF	NA	F8SJN4	Pseudomonas_phage	45.1	3.0e-21
WP_002296683.1|1459404_1460619_-	ammonium transporter	NA	NA	NA	NA	NA
WP_002290686.1|1460959_1461202_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002295944.1|1461233_1461791_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002295945.1|1461803_1461992_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002295947.1|1462004_1462571_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002295138.1|1463800_1464274_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1464282_1464510_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002347126.1|1464943_1466479_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	3.3e-125
WP_002295142.1|1466702_1467074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1467329_1467572_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1467603_1468506_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1468518_1468707_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1468720_1469284_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1469321_1470215_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1470292_1471231_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1471264_1471615_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1471647_1472550_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1472542_1473400_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1473733_1474543_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1474582_1475080_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1475724_1476048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1476211_1476466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1476535_1476781_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1476856_1477222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1478496_1479792_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302440.1|1480030_1481332_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002293303.1|1481435_1481636_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296656.1|1482387_1483101_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1483093_1484179_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1484195_1484639_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1484672_1485026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1485137_1485539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1485575_1486085_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1486106_1486964_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1486981_1487815_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1487828_1488626_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1488658_1488943_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1488939_1489941_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1489942_1490845_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1491008_1491857_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1492502_1492709_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1492910_1493912_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1493916_1495830_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1495997_1496504_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1496663_1497104_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1497129_1498287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1498289_1498646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1498943_1499918_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1500113_1500953_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1501137_1502025_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|1502618_1503314_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1503297_1503696_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1504104_1505355_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 6
NZ_CP023423	Enterococcus faecium strain K60-39 chromosome, complete genome	2739582	2057303	2109224	2739582	tRNA,transposase	Streptococcus_phage(31.25%)	41	NA	NA
WP_000222572.1|2057303_2058257_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2058290_2059520_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2059521_2060439_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2060442_2061180_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2061270_2061798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2061977_2062571_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2062674_2063160_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2063312_2063510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2063604_2065365_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2065361_2067092_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2067484_2067697_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2067698_2069378_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2069631_2069832_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002294069.1|2069981_2070674_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002287951.1|2070728_2071382_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2071371_2072685_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2072994_2075640_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002287954.1|2076032_2076680_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287955.1|2077252_2078464_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287956.1|2078479_2079622_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287957.1|2079786_2081508_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287958.1|2081706_2082267_-	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287959.1|2082292_2083132_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287960.1|2083165_2083999_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287961.1|2084230_2085199_+	asparaginase	NA	NA	NA	NA	NA
WP_000202380.1|2085417_2086737_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002287962.1|2087037_2087775_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287963.1|2087790_2088624_-	phosphotransferase	NA	NA	NA	NA	NA
WP_002294080.1|2088825_2090154_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002287965.1|2091243_2091873_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002287966.1|2091986_2092361_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_086956687.1|2092569_2093731_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002302440.1|2094122_2095424_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002287172.1|2101406_2101769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287231.1|2101842_2102223_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002296072.1|2102304_2103480_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002287167.1|2103556_2104141_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	2.0e-27
WP_002287107.1|2104549_2105800_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287165.1|2106124_2107123_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.1	2.6e-30
WP_002287163.1|2107234_2107744_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.1	1.5e-39
WP_002302440.1|2107922_2109224_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
>prophage 7
NZ_CP023423	Enterococcus faecium strain K60-39 chromosome, complete genome	2739582	2608897	2625793	2739582		Streptococcus_phage(92.86%)	18	NA	NA
WP_002297366.1|2608897_2609212_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2609224_2609599_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2609599_2609944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729284.1|2610026_2611367_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
WP_002297358.1|2611444_2612119_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2612351_2612786_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2612786_2613494_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2613483_2613774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2614032_2615217_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2615213_2615351_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2616096_2618007_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2618110_2618335_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2618347_2618851_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2618910_2619300_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_010729283.1|2619286_2621734_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297347.1|2621738_2623862_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2623858_2624863_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2624881_2625793_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP023424	Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence	195692	3393	127577	195692	integrase,holin,bacteriocin,transposase	Streptococcus_phage(25.64%)	114	56944:56960	120105:120121
WP_002287107.1|3393_4644_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295673.1|5053_5293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295672.1|5359_5569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324491.1|5628_6300_+	class A sortase	NA	NA	NA	NA	NA
WP_002326171.1|6352_8329_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_096157791.1|8343_9096_+	class C sortase	NA	NA	NA	NA	NA
WP_002302869.1|9111_9873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302867.1|9885_10146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305225.1|10142_12233_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_080474562.1|12259_12724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305229.1|12720_12963_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002295662.1|12980_13283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317430.1|13352_15416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305162.1|15415_18025_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002302440.1|19946_21248_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002326876.1|21946_22279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002313112.1|22279_22873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096157793.1|23035_24730_+	ATPase	NA	NA	NA	NA	NA
WP_002305177.1|25417_27295_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.3	9.1e-29
WP_074394474.1|27802_29008_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	42.4	2.5e-32
WP_060794172.1|29023_29668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060794173.1|29678_30485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025477554.1|30506_30737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002325546.1|31282_31558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060794174.1|31599_32022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021109222.1|32040_33633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002310991.1|33644_33980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010726515.1|34120_34315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|34450_35701_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_060797393.1|36110_38483_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.2	2.9e-11
WP_002313123.1|38543_40013_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|40023_42033_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002299811.1|42378_42975_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002301800.1|42987_43887_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|43889_44021_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|44042_44375_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002295625.1|44396_44654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|44812_44935_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|45124_45349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|45791_45998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|45997_46249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|46429_46702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|47146_47326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|47384_47741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|48709_49663_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|49783_50047_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|50418_51597_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300833.1|51985_53932_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002300835.1|53934_54390_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|54403_55732_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|55765_56050_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|56051_56567_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|56582_57245_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
56944:56960	attL	TTATTGAACCAGTATTA	NA	NA	NA	NA
WP_002300842.1|57251_57824_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300843.1|58010_59531_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002300845.1|59773_59953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|59942_60125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|61078_61678_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|61741_62341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292418.1|63356_64229_-	ROK family protein	NA	NA	NA	NA	NA
WP_002293868.1|64492_66439_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|66623_68063_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|68064_69027_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|69196_70623_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|70865_71321_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|71906_72137_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|72366_73185_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|73345_74035_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|74048_75551_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|75563_76040_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|76537_77700_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|78817_79336_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|81411_82497_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|82604_83558_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002301126.1|83688_84939_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002301128.1|85961_86957_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|86972_88142_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|88157_88892_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956687.1|89661_90824_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002301811.1|91392_92685_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|92958_93219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|93469_94648_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_065305666.1|94999_95209_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	61.7	5.9e-14
WP_002287876.1|96166_96562_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|96571_97420_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|97434_98262_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002287872.1|98273_99119_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_002285758.1|99939_100134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014387108.1|100123_100489_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.9e-17
WP_096157795.1|100577_102134_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	29.0	4.9e-44
WP_002285758.1|102160_102355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|102344_102698_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002299190.1|102799_104347_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002354485.1|105559_106246_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000195429.1|106783_107956_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001028141.1|108085_109525_-	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	8.5e-285
WP_025189010.1|109525_109918_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_002303110.1|111527_112565_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_002360733.1|112561_113083_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002304894.1|113131_113398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319817.1|113741_114422_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002303113.1|114966_115518_+	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|115985_116666_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002321606.1|116925_117531_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000824191.1|117575_117743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|117776_118076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|118116_118734_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_000344083.1|119532_121884_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
120105:120121	attR	TTATTGAACCAGTATTA	NA	NA	NA	NA
WP_000718009.1|122008_122698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|122711_123164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|123294_123975_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002300494.1|124045_125365_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|125361_126015_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_010729371.1|126302_127577_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.6	1.2e-56
>prophage 1
NZ_CP023425	Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence	86216	3694	61654	86216	protease,transposase,holin	Streptococcus_phage(53.85%)	59	NA	NA
WP_002287107.1|3694_4945_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002299885.1|5354_5594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299886.1|5660_5900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299887.1|6026_6716_+	sortase	NA	NA	NA	NA	NA
WP_002299888.1|6721_7888_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002302875.1|7969_8641_+	class A sortase	NA	NA	NA	NA	NA
WP_002302873.1|8693_10670_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002302871.1|10682_11435_+	class C sortase	NA	NA	NA	NA	NA
WP_002302869.1|11450_12212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302867.1|12224_12485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305780.1|12481_14572_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002300034.1|14607_16665_-|protease	serine protease	protease	NA	NA	NA	NA
WP_002300033.1|16809_17001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300032.1|17188_17644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305782.1|17640_17883_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002302862.1|17900_18203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302860.1|18271_20326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302859.1|20325_22938_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002302858.1|22934_25313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302857.1|25373_25916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302856.1|25993_26326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302855.1|26326_26920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065305674.1|26941_28636_+	ATPase	NA	NA	NA	NA	NA
WP_002305177.1|29323_31201_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.3	9.1e-29
WP_002302853.1|31708_32908_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	38.1	2.5e-32
WP_002302852.1|32923_33568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302851.1|33578_34385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582323.1|34795_35731_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_002305788.1|35774_36044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302849.1|36319_36595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302844.1|36636_37059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582318.1|37078_38671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302842.1|38691_39027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302840.1|39172_39367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|39502_40753_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|41162_43535_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002347152.1|43595_45056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305772.1|45066_47271_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_002303311.1|47511_48105_+	abortive infection protein	NA	NA	NA	NA	NA
WP_002303312.1|48117_49017_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303313.1|49019_49505_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002316074.1|49645_49849_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295623.1|49923_50184_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002347218.1|50620_50827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|50826_51078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300851.1|51092_51530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303117.1|51522_52230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120991.1|52610_52790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388479.1|52920_53190_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000588503.1|53182_53440_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_001809248.1|54077_54902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|55066_55681_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_002303116.1|55918_56341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|56350_56554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|56765_57350_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_002303115.1|57720_59046_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.4	7.7e-99
WP_002303114.1|59038_59389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|59652_60948_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_096157801.1|60973_61654_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.0	2.1e-116
>prophage 1
NZ_CP023426	Enterococcus faecium strain K60-39 plasmid pTT39_p3, complete sequence	40017	10164	39982	40017	transposase	Streptococcus_phage(63.64%)	34	NA	NA
WP_002294513.1|10164_11649_+	ABC-F type ribosomal protection protein Lsa(E)	NA	A0A2H4UUX5	Bodo_saltans_virus	26.0	2.6e-26
WP_002303393.1|14157_14382_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002303392.1|14396_15266_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	90.3	5.7e-151
WP_000662263.1|15246_15981_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|16013_16922_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_002347175.1|16918_17167_+	hypothetical protein	NA	A0A1B0RXL7	Streptococcus_phage	96.1	9.5e-27
WP_002324522.1|17169_18077_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002297218.1|18177_19473_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_001096887.1|20061_20856_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_031929417.1|21397_21481_+	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001038796.1|21605_22343_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_023843711.1|22287_22428_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	93.0	8.0e-15
WP_001284311.1|22605_23469_-	toxin zeta	NA	NA	NA	NA	NA
WP_000301765.1|23470_23743_-	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_001835296.1|23759_23975_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_096157813.1|24066_24327_-	hypothetical protein	NA	A0A1X9I765	Streptococcus_phage	98.8	4.3e-38
WP_002354485.1|24368_25055_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000119405.1|25215_26478_+	plasmid recombination protein	NA	NA	NA	NA	NA
WP_025192414.1|26722_27622_+	protein rep	NA	NA	NA	NA	NA
WP_014748745.1|27644_28331_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
WP_002324171.1|28757_28970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287227.1|28990_29842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287225.1|30024_30984_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	3.4e-32
WP_000053907.1|31007_31304_-	replication control protein PrgN	NA	NA	NA	NA	NA
WP_000947691.1|31438_32932_-	replication protein RepR	NA	NA	NA	NA	NA
WP_000429439.1|33543_34497_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_001196543.1|34468_34744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199136.1|34936_35191_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_002322130.1|35301_35556_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_086953888.1|35596_36758_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_073120187.1|36859_37432_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_002303206.1|37904_38477_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_000599739.1|38492_39098_-	cell filamentation protein	NA	NA	NA	NA	NA
WP_002354485.1|39295_39982_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
