The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	405374	442954	3507358	transposase,plate,holin	Streptococcus_phage(20.0%)	32	NA	NA
WP_004191998.1|405374_406838_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198200.1|406971_408036_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011807805.1|408281_408950_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_004198198.1|409043_409595_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_004198197.1|409788_410649_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_004198195.1|411716_412097_+	response regulator	NA	NA	NA	NA	NA
WP_011204177.1|412128_414432_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_004199265.1|414462_414990_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_004202799.1|415030_417052_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	2.2e-12
WP_011832274.1|417055_418003_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
WP_004198646.1|417999_418704_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_004200023.1|418700_419804_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_004185006.1|420152_420548_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	2.7e-07
WP_004524402.1|420549_421278_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_004198643.1|421475_421979_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_004198642.1|422001_423252_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_004198641.1|423438_423939_+	VOC family protein	NA	NA	NA	NA	NA
WP_004198640.1|424646_425852_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_004198639.1|425848_427951_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_123784499.1|427931_428471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198638.1|428566_429691_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_004198637.1|429683_430496_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_004198636.1|430517_431252_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_004198634.1|431605_433027_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	7.6e-44
WP_004198632.1|433190_433544_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|433561_434392_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_038798086.1|434575_436066_-	6-aminohexanoate hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|436162_436855_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_096325434.1|438230_439350_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204912.1|439489_439972_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004202808.1|440051_441890_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004200010.1|441853_442954_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	542501	595121	3507358	terminase,transposase,portal,protease	Leptospira_phage(20.0%)	47	NA	NA
WP_004199890.1|542501_543023_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004199888.1|543244_543742_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|543738_544794_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|544837_545194_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199884.1|545196_545493_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	2.8e-49
WP_038802950.1|546300_547420_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199882.1|548045_548318_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_004201278.1|548436_549219_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_004199881.1|549538_549967_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199880.1|550048_550924_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004199879.1|550916_551438_+	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_004202867.1|551595_552609_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199877.1|552692_553490_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.5e-30
WP_004201276.1|553517_554366_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004197153.1|554443_555823_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004197150.1|555833_556511_+	response regulator	NA	NA	NA	NA	NA
WP_004197145.1|556800_557961_+	porin	NA	NA	NA	NA	NA
WP_004197141.1|557996_558179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901007.1|558433_560449_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.8	2.5e-85
WP_004197137.1|560489_563519_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	38.7	2.2e-181
WP_004197133.1|564056_565157_+	porin	NA	NA	NA	NA	NA
WP_004199873.1|565556_566516_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004538585.1|566638_567370_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	1.6e-05
WP_004197129.1|567742_568465_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.8e-07
WP_004197128.1|568461_569511_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197127.1|569507_570386_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197126.1|570390_571650_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004198383.1|571866_573372_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004198382.1|573427_573820_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004198380.1|573830_574640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198379.1|574685_575483_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.8	3.3e-12
WP_004198377.1|575567_577217_-	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.9	2.0e-56
WP_004198376.1|577944_578286_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038802950.1|579459_580579_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004525798.1|581002_581308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202848.1|581331_582318_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_004202847.1|582347_583184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160468978.1|583642_584830_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004202842.1|584828_585965_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004202841.1|586571_587777_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_004202840.1|587789_589913_+	fatty oxidation complex subunit alpha	NA	NA	NA	NA	NA
WP_004202838.1|590276_591410_+	CoA transferase	NA	NA	NA	NA	NA
WP_004525805.1|591486_592053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202836.1|592388_592844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935860.1|593408_593849_+	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_004202832.1|593835_593973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|594000_595121_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	1211493	1220730	3507358		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|1211493_1213446_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_024901038.1|1213712_1214843_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194350.1|1214876_1216883_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194137.1|1217058_1217874_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194274.1|1217938_1218622_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194373.1|1218618_1219146_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194112.1|1219182_1220730_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 4
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	1224220	1302143	3507358	tRNA,transposase,protease	Synechococcus_phage(15.0%)	60	NA	NA
WP_004194103.1|1224220_1225195_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_004194266.1|1225191_1227246_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.7	2.9e-76
WP_004194375.1|1227430_1228111_+	membrane protein	NA	NA	NA	NA	NA
WP_004194228.1|1228431_1229259_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_024901039.1|1229369_1230206_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_004194323.1|1230476_1231904_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.4	1.3e-54
WP_004194028.1|1232301_1234038_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004196472.1|1234317_1235469_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004194378.1|1235649_1236813_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024901040.1|1236894_1238442_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_004194135.1|1238448_1239231_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004194035.1|1239227_1239884_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.1	8.7e-11
WP_004194357.1|1239916_1241440_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024900377.1|1241462_1242785_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_004196467.1|1242884_1243736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194348.1|1243732_1245529_+	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_004541333.1|1245546_1246482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194206.1|1246478_1247321_+	sugar nucleotide-binding protein	NA	A0A222YYW2	Synechococcus_phage	35.0	1.7e-38
WP_004194087.1|1247330_1248344_+	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	52.6	7.2e-97
WP_004194045.1|1248359_1249400_+	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	40.5	1.7e-61
WP_004200490.1|1249396_1249975_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	37.2	2.5e-17
WP_004194086.1|1249976_1250669_+	NTP transferase domain-containing protein	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	28.8	7.5e-05
WP_004194255.1|1250665_1251235_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024901041.1|1251501_1252704_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_004194054.1|1252700_1253489_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194306.1|1253490_1255023_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_004202217.1|1255025_1262666_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194036.1|1262662_1263580_+	UDP-3-O-acyl N-acetylglycosamine deacetylase	NA	NA	NA	NA	NA
WP_004194209.1|1263644_1264964_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004194345.1|1264972_1265665_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038802950.1|1266640_1267760_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_071810810.1|1267834_1268053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|1268250_1268760_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|1269060_1271175_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_024901034.1|1272347_1273811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|1274355_1275201_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|1275369_1276116_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197492.1|1276831_1278193_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004522619.1|1278165_1278501_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|1278797_1280237_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162473466.1|1280584_1280872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200476.1|1280855_1282130_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|1282254_1282860_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004186428.1|1283391_1284414_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|1284429_1284957_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|1285041_1285797_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186611.1|1286030_1287236_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_096325437.1|1287324_1288445_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004185841.1|1289507_1290086_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|1290282_1291665_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|1291659_1291890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|1292122_1293151_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|1293131_1293338_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|1293511_1294303_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|1294511_1295174_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|1295289_1296753_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|1296856_1297060_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|1297592_1297907_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|1297903_1300204_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_038802950.1|1301022_1302143_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	1898449	1968564	3507358	coat,transposase,plate	Leptospira_phage(28.57%)	57	NA	NA
WP_038802950.1|1898449_1899569_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_073699268.1|1899614_1900205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193369.1|1900546_1901053_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	5.1e-19
WP_004191223.1|1901049_1901475_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
WP_004193964.1|1902220_1904113_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191686.1|1904179_1905640_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004197687.1|1905862_1906240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901063.1|1906263_1906842_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_004197691.1|1907056_1909849_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_004266861.1|1909845_1912068_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_004191214.1|1912064_1913807_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_004192927.1|1913833_1915942_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_004205216.1|1918203_1921599_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011832205.1|1921595_1924943_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_004205215.1|1925266_1925521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193933.1|1925496_1926975_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004193830.1|1927157_1927448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192837.1|1927682_1927901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162473508.1|1928396_1928867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193316.1|1928872_1929196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193478.1|1929479_1930904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193589.1|1931170_1932148_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004526732.1|1932561_1933344_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192729.1|1933527_1933743_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_004192564.1|1933753_1934125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196675.1|1934176_1934512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191937.1|1934594_1934753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196677.1|1935118_1935814_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004191391.1|1936201_1939474_+	hemagglutinin	NA	A0A2C9CZB7	Yersinia_phage	33.0	1.4e-05
WP_004191672.1|1939554_1940265_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004192726.1|1940266_1941796_+	hypothetical protein	NA	D6PFH9	uncultured_phage	25.4	1.2e-15
WP_004191318.1|1941812_1942157_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004193132.1|1942579_1942822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193698.1|1942867_1943428_-	SCO family protein	NA	NA	NA	NA	NA
WP_004191878.1|1943462_1943951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196681.1|1943977_1946380_-	DUF1929 domain-containing protein	NA	NA	NA	NA	NA
WP_004196682.1|1946632_1946866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266855.1|1946910_1947747_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009966472.1|1947916_1948045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192127.1|1949038_1950889_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004193292.1|1950916_1952332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193592.1|1952355_1952622_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004192367.1|1952881_1953109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191109.1|1953142_1955950_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	6.8e-28
WP_004192570.1|1955952_1956786_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1957019_1958140_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193170.1|1958875_1960189_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004191144.1|1961083_1961353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193855.1|1961605_1961887_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004192394.1|1962354_1963347_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004196700.1|1963391_1964588_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196705.1|1965094_1965988_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531175.1|1966325_1966547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542449.1|1966632_1966818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192149.1|1966804_1967350_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|1967402_1967963_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|1968039_1968564_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	2031676	2102909	3507358	tRNA,transposase	Bacillus_phage(15.38%)	57	NA	NA
WP_004191922.1|2031676_2034544_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192721.1|2034683_2037047_+	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	30.6	4.2e-71
WP_004193777.1|2037043_2037832_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_004192717.1|2038153_2039404_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196082.1|2039755_2041432_+	chemotaxis methyl-accepting membrane protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	3.9e-15
WP_004191342.1|2041779_2042661_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004191885.1|2042674_2042878_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_004192976.1|2042874_2045076_-	FUSC family protein	NA	NA	NA	NA	NA
WP_024901066.1|2045092_2046868_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004191155.1|2047040_2047982_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192873.1|2048325_2049309_-	ser/threonine protein phosphatase	NA	S4VP02	Pandoravirus	34.0	1.8e-20
WP_004191226.1|2049340_2050762_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004192580.1|2050796_2051246_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_004193704.1|2051242_2051851_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004266851.1|2051956_2053267_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_004192500.1|2053438_2053759_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004193328.1|2053975_2054440_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004196088.1|2054539_2056354_+	MFS transporter	NA	NA	NA	NA	NA
WP_125754530.1|2056365_2056470_+	MFS transporter	NA	NA	NA	NA	NA
WP_004266572.1|2056834_2057944_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	1.1e-82
WP_004521230.1|2058109_2058643_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024900959.1|2058642_2059056_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.0	5.8e-29
WP_038802950.1|2059100_2060221_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197788.1|2060308_2061484_+	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	35.9	1.8e-46
WP_004192661.1|2061608_2063981_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_162473478.1|2064149_2064398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857895.1|2065403_2066954_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004192734.1|2067003_2068269_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011203914.1|2068419_2070099_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004193599.1|2070342_2070804_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004191720.1|2071040_2071451_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004550551.1|2071645_2072743_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191219.1|2072849_2074280_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004192735.1|2074379_2075654_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191889.1|2075781_2078646_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004193111.1|2078984_2080811_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004191941.1|2080763_2080904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192835.1|2081103_2081601_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191557.1|2081700_2083197_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192058.1|2083264_2084500_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004193982.1|2084522_2086082_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011203915.1|2086352_2087288_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004199441.1|2087314_2087683_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004197388.1|2087788_2090716_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004193517.1|2090807_2092283_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004193908.1|2092279_2092741_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004191876.1|2093045_2094710_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192767.1|2094773_2096102_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	5.3e-23
WP_004193481.1|2096520_2097423_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004199443.1|2097841_2098243_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004521676.1|2098448_2098706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199444.1|2098864_2099182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|2099382_2100105_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004192834.1|2100343_2100622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|2100770_2101028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193694.1|2101077_2101368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2101789_2102909_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 7
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	2795018	2860803	3507358	transposase,protease	Streptococcus_phage(36.36%)	46	NA	NA
WP_004191998.1|2795018_2796482_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004199567.1|2796590_2797160_-	phasin family protein	NA	NA	NA	NA	NA
WP_004191998.1|2799069_2800533_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192702.1|2800789_2802559_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	6.8e-34
WP_004193075.1|2802866_2804456_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_004199569.1|2804588_2807285_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_004192045.1|2807416_2807638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557112.1|2807557_2810068_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_004193928.1|2810064_2810703_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192825.1|2811019_2811877_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	4.1e-37
WP_004199570.1|2811833_2812049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191126.1|2812562_2814662_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	21.8	1.7e-39
WP_004191702.1|2814891_2816094_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_004192547.1|2816046_2816331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193983.1|2816816_2818097_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_004192248.1|2818140_2819526_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_004193149.1|2819776_2823502_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_004193619.1|2823498_2825052_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.5	2.9e-20
WP_004192818.1|2825048_2825753_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004191967.1|2825789_2826476_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004193869.1|2826617_2828540_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004192421.1|2828575_2829277_+	response regulator	NA	NA	NA	NA	NA
WP_004193531.1|2829423_2830200_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004191998.1|2830482_2831946_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192209.1|2832079_2833615_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004192981.1|2833652_2834795_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004192601.1|2834961_2836377_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004191860.1|2836781_2837246_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192990.1|2837498_2838317_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004193555.1|2838313_2839147_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_004192998.1|2839690_2840680_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_004192001.1|2840696_2841689_-	beta-propeller fold lactonase family protein	NA	A0A2H4JCI3	uncultured_Caudovirales_phage	59.6	3.5e-11
WP_004202033.1|2841790_2845918_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.5	4.3e-47
WP_004192168.1|2845941_2847318_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193961.1|2847370_2847646_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004192533.1|2847818_2849150_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_004199573.1|2849358_2850885_-	CoA transferase	NA	NA	NA	NA	NA
WP_004193195.1|2850881_2852675_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004193679.1|2852783_2853686_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|2854087_2855551_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_011832359.1|2855667_2856234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2856377_2857498_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193468.1|2857607_2858084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|2858540_2858765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193210.1|2859029_2860166_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|2860263_2860803_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 8
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	3022242	3086156	3507358	transposase,protease	Leptospira_phage(25.0%)	60	NA	NA
WP_004192020.1|3022242_3023751_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	2.8e-20
WP_004192760.1|3023767_3024820_-	sugar dehydratase	NA	NA	NA	NA	NA
WP_004192486.1|3024825_3025428_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_004193971.1|3025511_3026111_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.3	3.8e-05
WP_004192146.1|3026216_3026690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024901020.1|3026701_3027940_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_004197638.1|3028096_3028336_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.6e-10
WP_004197597.1|3028479_3029229_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	5.8e-19
WP_004193828.1|3029279_3030212_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004191537.1|3030282_3031272_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_004192749.1|3031271_3032378_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_004192741.1|3032516_3032696_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_004193919.1|3032792_3033425_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_004192535.1|3033668_3034316_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004193677.1|3034312_3035035_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191725.1|3035073_3036075_-	S49 family peptidase	NA	NA	NA	NA	NA
WP_004193415.1|3036084_3036480_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004193798.1|3036777_3037785_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192715.1|3038548_3041821_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_004532083.1|3041960_3043073_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_004192903.1|3043106_3043730_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_004191191.1|3043841_3045152_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_004192965.1|3045188_3045476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199373.1|3045472_3045976_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193862.1|3046218_3047694_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_011203830.1|3047690_3048680_-	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	25.8	4.1e-12
WP_004193636.1|3048745_3050188_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004192015.1|3050243_3050906_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004202995.1|3051050_3052250_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.7	1.2e-55
WP_004193394.1|3052334_3052601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004205776.1|3052518_3052842_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_004197812.1|3053329_3053809_+	protein CreA	NA	NA	NA	NA	NA
WP_004536352.1|3054399_3055188_+	DUF4088 family protein	NA	NA	NA	NA	NA
WP_004189585.1|3055372_3055879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189709.1|3056216_3056438_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_004189199.1|3056562_3057969_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_038802950.1|3058286_3059406_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197806.1|3059602_3059776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189867.1|3059790_3061185_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004190145.1|3061663_3062170_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004197804.1|3062357_3062552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189917.1|3063122_3063833_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|3066671_3068135_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189292.1|3068292_3069903_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3069915_3070098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3070070_3071330_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3071597_3072176_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_096325434.1|3072369_3073490_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_096325434.1|3074601_3075722_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197797.1|3076148_3076307_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_011203825.1|3076303_3076897_-	chorismate mutase	NA	NA	NA	NA	NA
WP_004189159.1|3077509_3077899_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004188913.1|3078045_3080382_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004189437.1|3080390_3081641_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_004203540.1|3081637_3082126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197795.1|3082412_3082664_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004197793.1|3083363_3083579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|3083834_3084311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190100.1|3084333_3084594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|3084935_3086156_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 9
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	3139033	3147875	3507358		Bacillus_phage(16.67%)	8	NA	NA
WP_004189214.1|3139033_3140434_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004200795.1|3140402_3141389_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004190173.1|3141447_3142440_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|3142511_3142829_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|3143152_3144055_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_024901052.1|3144280_3145588_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|3145766_3146690_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004190087.1|3147032_3147875_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 10
NZ_CP009735	Burkholderia mallei strain Turkey6 chromosome 1, complete sequence	3507358	3409010	3466508	3507358	portal,tRNA,transposase,protease	Vibrio_phage(17.65%)	49	NA	NA
WP_004191998.1|3409010_3410474_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|3410640_3411411_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|3411442_3412282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190092.1|3412408_3413881_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|3413883_3415374_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|3415486_3415786_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_024901104.1|3416151_3417195_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|3417314_3418388_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189260.1|3418384_3418897_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|3419080_3421489_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|3421500_3422649_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004190168.1|3422971_3423748_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|3423744_3424530_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|3424951_3425404_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|3425423_3426056_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|3426149_3426884_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|3427351_3428035_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|3428035_3430444_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|3430445_3431036_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|3431032_3432442_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|3432811_3433669_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|3433778_3434414_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|3434534_3435518_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|3435549_3436053_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|3436281_3437472_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|3437531_3437903_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|3438113_3440723_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|3440944_3442000_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|3442449_3443466_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|3443586_3444456_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|3444493_3444898_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|3445288_3446509_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_038802950.1|3447825_3448945_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200731.1|3448997_3449480_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|3449476_3449761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|3449833_3450925_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004200729.1|3451323_3451734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|3451870_3452746_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|3452756_3453869_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_162496236.1|3454917_3455076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189434.1|3455133_3456102_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189689.1|3457368_3457917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|3458180_3459629_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004200727.1|3459647_3461261_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|3461420_3462362_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|3462358_3463453_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|3463854_3464271_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|3464456_3465011_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_038802950.1|3465388_3466508_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 1
NZ_CP009736	Burkholderia mallei strain Turkey6 chromosome 2, complete sequence	2240464	171108	214835	2240464	transposase,plate	Streptococcus_phage(50.0%)	29	NA	NA
WP_004191998.1|171108_172572_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004554722.1|172710_173610_-	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196258.1|173773_175021_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004188170.1|175173_176106_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188660.1|176650_177391_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004202300.1|177410_177695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187552.1|177834_178200_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004196252.1|178641_180558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188385.1|180769_183730_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_011204674.1|183757_183988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|184294_185515_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004188150.1|185644_186703_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_004187705.1|187628_189113_+	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004187879.1|189158_191027_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	25.9	3.0e-24
WP_004187502.1|191055_192027_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004187006.1|192081_193008_+	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004196246.1|193250_194597_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188288.1|195182_195413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188530.1|199536_200802_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188743.1|200890_202237_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004187276.1|202258_202762_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188308.1|202868_203354_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004188012.1|203470_204970_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004196243.1|205004_205586_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011204222.1|207743_209207_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004188539.1|210638_211385_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_004187921.1|211381_212347_+	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004187068.1|212333_212915_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187986.1|212945_214835_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009736	Burkholderia mallei strain Turkey6 chromosome 2, complete sequence	2240464	383806	454590	2240464	transposase,holin,tRNA	Acinetobacter_phage(40.0%)	58	NA	NA
WP_004521984.1|383806_385105_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004200645.1|385396_385708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198580.1|385704_385959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186938.1|385977_387792_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	49.6	3.0e-170
WP_004186966.1|387928_388480_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004186915.1|388476_389100_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_004186903.1|389435_391103_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	5.8e-43
WP_004186876.1|391389_391701_-	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_004202137.1|391840_392818_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_004198399.1|392933_393413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186796.1|393570_393792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186864.1|394075_395479_+	GABA permease	NA	NA	NA	NA	NA
WP_004186854.1|395550_396384_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186860.1|396397_396901_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_004206632.1|397115_397397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186874.1|397507_398602_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004186799.1|399127_399493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557275.1|399501_399858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266669.1|399949_400078_-	lipoprotein	NA	NA	NA	NA	NA
WP_004521997.1|400392_401574_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_004186871.1|401675_402404_+	DsbC family protein	NA	NA	NA	NA	NA
WP_004186839.1|402503_404333_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_004549943.1|404471_405068_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004186801.1|405287_406067_-	uracil-DNA glycosylase	NA	A0A060Q589	Fruit_bat_alphaherpesvirus	51.1	6.4e-53
WP_004186832.1|406108_406750_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_004186826.1|406760_407546_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	46.7	9.3e-52
WP_004186823.1|407608_408640_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.0	1.6e-80
WP_004186792.1|408657_409248_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	60.0	1.4e-68
WP_004186866.1|409261_410755_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	30.5	3.5e-39
WP_004186872.1|411117_411846_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004186923.1|411842_412538_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004522004.1|412584_412794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186878.1|412719_413094_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_038719768.1|413202_414429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186945.1|414756_416055_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_004186957.1|416568_417360_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_004522007.1|417418_418621_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004186941.1|418709_420416_-	phenylacetic acid degradation protein PaaN	NA	NA	NA	NA	NA
WP_004198410.1|420546_421323_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_073699529.1|421719_421836_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_096325434.1|427454_428574_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004184834.1|428815_430276_+	ser/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_009967729.1|431854_432787_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_011326545.1|433230_433920_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024900894.1|433951_434686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|442480_443601_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004266245.1|444159_445230_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_004184680.1|445292_445787_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_004184724.1|445821_446301_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004198701.1|446297_446633_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004266244.1|447104_448004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198708.1|448102_448318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198711.1|448693_448885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555731.1|448911_449574_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162490682.1|449807_451523_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.8	3.9e-26
WP_004200833.1|451515_452418_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_004199315.1|452540_453539_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004533171.1|453639_454590_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 3
NZ_CP009736	Burkholderia mallei strain Turkey6 chromosome 2, complete sequence	2240464	529965	586974	2240464	transposase	Streptococcus_phage(37.5%)	45	NA	NA
WP_004191998.1|529965_531429_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004551552.1|531631_532468_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200939.1|532467_532962_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200941.1|533143_533983_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200942.1|534232_535273_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004200943.1|535640_536786_+	cytochrome P460	NA	NA	NA	NA	NA
WP_004200944.1|536974_538183_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184941.1|538587_539364_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004200946.1|539379_540249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200950.1|541092_542508_+	amino acid permease	NA	NA	NA	NA	NA
WP_004200952.1|543103_543346_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004184704.1|543496_543787_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024901083.1|544180_545497_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004201904.1|545918_546416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266679.1|546533_547418_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_038802950.1|547528_548649_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198724.1|549670_551725_-	sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein	NA	NA	NA	NA	NA
WP_004204041.1|551984_552440_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_004194708.1|552436_553291_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_004194588.1|553338_554685_+	MFS transporter	NA	NA	NA	NA	NA
WP_004194610.1|555086_556196_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_004194640.1|556433_557516_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004194602.1|557572_558670_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.5	5.5e-26
WP_004194612.1|558647_559595_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004194685.1|559584_560445_+	2-aminoethylphosphonate ABC transport system, membrane component PhnV	NA	NA	NA	NA	NA
WP_004199121.1|560488_561760_+	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
WP_004194628.1|561756_563211_+	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004194622.1|563215_563767_+	HD domain-containing protein	NA	A0A2K9L141	Tupanvirus	34.1	2.3e-20
WP_073699529.1|564206_564323_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_038802950.1|569920_571041_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198117.1|571211_571358_+	DUF3563 family protein	NA	NA	NA	NA	NA
WP_011204222.1|571482_572946_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004198119.1|573154_573433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198120.1|573445_574291_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004198121.1|574439_575411_-	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004266709.1|575598_576387_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004191998.1|576591_578055_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198124.1|578198_579398_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004199587.1|579685_581776_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004266710.1|581999_582551_+	membrane protein	NA	NA	NA	NA	NA
WP_004198127.1|582610_582940_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004198128.1|582999_583842_+	iron transporter OFeT family	NA	NA	NA	NA	NA
WP_004198129.1|583838_585239_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_004199588.1|585298_585709_+	heme-binding protein	NA	NA	NA	NA	NA
WP_038802333.1|585854_586974_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 4
NZ_CP009736	Burkholderia mallei strain Turkey6 chromosome 2, complete sequence	2240464	1753653	1828339	2240464	plate,transposase,tRNA	Leptospira_phage(33.33%)	59	NA	NA
WP_004203245.1|1753653_1754466_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004203246.1|1754465_1757093_-	membrane protein	NA	NA	NA	NA	NA
WP_004188178.1|1757228_1758350_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004525190.1|1758348_1758510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187693.1|1758691_1759759_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_004187882.1|1759807_1760458_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_004187125.1|1760535_1760685_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004187091.1|1760681_1762091_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004187288.1|1762482_1763778_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004187652.1|1763770_1764718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187998.1|1765437_1765965_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187349.1|1766125_1768849_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_004188364.1|1769100_1770345_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_096325434.1|1771556_1772676_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200651.1|1772687_1772831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187842.1|1772906_1773881_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004188362.1|1773977_1775279_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004188825.1|1775331_1775604_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_004187935.1|1775605_1776307_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004188402.1|1776328_1778104_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004187439.1|1778108_1778477_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004536542.1|1778481_1778898_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004196014.1|1779097_1779907_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187735.1|1780196_1781180_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_004188261.1|1781377_1782397_+	lyase	NA	NA	NA	NA	NA
WP_004188791.1|1782553_1783063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188028.1|1783139_1784591_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_004187807.1|1784638_1787356_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_004187717.1|1787602_1790320_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004188259.1|1790420_1792085_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	22.5	1.9e-17
WP_004204352.1|1792108_1792381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1792676_1793796_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196172.1|1795228_1796488_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004190781.1|1796588_1797635_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190757.1|1797709_1798810_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	5.2e-24
WP_004200631.1|1798918_1800448_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004196164.1|1801542_1802568_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190808.1|1802918_1805156_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004190837.1|1805243_1805639_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190603.1|1805799_1806336_-	cytochrome b	NA	NA	NA	NA	NA
WP_004190805.1|1806604_1807240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204344.1|1807370_1808135_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_004190911.1|1808413_1808725_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204342.1|1809169_1809502_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190614.1|1809700_1811116_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_004190588.1|1811104_1811248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190461.1|1811571_1812249_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190245.1|1812211_1813150_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190776.1|1813146_1814571_-	cytosine permease	NA	NA	NA	NA	NA
WP_011204340.1|1815087_1816068_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045589205.1|1816080_1816842_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_038802950.1|1816741_1817861_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196154.1|1817889_1818948_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004196151.1|1818877_1819531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|1819605_1821810_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004203276.1|1821806_1824461_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	2.3e-78
WP_004190820.1|1824439_1825918_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190509.1|1825914_1827786_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009935240.1|1827790_1828339_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009736	Burkholderia mallei strain Turkey6 chromosome 2, complete sequence	2240464	1903962	1963332	2240464	portal,transposase,integrase,tRNA	Leptospira_phage(22.22%)	53	1895678:1895737	1958018:1958968
1895678:1895737	attL	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCC	NA	NA	NA	NA
WP_011204325.1|1903962_1905003_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.7e-93
WP_004195713.1|1905393_1906203_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004266656.1|1906353_1908258_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004190235.1|1908341_1909226_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|1909222_1909516_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|1909785_1910892_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004191998.1|1911042_1912506_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190656.1|1912630_1913500_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|1913558_1914434_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004204467.1|1914586_1914808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038763983.1|1915147_1916941_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|1917302_1918685_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190446.1|1919003_1921784_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	2.9e-71
WP_004530319.1|1921785_1922535_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190924.1|1922531_1922801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190916.1|1922952_1923237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190352.1|1923896_1924388_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004203322.1|1924823_1925087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1926991_1928111_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009950031.1|1928668_1928956_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
WP_004195697.1|1928952_1929639_+|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_004190957.1|1929722_1931249_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004190726.1|1931404_1931803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190439.1|1931896_1932892_+	homoserine kinase	NA	NA	NA	NA	NA
WP_004190835.1|1932882_1933695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038730270.1|1933826_1934078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190487.1|1934197_1934650_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011832128.1|1934787_1935207_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004190391.1|1935319_1935478_-	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_004190691.1|1935574_1936723_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004204469.1|1936973_1937672_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004195689.1|1938112_1938913_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190258.1|1938925_1939600_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004190506.1|1939601_1940303_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
WP_004190826.1|1940846_1941695_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_004195687.1|1941729_1943652_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_004190990.1|1943849_1944233_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_004190343.1|1944330_1945206_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190540.1|1945272_1946193_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004190659.1|1946285_1947065_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004190954.1|1947150_1948491_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004190469.1|1948487_1949117_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004190582.1|1949275_1950919_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_004190434.1|1952203_1952659_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004190743.1|1952723_1953962_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_004195676.1|1954214_1954625_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004190802.1|1954866_1955460_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004533441.1|1955555_1956410_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195671.1|1956640_1956967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190721.1|1957149_1958037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1958064_1959185_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
1958018:1958968	attR	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCA	NA	NA	NA	NA
WP_004190833.1|1959250_1960330_-	putative membrane protein	NA	NA	NA	NA	NA
WP_004190269.1|1962327_1963332_-|transposase	transposase	transposase	NA	NA	NA	NA
