The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	405395	442975	3512356	transposase,holin,plate	Streptococcus_phage(20.0%)	32	NA	NA
WP_004191998.1|405395_406859_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198200.1|406992_408057_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011807805.1|408302_408971_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_004198198.1|409064_409616_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_004198197.1|409809_410670_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_004198195.1|411737_412118_+	response regulator	NA	NA	NA	NA	NA
WP_011204177.1|412149_414453_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_004199265.1|414483_415011_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_004202799.1|415051_417073_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	2.2e-12
WP_011832274.1|417076_418024_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
WP_004198646.1|418020_418725_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_004200023.1|418721_419825_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_004185006.1|420173_420569_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	2.7e-07
WP_004524402.1|420570_421299_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_004198643.1|421496_422000_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_004198642.1|422022_423273_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_004198641.1|423459_423960_+	VOC family protein	NA	NA	NA	NA	NA
WP_004198640.1|424667_425873_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_004198639.1|425869_427972_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_123784499.1|427952_428492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198638.1|428587_429712_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_004198637.1|429704_430517_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_004198636.1|430538_431273_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_004198634.1|431626_433048_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	7.6e-44
WP_004198632.1|433211_433565_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|433582_434413_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_038798086.1|434596_436087_-	6-aminohexanoate hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|436183_436876_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_096325434.1|438251_439371_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204912.1|439510_439993_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004202808.1|440072_441911_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004200010.1|441874_442975_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	542522	595142	3512356	portal,transposase,protease,terminase	Leptospira_phage(20.0%)	47	NA	NA
WP_004199890.1|542522_543044_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004199888.1|543265_543763_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|543759_544815_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|544858_545215_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199884.1|545217_545514_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	2.8e-49
WP_038802950.1|546321_547441_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199882.1|548066_548339_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_004201278.1|548457_549240_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_004199881.1|549559_549988_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199880.1|550069_550945_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004199879.1|550937_551459_+	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_004202867.1|551616_552630_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199877.1|552713_553511_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.5e-30
WP_004201276.1|553538_554387_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004197153.1|554464_555844_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004197150.1|555854_556532_+	response regulator	NA	NA	NA	NA	NA
WP_004197145.1|556821_557982_+	porin	NA	NA	NA	NA	NA
WP_004197141.1|558017_558200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901007.1|558454_560470_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.8	2.5e-85
WP_004197137.1|560510_563540_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	38.7	2.2e-181
WP_004197133.1|564077_565178_+	porin	NA	NA	NA	NA	NA
WP_004199873.1|565577_566537_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004538585.1|566659_567391_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	1.6e-05
WP_004197129.1|567763_568486_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.8e-07
WP_004197128.1|568482_569532_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197127.1|569528_570407_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197126.1|570411_571671_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004198383.1|571887_573393_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004198382.1|573448_573841_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004198380.1|573851_574661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198379.1|574706_575504_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.8	3.3e-12
WP_004198377.1|575588_577238_-	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.9	2.0e-56
WP_004198376.1|577965_578307_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038802950.1|579480_580600_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004525798.1|581023_581329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202848.1|581352_582339_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_004202847.1|582368_583205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160468978.1|583663_584851_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004202842.1|584849_585986_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004202841.1|586592_587798_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_004202840.1|587810_589934_+	fatty oxidation complex subunit alpha	NA	NA	NA	NA	NA
WP_004202838.1|590297_591431_+	CoA transferase	NA	NA	NA	NA	NA
WP_004525805.1|591507_592074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202836.1|592409_592865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935860.1|593429_593870_+	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_004202832.1|593856_593994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|594021_595142_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	1211549	1220786	3512356		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|1211549_1213502_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_024901038.1|1213768_1214899_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194350.1|1214932_1216939_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194137.1|1217114_1217930_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194274.1|1217994_1218678_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194373.1|1218674_1219202_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194112.1|1219238_1220786_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 4
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	1224276	1302223	3512356	transposase,tRNA,protease	Synechococcus_phage(15.0%)	60	NA	NA
WP_004194103.1|1224276_1225251_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_004194266.1|1225247_1227302_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.7	2.9e-76
WP_004194375.1|1227486_1228167_+	membrane protein	NA	NA	NA	NA	NA
WP_004194228.1|1228487_1229315_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_024901039.1|1229425_1230262_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_004194323.1|1230532_1231960_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.4	1.3e-54
WP_004194028.1|1232357_1234094_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004196472.1|1234373_1235525_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004194378.1|1235705_1236869_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024901040.1|1236950_1238498_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_004194135.1|1238504_1239287_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004194035.1|1239283_1239940_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.1	8.7e-11
WP_004194357.1|1239972_1241496_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024900377.1|1241518_1242841_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_004196467.1|1242940_1243792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194348.1|1243788_1245585_+	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_004541333.1|1245602_1246538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194206.1|1246534_1247377_+	sugar nucleotide-binding protein	NA	A0A222YYW2	Synechococcus_phage	35.0	1.7e-38
WP_004194087.1|1247386_1248400_+	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	52.6	7.2e-97
WP_004194045.1|1248415_1249456_+	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	40.5	1.7e-61
WP_004200490.1|1249452_1250031_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	37.2	2.5e-17
WP_004194086.1|1250032_1250725_+	NTP transferase domain-containing protein	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	28.8	7.5e-05
WP_004194255.1|1250721_1251291_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024901041.1|1251557_1252760_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_004194054.1|1252756_1253545_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194306.1|1253546_1255079_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_004202217.1|1255081_1262722_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194036.1|1262718_1263636_+	UDP-3-O-acyl N-acetylglycosamine deacetylase	NA	NA	NA	NA	NA
WP_004194209.1|1263700_1265020_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004194345.1|1265028_1265721_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038802950.1|1266696_1267816_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_071810810.1|1267890_1268109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|1268306_1268816_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|1269116_1271231_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_024901034.1|1272403_1273867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|1274411_1275257_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|1275425_1276172_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197492.1|1276887_1278249_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004522619.1|1278221_1278557_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|1278853_1280293_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162473466.1|1280640_1280928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200476.1|1280911_1282186_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|1282310_1282916_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004186428.1|1283447_1284470_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|1284485_1285013_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|1285097_1285853_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186611.1|1286086_1287292_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_096325437.1|1287380_1288501_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004185841.1|1289563_1290142_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|1290338_1291721_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|1291715_1291946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|1292178_1293207_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|1293187_1293394_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|1293567_1294359_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|1294567_1295230_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|1295369_1296833_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|1296936_1297140_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|1297672_1297987_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|1297983_1300284_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_038802950.1|1301102_1302223_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	1898607	1968722	3512356	transposase,coat,plate	Leptospira_phage(28.57%)	57	NA	NA
WP_038802950.1|1898607_1899727_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_073699268.1|1899772_1900363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193369.1|1900704_1901211_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	5.1e-19
WP_004191223.1|1901207_1901633_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
WP_004193964.1|1902378_1904271_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191686.1|1904337_1905798_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004197687.1|1906020_1906398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901063.1|1906421_1907000_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_004197691.1|1907214_1910007_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_004266861.1|1910003_1912226_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_004191214.1|1912222_1913965_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_004192927.1|1913991_1916100_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_004205216.1|1918361_1921757_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011832205.1|1921753_1925101_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_004205215.1|1925424_1925679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193933.1|1925654_1927133_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004193830.1|1927315_1927606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192837.1|1927840_1928059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162473477.1|1928554_1928848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193316.1|1929030_1929354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193478.1|1929637_1931062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193589.1|1931328_1932306_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004526732.1|1932719_1933502_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192729.1|1933685_1933901_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_004192564.1|1933911_1934283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196675.1|1934334_1934670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191937.1|1934752_1934911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196677.1|1935276_1935972_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004191391.1|1936359_1939632_+	hemagglutinin	NA	A0A2C9CZB7	Yersinia_phage	33.0	1.4e-05
WP_004191672.1|1939712_1940423_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004192726.1|1940424_1941954_+	hypothetical protein	NA	D6PFH9	uncultured_phage	25.4	1.2e-15
WP_004191318.1|1941970_1942315_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004193132.1|1942737_1942980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193698.1|1943025_1943586_-	SCO family protein	NA	NA	NA	NA	NA
WP_004191878.1|1943620_1944109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196681.1|1944135_1946538_-	DUF1929 domain-containing protein	NA	NA	NA	NA	NA
WP_004196682.1|1946790_1947024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266855.1|1947068_1947905_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009966472.1|1948074_1948203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053811246.1|1949196_1951047_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004193292.1|1951074_1952490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193592.1|1952513_1952780_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004192367.1|1953039_1953267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191109.1|1953300_1956108_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	6.8e-28
WP_004192570.1|1956110_1956944_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1957177_1958298_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193170.1|1959033_1960347_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004191144.1|1961241_1961511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193855.1|1961763_1962045_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004192394.1|1962512_1963505_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004196700.1|1963549_1964746_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196705.1|1965252_1966146_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531175.1|1966483_1966705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542449.1|1966790_1966976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192149.1|1966962_1967508_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|1967560_1968121_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|1968197_1968722_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	2031825	2103049	3512356	transposase,tRNA	Bacillus_phage(15.38%)	57	NA	NA
WP_004191922.1|2031825_2034693_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192721.1|2034832_2037196_+	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	30.6	4.2e-71
WP_004193777.1|2037192_2037981_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_004192717.1|2038302_2039553_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196082.1|2039904_2041581_+	chemotaxis methyl-accepting membrane protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	3.9e-15
WP_004191342.1|2041928_2042810_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004191885.1|2042823_2043027_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_004192976.1|2043023_2045225_-	FUSC family protein	NA	NA	NA	NA	NA
WP_024900385.1|2045241_2047008_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004191155.1|2047180_2048122_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192873.1|2048465_2049449_-	ser/threonine protein phosphatase	NA	S4VP02	Pandoravirus	34.0	1.8e-20
WP_004191226.1|2049480_2050902_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004192580.1|2050936_2051386_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_004193704.1|2051382_2051991_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004266851.1|2052096_2053407_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_004192500.1|2053578_2053899_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004193328.1|2054115_2054580_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004196088.1|2054679_2056494_+	MFS transporter	NA	NA	NA	NA	NA
WP_125754530.1|2056505_2056610_+	MFS transporter	NA	NA	NA	NA	NA
WP_004266572.1|2056974_2058084_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	1.1e-82
WP_004521230.1|2058249_2058783_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024900959.1|2058782_2059196_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.0	5.8e-29
WP_038802950.1|2059240_2060361_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197788.1|2060448_2061624_+	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	35.9	1.8e-46
WP_004192661.1|2061748_2064121_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_162473478.1|2064289_2064538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857895.1|2065543_2067094_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004192734.1|2067143_2068409_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011203914.1|2068559_2070239_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004193599.1|2070482_2070944_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004191720.1|2071180_2071591_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004550551.1|2071785_2072883_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191219.1|2072989_2074420_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004192735.1|2074519_2075794_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191889.1|2075921_2078786_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004193111.1|2079124_2080951_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004191941.1|2080903_2081044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192835.1|2081243_2081741_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191557.1|2081840_2083337_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192058.1|2083404_2084640_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004193982.1|2084662_2086222_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011203915.1|2086492_2087428_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004199441.1|2087454_2087823_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004197388.1|2087928_2090856_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004193517.1|2090947_2092423_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004193908.1|2092419_2092881_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004191876.1|2093185_2094850_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192767.1|2094913_2096242_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	5.3e-23
WP_004193481.1|2096660_2097563_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004199443.1|2097981_2098383_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004521676.1|2098588_2098846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199444.1|2099004_2099322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|2099522_2100245_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004192834.1|2100483_2100762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|2100910_2101168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193694.1|2101217_2101508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2101929_2103049_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 7
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	2796765	2861177	3512356	transposase,coat	Streptococcus_phage(25.0%)	49	NA	NA
WP_004191998.1|2796765_2798229_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192209.1|2798362_2799898_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004192981.1|2799935_2801078_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004192601.1|2801244_2802660_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004191860.1|2803064_2803529_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192990.1|2803781_2804600_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004193555.1|2804596_2805430_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_004192998.1|2805973_2806963_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_004192001.1|2806979_2807972_-	beta-propeller fold lactonase family protein	NA	A0A2H4JCI3	uncultured_Caudovirales_phage	59.6	3.5e-11
WP_004202033.1|2808073_2812201_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.5	4.3e-47
WP_004192168.1|2812224_2813601_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193961.1|2813653_2813929_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004192533.1|2814101_2815433_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_004199573.1|2815641_2817168_-	CoA transferase	NA	NA	NA	NA	NA
WP_004193195.1|2817164_2818958_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004193679.1|2819066_2819969_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|2820370_2821834_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_011832359.1|2821950_2822517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802333.1|2822681_2823801_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004192968.1|2824266_2825607_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.2e-32
WP_004192556.1|2825660_2827418_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004198606.1|2827914_2828181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193003.1|2828254_2829568_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004191521.1|2829551_2830250_-	response regulator	NA	W8CYM9	Bacillus_phage	36.7	2.9e-28
WP_004192043.1|2830491_2831037_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004198602.1|2832464_2833241_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004191164.1|2833451_2834141_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004193161.1|2834137_2834851_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004553879.1|2834873_2835653_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	3.9e-26
WP_004191758.1|2836547_2837636_+	porin	NA	NA	NA	NA	NA
WP_004193987.1|2838104_2838443_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004198600.1|2838503_2840204_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	5.8e-91
WP_011832356.1|2840324_2841503_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011807749.1|2842134_2842524_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038796551.1|2842502_2843408_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	43.1	2.1e-07
WP_004192356.1|2843466_2843994_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.8	9.0e-51
WP_024901025.1|2844154_2845594_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004192728.1|2845682_2846441_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004192161.1|2846479_2847787_+	MFS transporter	NA	NA	NA	NA	NA
WP_053811283.1|2847967_2849101_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_004193146.1|2849105_2851085_-	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_004193185.1|2851084_2852074_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_004199404.1|2852108_2852288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191560.1|2852400_2855385_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004191998.1|2855530_2856994_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192680.1|2857348_2858104_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004192784.1|2858286_2859102_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004193822.1|2859274_2860285_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004526328.1|2860658_2861177_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	3044782	3108689	3512356	transposase,protease	Leptospira_phage(25.0%)	60	NA	NA
WP_004192020.1|3044782_3046291_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	2.8e-20
WP_004192760.1|3046307_3047360_-	sugar dehydratase	NA	NA	NA	NA	NA
WP_004192486.1|3047365_3047968_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_004193971.1|3048051_3048651_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.3	3.8e-05
WP_004192146.1|3048756_3049230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024901020.1|3049241_3050480_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_004197638.1|3050636_3050876_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.6e-10
WP_004197597.1|3051019_3051769_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	5.8e-19
WP_004193828.1|3051819_3052752_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004191537.1|3052822_3053812_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_004192749.1|3053811_3054918_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_004192741.1|3055056_3055236_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_004193919.1|3055332_3055965_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_004192535.1|3056208_3056856_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004193677.1|3056852_3057575_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191725.1|3057613_3058615_-	S49 family peptidase	NA	NA	NA	NA	NA
WP_004193415.1|3058624_3059020_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004193798.1|3059317_3060325_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192715.1|3061088_3064361_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_004532083.1|3064500_3065613_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_004192903.1|3065646_3066270_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_004191191.1|3066381_3067692_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_004192965.1|3067728_3068016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199373.1|3068012_3068516_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193862.1|3068758_3070234_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_011203830.1|3070230_3071220_-	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	25.8	4.1e-12
WP_004193636.1|3071285_3072728_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004192015.1|3072783_3073446_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004202995.1|3073590_3074790_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.7	1.2e-55
WP_004193394.1|3074874_3075141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004205776.1|3075058_3075382_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_004197812.1|3075869_3076349_+	protein CreA	NA	NA	NA	NA	NA
WP_004536352.1|3076939_3077728_+	DUF4088 family protein	NA	NA	NA	NA	NA
WP_004189585.1|3077912_3078419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189709.1|3078756_3078978_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_004189199.1|3079102_3080509_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_038802950.1|3080826_3081946_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197806.1|3082142_3082316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189867.1|3082330_3083725_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004190145.1|3084203_3084710_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004197804.1|3084897_3085092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189917.1|3085655_3086366_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|3089204_3090668_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189292.1|3090825_3092436_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3092448_3092631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3092603_3093863_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3094130_3094709_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_096325434.1|3094902_3096023_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_096325434.1|3097134_3098255_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197797.1|3098681_3098840_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_011203825.1|3098836_3099430_-	chorismate mutase	NA	NA	NA	NA	NA
WP_004189159.1|3100042_3100432_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004188913.1|3100578_3102915_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004189437.1|3102923_3104174_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_004203540.1|3104170_3104659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197795.1|3104945_3105197_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004197793.1|3105896_3106112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|3106367_3106844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190100.1|3106866_3107127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|3107468_3108689_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 9
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	3161566	3170408	3512356		Bacillus_phage(16.67%)	8	NA	NA
WP_004189214.1|3161566_3162967_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004200795.1|3162935_3163922_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004190173.1|3163980_3164973_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|3165044_3165362_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|3165685_3166588_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_024901052.1|3166813_3168121_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|3168299_3169223_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004190087.1|3169565_3170408_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 10
NZ_CP009733	Burkholderia mallei strain Turkey5 chromosome 1, complete sequence	3512356	3431551	3489062	3512356	portal,transposase,tRNA,protease	Vibrio_phage(17.65%)	46	NA	NA
WP_004191998.1|3431551_3433015_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|3433181_3433952_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|3433983_3434823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190092.1|3434949_3436422_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|3436424_3437915_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|3438027_3438327_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_053811204.1|3438692_3439736_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|3439855_3440929_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189260.1|3440925_3441438_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|3441621_3444030_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|3444041_3445190_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004190168.1|3445540_3446317_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|3446313_3447099_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|3447520_3447973_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|3447992_3448625_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|3448718_3449453_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|3449920_3450604_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|3450604_3453013_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|3453014_3453605_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|3453601_3455011_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|3455380_3456238_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|3456347_3456983_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|3457103_3458087_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|3458118_3458622_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|3458850_3460041_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|3460100_3460472_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|3460682_3463292_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|3463513_3464569_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|3465018_3466035_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|3466155_3467025_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|3467062_3467467_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|3467857_3469078_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_038802950.1|3470394_3471514_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200731.1|3471566_3472049_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|3472045_3472330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|3472402_3473494_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004200729.1|3473892_3474303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|3474439_3475315_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|3475325_3476438_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004189874.1|3478764_3479334_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189689.1|3479926_3480475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|3480738_3482187_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004190110.1|3484912_3486007_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|3486408_3486825_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|3487010_3487565_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_038802950.1|3487942_3489062_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 1
NZ_CP009734	Burkholderia mallei strain Turkey5 chromosome 2, complete sequence	2185904	171045	214772	2185904	plate,transposase	Streptococcus_phage(50.0%)	29	NA	NA
WP_004191998.1|171045_172509_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004554722.1|172647_173547_-	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196258.1|173710_174958_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004188170.1|175110_176043_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188660.1|176587_177328_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004202300.1|177347_177632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187552.1|177771_178137_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004196252.1|178578_180495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188385.1|180706_183667_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_011204674.1|183694_183925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|184231_185452_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004188150.1|185581_186640_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_004187705.1|187565_189050_+	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004187879.1|189095_190964_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	25.9	3.0e-24
WP_004187502.1|190992_191964_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004187006.1|192018_192945_+	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004196246.1|193187_194534_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188288.1|195119_195350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188530.1|199473_200739_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188743.1|200827_202174_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004187276.1|202195_202699_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188308.1|202805_203291_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004188012.1|203407_204907_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004196243.1|204941_205523_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011204222.1|207680_209144_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004188539.1|210575_211322_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_004187921.1|211318_212284_+	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004187068.1|212270_212852_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187986.1|212882_214772_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009734	Burkholderia mallei strain Turkey5 chromosome 2, complete sequence	2185904	383873	454657	2185904	tRNA,transposase,holin	Acinetobacter_phage(40.0%)	58	NA	NA
WP_004521984.1|383873_385172_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004200645.1|385463_385775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198580.1|385771_386026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186938.1|386044_387859_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	49.6	3.0e-170
WP_004186966.1|387995_388547_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004186915.1|388543_389167_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_004186903.1|389502_391170_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	5.8e-43
WP_004186876.1|391456_391768_-	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_004202137.1|391907_392885_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_004198399.1|393000_393480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186796.1|393637_393859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186864.1|394142_395546_+	GABA permease	NA	NA	NA	NA	NA
WP_004186854.1|395617_396451_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186860.1|396464_396968_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_004206632.1|397182_397464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186874.1|397574_398669_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004186799.1|399194_399560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557275.1|399568_399925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266669.1|400016_400145_-	lipoprotein	NA	NA	NA	NA	NA
WP_004521997.1|400459_401641_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_004186871.1|401742_402471_+	DsbC family protein	NA	NA	NA	NA	NA
WP_004186839.1|402570_404400_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_004549943.1|404538_405135_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004186801.1|405354_406134_-	uracil-DNA glycosylase	NA	A0A060Q589	Fruit_bat_alphaherpesvirus	51.1	6.4e-53
WP_004186832.1|406175_406817_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_004186826.1|406827_407613_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	46.7	9.3e-52
WP_004186823.1|407675_408707_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.0	1.6e-80
WP_004186792.1|408724_409315_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	60.0	1.4e-68
WP_004186866.1|409328_410822_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	30.5	3.5e-39
WP_004186872.1|411184_411913_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004186923.1|411909_412605_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004522004.1|412651_412861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186878.1|412786_413161_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_038719768.1|413269_414496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186945.1|414823_416122_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_004186957.1|416635_417427_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_004522007.1|417485_418688_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004186941.1|418776_420483_-	phenylacetic acid degradation protein PaaN	NA	NA	NA	NA	NA
WP_004198410.1|420613_421390_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_073699529.1|421786_421903_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_096325434.1|427521_428641_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004184834.1|428882_430343_+	ser/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_009967729.1|431921_432854_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_011326545.1|433297_433987_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024900894.1|434018_434753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|442547_443668_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004266245.1|444226_445297_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_004184680.1|445359_445854_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_004184724.1|445888_446368_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004198701.1|446364_446700_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004266244.1|447171_448071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198708.1|448169_448385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198711.1|448760_448952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555731.1|448978_449641_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162490682.1|449874_451590_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.8	3.9e-26
WP_004200833.1|451582_452485_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_004199315.1|452607_453606_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004533171.1|453706_454657_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 3
NZ_CP009734	Burkholderia mallei strain Turkey5 chromosome 2, complete sequence	2185904	594592	651601	2185904	transposase	Streptococcus_phage(37.5%)	45	NA	NA
WP_004191998.1|594592_596056_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004551552.1|596258_597095_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200939.1|597094_597589_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200941.1|597770_598610_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200942.1|598859_599900_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004200943.1|600267_601413_+	cytochrome P460	NA	NA	NA	NA	NA
WP_004200944.1|601601_602810_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184941.1|603214_603991_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004200946.1|604006_604876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200950.1|605719_607135_+	amino acid permease	NA	NA	NA	NA	NA
WP_004200952.1|607730_607973_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004184704.1|608123_608414_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024901083.1|608807_610124_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004201904.1|610545_611043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266679.1|611160_612045_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_038802950.1|612155_613276_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198724.1|614297_616352_-	sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein	NA	NA	NA	NA	NA
WP_004204041.1|616611_617067_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_004194708.1|617063_617918_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_004194588.1|617965_619312_+	MFS transporter	NA	NA	NA	NA	NA
WP_004194610.1|619713_620823_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_004194640.1|621060_622143_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004194602.1|622199_623297_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.5	5.5e-26
WP_004194612.1|623274_624222_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004194685.1|624211_625072_+	2-aminoethylphosphonate ABC transport system, membrane component PhnV	NA	NA	NA	NA	NA
WP_004199121.1|625115_626387_+	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
WP_004194628.1|626383_627838_+	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004194622.1|627842_628394_+	HD domain-containing protein	NA	A0A2K9L141	Tupanvirus	34.1	2.3e-20
WP_073699529.1|628833_628950_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_038802950.1|634547_635668_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198117.1|635838_635985_+	DUF3563 family protein	NA	NA	NA	NA	NA
WP_011204222.1|636109_637573_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004198119.1|637781_638060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198120.1|638072_638918_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004198121.1|639066_640038_-	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004266709.1|640225_641014_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004191998.1|641218_642682_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198124.1|642825_644025_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004199587.1|644312_646403_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004266710.1|646626_647178_+	membrane protein	NA	NA	NA	NA	NA
WP_004198127.1|647237_647567_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004198128.1|647626_648469_+	iron transporter OFeT family	NA	NA	NA	NA	NA
WP_004198129.1|648465_649866_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_004199588.1|649925_650336_+	heme-binding protein	NA	NA	NA	NA	NA
WP_038802333.1|650481_651601_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 4
NZ_CP009734	Burkholderia mallei strain Turkey5 chromosome 2, complete sequence	2185904	1697848	1772546	2185904	tRNA,plate,transposase	Leptospira_phage(33.33%)	59	NA	NA
WP_004203245.1|1697848_1698661_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004203246.1|1698660_1701288_-	membrane protein	NA	NA	NA	NA	NA
WP_004188178.1|1701423_1702545_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004525190.1|1702543_1702705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187693.1|1702886_1703954_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_004187882.1|1704002_1704653_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_004187125.1|1704730_1704880_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004187091.1|1704876_1706286_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004187288.1|1706677_1707973_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004187652.1|1707965_1708913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187998.1|1709632_1710160_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187349.1|1710320_1713044_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_004188364.1|1713295_1714540_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_096325434.1|1715751_1716871_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200651.1|1716882_1717026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187842.1|1717101_1718076_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004188362.1|1718172_1719474_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004188825.1|1719526_1719799_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_004187935.1|1719800_1720502_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004188402.1|1720523_1722299_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004187439.1|1722303_1722672_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004536542.1|1722676_1723093_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004196014.1|1723292_1724102_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187735.1|1724391_1725375_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_004188261.1|1725572_1726592_+	lyase	NA	NA	NA	NA	NA
WP_004188791.1|1726748_1727258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188028.1|1727334_1728786_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_004187807.1|1728833_1731551_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_004187717.1|1731797_1734515_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004188259.1|1734615_1736280_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	22.5	1.9e-17
WP_004204352.1|1736303_1736576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1736871_1737991_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196172.1|1739423_1740683_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004190781.1|1740783_1741830_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190757.1|1741904_1743005_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	5.2e-24
WP_004200631.1|1743113_1744643_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004196164.1|1745737_1746763_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190808.1|1747113_1749351_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004190837.1|1749438_1749834_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190603.1|1749994_1750531_-	cytochrome b	NA	NA	NA	NA	NA
WP_004190805.1|1750799_1751435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204344.1|1751565_1752330_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_004190911.1|1752608_1752920_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204342.1|1753364_1753697_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190614.1|1753895_1755311_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_004190588.1|1755299_1755443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190461.1|1755766_1756444_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190245.1|1756406_1757345_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190776.1|1757341_1758766_-	cytosine permease	NA	NA	NA	NA	NA
WP_011204340.1|1759282_1760263_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045589205.1|1760275_1761037_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_038802950.1|1760936_1762056_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196154.1|1762084_1763143_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004196151.1|1763072_1763726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|1763800_1766005_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004203276.1|1766001_1768656_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	2.3e-78
WP_004190820.1|1768634_1770113_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190509.1|1770109_1771981_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|1771985_1772546_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009734	Burkholderia mallei strain Turkey5 chromosome 2, complete sequence	2185904	1848154	1907524	2185904	tRNA,transposase,portal,integrase	Leptospira_phage(22.22%)	53	1839870:1839929	1902210:1903160
1839870:1839929	attL	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCC	NA	NA	NA	NA
WP_011204325.1|1848154_1849195_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.7e-93
WP_004195713.1|1849585_1850395_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004266656.1|1850545_1852450_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004190235.1|1852533_1853418_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|1853414_1853708_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|1853977_1855084_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004191998.1|1855234_1856698_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190656.1|1856822_1857692_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|1857750_1858626_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004204467.1|1858778_1859000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038763983.1|1859339_1861133_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|1861494_1862877_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190446.1|1863195_1865976_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	2.9e-71
WP_004530319.1|1865977_1866727_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190924.1|1866723_1866993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190916.1|1867144_1867429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190352.1|1868088_1868580_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004203322.1|1869015_1869279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1871183_1872303_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009950031.1|1872860_1873148_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
WP_004195697.1|1873144_1873831_+|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_004190957.1|1873914_1875441_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004190726.1|1875596_1875995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190439.1|1876088_1877084_+	homoserine kinase	NA	NA	NA	NA	NA
WP_004190835.1|1877074_1877887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038730270.1|1878018_1878270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190487.1|1878389_1878842_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011832128.1|1878979_1879399_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004190391.1|1879511_1879670_-	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_004190691.1|1879766_1880915_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004204469.1|1881165_1881864_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004195689.1|1882304_1883105_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190258.1|1883117_1883792_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004190506.1|1883793_1884495_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
WP_004190826.1|1885038_1885887_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_004195687.1|1885921_1887844_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_004190990.1|1888041_1888425_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_004190343.1|1888522_1889398_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190540.1|1889464_1890385_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004190659.1|1890477_1891257_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004190954.1|1891342_1892683_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004190469.1|1892679_1893309_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004190582.1|1893467_1895111_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_004190434.1|1896395_1896851_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004190743.1|1896915_1898154_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_004195676.1|1898406_1898817_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004190802.1|1899058_1899652_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004533441.1|1899747_1900602_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195671.1|1900832_1901159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190721.1|1901341_1902229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1902256_1903377_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
1902210:1903160	attR	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCA	NA	NA	NA	NA
WP_004190833.1|1903442_1904522_-	putative membrane protein	NA	NA	NA	NA	NA
WP_004190269.1|1906519_1907524_-|transposase	transposase	transposase	NA	NA	NA	NA
