The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	405382	442962	3573819	transposase,holin,plate	Streptococcus_phage(20.0%)	32	NA	NA
WP_004191998.1|405382_406846_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198200.1|406979_408044_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011807805.1|408289_408958_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_004198198.1|409051_409603_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_004198197.1|409796_410657_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_004198195.1|411724_412105_+	response regulator	NA	NA	NA	NA	NA
WP_011204177.1|412136_414440_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_004199265.1|414470_414998_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_004202799.1|415038_417060_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	2.2e-12
WP_011832274.1|417063_418011_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
WP_004198646.1|418007_418712_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_004200023.1|418708_419812_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_004185006.1|420160_420556_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	2.7e-07
WP_004524402.1|420557_421286_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_004198643.1|421483_421987_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_004198642.1|422009_423260_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_004198641.1|423446_423947_+	VOC family protein	NA	NA	NA	NA	NA
WP_004198640.1|424654_425860_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_004198639.1|425856_427959_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_123784499.1|427939_428479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198638.1|428574_429699_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_004198637.1|429691_430504_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_004198636.1|430525_431260_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_004198634.1|431613_433035_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	7.6e-44
WP_004198632.1|433198_433552_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|433569_434400_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_038798086.1|434583_436074_-	6-aminohexanoate hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|436170_436863_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_096325434.1|438238_439358_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204912.1|439497_439980_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004202808.1|440059_441898_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004200010.1|441861_442962_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	542509	595129	3573819	transposase,protease,portal,terminase	Leptospira_phage(20.0%)	47	NA	NA
WP_004199890.1|542509_543031_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004199888.1|543252_543750_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|543746_544802_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|544845_545202_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199884.1|545204_545501_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	2.8e-49
WP_038802950.1|546308_547428_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199882.1|548053_548326_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_004201278.1|548444_549227_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_004199881.1|549546_549975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199880.1|550056_550932_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004199879.1|550924_551446_+	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_004202867.1|551603_552617_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199877.1|552700_553498_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.5e-30
WP_004201276.1|553525_554374_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004197153.1|554451_555831_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004197150.1|555841_556519_+	response regulator	NA	NA	NA	NA	NA
WP_004197145.1|556808_557969_+	porin	NA	NA	NA	NA	NA
WP_004197141.1|558004_558187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901007.1|558441_560457_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.8	2.5e-85
WP_004197137.1|560497_563527_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	38.7	2.2e-181
WP_004197133.1|564064_565165_+	porin	NA	NA	NA	NA	NA
WP_004199873.1|565564_566524_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004538585.1|566646_567378_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	1.6e-05
WP_004197129.1|567750_568473_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.8e-07
WP_004197128.1|568469_569519_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197127.1|569515_570394_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197126.1|570398_571658_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004198383.1|571874_573380_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004198382.1|573435_573828_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004198380.1|573838_574648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198379.1|574693_575491_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.8	3.3e-12
WP_004198377.1|575575_577225_-	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.9	2.0e-56
WP_004198376.1|577952_578294_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038802950.1|579467_580587_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004525798.1|581010_581316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202848.1|581339_582326_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_004202847.1|582355_583192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160468978.1|583650_584838_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004202842.1|584836_585973_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004202841.1|586579_587785_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_004202840.1|587797_589921_+	fatty oxidation complex subunit alpha	NA	NA	NA	NA	NA
WP_004202838.1|590284_591418_+	CoA transferase	NA	NA	NA	NA	NA
WP_004525805.1|591494_592061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202836.1|592396_592852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935860.1|593416_593857_+	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_004202832.1|593843_593981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|594008_595129_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	1248881	1258118	3573819		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|1248881_1250834_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_024901038.1|1251100_1252231_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194350.1|1252264_1254271_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194137.1|1254446_1255262_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194274.1|1255326_1256010_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194373.1|1256006_1256534_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194112.1|1256570_1258118_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 4
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	1261608	1339550	3573819	transposase,protease,tRNA	Synechococcus_phage(15.0%)	60	NA	NA
WP_004194103.1|1261608_1262583_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_004194266.1|1262579_1264634_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.7	2.9e-76
WP_004194375.1|1264818_1265499_+	membrane protein	NA	NA	NA	NA	NA
WP_004194228.1|1265819_1266647_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_024901039.1|1266757_1267594_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_004194323.1|1267864_1269292_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.4	1.3e-54
WP_004194028.1|1269689_1271426_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004196472.1|1271705_1272857_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004194378.1|1273037_1274201_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024901040.1|1274282_1275830_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_004194135.1|1275836_1276619_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004194035.1|1276615_1277272_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.1	8.7e-11
WP_004194357.1|1277304_1278828_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024900377.1|1278850_1280173_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_004196467.1|1280272_1281124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194348.1|1281120_1282917_+	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_004541333.1|1282934_1283870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194206.1|1283866_1284709_+	sugar nucleotide-binding protein	NA	A0A222YYW2	Synechococcus_phage	35.0	1.7e-38
WP_004194087.1|1284718_1285732_+	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	52.6	7.2e-97
WP_004194045.1|1285747_1286788_+	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	40.5	1.7e-61
WP_004200490.1|1286784_1287363_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	37.2	2.5e-17
WP_004194086.1|1287364_1288057_+	NTP transferase domain-containing protein	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	28.8	7.5e-05
WP_004194255.1|1288053_1288623_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024901041.1|1288889_1290092_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_004194054.1|1290088_1290877_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194306.1|1290878_1292411_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_004202217.1|1292413_1300054_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194036.1|1300050_1300968_+	UDP-3-O-acyl N-acetylglycosamine deacetylase	NA	NA	NA	NA	NA
WP_004194209.1|1301032_1302352_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004194345.1|1302360_1303053_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038802950.1|1304028_1305148_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_071810810.1|1305222_1305441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|1305638_1306148_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|1306448_1308563_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_024901034.1|1309735_1311199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|1311743_1312589_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|1312757_1313504_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197492.1|1314219_1315581_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004522619.1|1315553_1315889_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|1316185_1317625_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162473466.1|1317972_1318260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200476.1|1318243_1319518_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|1319642_1320248_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004186428.1|1320779_1321802_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|1321817_1322345_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|1322429_1323185_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186611.1|1323418_1324624_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_096325437.1|1324712_1325833_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004185841.1|1326895_1327474_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|1327670_1329053_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|1329047_1329278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|1329510_1330539_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|1330519_1330726_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|1330899_1331691_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|1331899_1332562_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|1332696_1334160_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|1334263_1334467_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|1334999_1335314_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|1335310_1337611_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_038802950.1|1338429_1339550_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	1935920	2006062	3573819	coat,transposase,plate	Leptospira_phage(28.57%)	57	NA	NA
WP_038802950.1|1935920_1937040_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_073699268.1|1937085_1937676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193369.1|1938017_1938524_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	5.1e-19
WP_004191223.1|1938520_1938946_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
WP_004193964.1|1939691_1941584_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191686.1|1941650_1943111_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004197687.1|1943333_1943711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901063.1|1943734_1944313_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_004197691.1|1944527_1947320_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_004266861.1|1947316_1949539_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_004191214.1|1949535_1951278_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_004192927.1|1951304_1953413_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_004205216.1|1955674_1959070_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011832205.1|1959066_1962414_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_004205215.1|1962737_1962992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193933.1|1962967_1964446_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004193830.1|1964628_1964919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192837.1|1965153_1965372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162473477.1|1965867_1966161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193316.1|1966343_1966667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193478.1|1966950_1968375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193589.1|1968641_1969619_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004526732.1|1970032_1970815_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192729.1|1970998_1971214_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_004192564.1|1971224_1971596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196675.1|1971647_1971983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191937.1|1972065_1972224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196677.1|1972589_1973285_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004191391.1|1973672_1976945_+	hemagglutinin	NA	A0A2C9CZB7	Yersinia_phage	33.0	1.4e-05
WP_004191672.1|1977025_1977736_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004192726.1|1977737_1979267_+	hypothetical protein	NA	D6PFH9	uncultured_phage	25.4	1.2e-15
WP_004191318.1|1979283_1979628_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004193132.1|1980050_1980293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193698.1|1980338_1980899_-	SCO family protein	NA	NA	NA	NA	NA
WP_004191878.1|1980933_1981422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196681.1|1981448_1983851_-	DUF1929 domain-containing protein	NA	NA	NA	NA	NA
WP_004196682.1|1984103_1984337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266855.1|1984381_1985218_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009966472.1|1985387_1985516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192127.1|1986509_1988360_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004193292.1|1988387_1989803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193592.1|1989826_1990093_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004192367.1|1990352_1990580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191109.1|1990613_1993421_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	6.8e-28
WP_004192570.1|1993423_1994257_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1994490_1995611_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193170.1|1996346_1997660_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004191144.1|1998554_1998824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193855.1|1999076_1999358_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004192394.1|1999825_2000818_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004196700.1|2000862_2002059_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196705.1|2002565_2003459_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531175.1|2003796_2004018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542449.1|2004103_2004289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192149.1|2004275_2004821_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|2004900_2005461_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|2005537_2006062_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	2069165	2140389	3573819	transposase,tRNA	Bacillus_phage(15.38%)	57	NA	NA
WP_004191922.1|2069165_2072033_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192721.1|2072172_2074536_+	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	30.6	4.2e-71
WP_004193777.1|2074532_2075321_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_004192717.1|2075642_2076893_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196082.1|2077244_2078921_+	chemotaxis methyl-accepting membrane protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	3.9e-15
WP_004191342.1|2079268_2080150_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004191885.1|2080163_2080367_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_004192976.1|2080363_2082565_-	FUSC family protein	NA	NA	NA	NA	NA
WP_024900385.1|2082581_2084348_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004191155.1|2084520_2085462_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192873.1|2085805_2086789_-	ser/threonine protein phosphatase	NA	S4VP02	Pandoravirus	34.0	1.8e-20
WP_004191226.1|2086820_2088242_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004192580.1|2088276_2088726_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_004193704.1|2088722_2089331_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004266851.1|2089436_2090747_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_004192500.1|2090918_2091239_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004193328.1|2091455_2091920_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004196088.1|2092019_2093834_+	MFS transporter	NA	NA	NA	NA	NA
WP_125754530.1|2093845_2093950_+	MFS transporter	NA	NA	NA	NA	NA
WP_004266572.1|2094314_2095424_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	1.1e-82
WP_004521230.1|2095589_2096123_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024900959.1|2096122_2096536_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.0	5.8e-29
WP_038802950.1|2096580_2097701_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197788.1|2097788_2098964_+	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	35.9	1.8e-46
WP_004192661.1|2099088_2101461_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_162473478.1|2101629_2101878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857895.1|2102883_2104434_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004192734.1|2104483_2105749_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011203914.1|2105899_2107579_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004193599.1|2107822_2108284_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004191720.1|2108520_2108931_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004550551.1|2109125_2110223_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191219.1|2110329_2111760_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004192735.1|2111859_2113134_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191889.1|2113261_2116126_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004193111.1|2116464_2118291_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004191941.1|2118243_2118384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192835.1|2118583_2119081_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191557.1|2119180_2120677_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192058.1|2120744_2121980_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004193982.1|2122002_2123562_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011203915.1|2123832_2124768_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004199441.1|2124794_2125163_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004197388.1|2125268_2128196_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004193517.1|2128287_2129763_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004193908.1|2129759_2130221_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004191876.1|2130525_2132190_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192767.1|2132253_2133582_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	5.3e-23
WP_004193481.1|2134000_2134903_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004199443.1|2135321_2135723_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004521676.1|2135928_2136186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199444.1|2136344_2136662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|2136862_2137585_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004192834.1|2137823_2138102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|2138250_2138508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193694.1|2138557_2138848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2139269_2140389_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 7
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	2833781	2899566	3573819	transposase,protease	Streptococcus_phage(36.36%)	46	NA	NA
WP_004191998.1|2833781_2835245_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004199567.1|2835353_2835923_-	phasin family protein	NA	NA	NA	NA	NA
WP_004191998.1|2837832_2839296_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192702.1|2839552_2841322_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	6.8e-34
WP_004193075.1|2841629_2843219_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_004199569.1|2843351_2846048_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_004192045.1|2846179_2846401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557112.1|2846320_2848831_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_004193928.1|2848827_2849466_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192825.1|2849782_2850640_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	4.1e-37
WP_004199570.1|2850596_2850812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191126.1|2851325_2853425_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	21.8	1.7e-39
WP_004191702.1|2853654_2854857_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_004192547.1|2854809_2855094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193983.1|2855579_2856860_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_004192248.1|2856903_2858289_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_004193149.1|2858539_2862265_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_004193619.1|2862261_2863815_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.5	2.9e-20
WP_004192818.1|2863811_2864516_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004191967.1|2864552_2865239_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004193869.1|2865380_2867303_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004192421.1|2867338_2868040_+	response regulator	NA	NA	NA	NA	NA
WP_004193531.1|2868186_2868963_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004191998.1|2869245_2870709_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192209.1|2870842_2872378_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004192981.1|2872415_2873558_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004192601.1|2873724_2875140_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004191860.1|2875544_2876009_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192990.1|2876261_2877080_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004193555.1|2877076_2877910_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_004192998.1|2878453_2879443_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_004192001.1|2879459_2880452_-	beta-propeller fold lactonase family protein	NA	A0A2H4JCI3	uncultured_Caudovirales_phage	59.6	3.5e-11
WP_004202033.1|2880553_2884681_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.5	4.3e-47
WP_004192168.1|2884704_2886081_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193961.1|2886133_2886409_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004192533.1|2886581_2887913_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_004199573.1|2888121_2889648_-	CoA transferase	NA	NA	NA	NA	NA
WP_004193195.1|2889644_2891438_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004193679.1|2891546_2892449_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|2892850_2894314_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_011832359.1|2894430_2894997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2895140_2896261_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193468.1|2896370_2896847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|2897303_2897528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193210.1|2897792_2898929_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|2899026_2899566_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 8
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	3130850	3187708	3573819	transposase,protease	Leptospira_phage(25.0%)	53	NA	NA
WP_004192020.1|3130850_3132359_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	2.8e-20
WP_004192760.1|3132375_3133428_-	sugar dehydratase	NA	NA	NA	NA	NA
WP_004192486.1|3133433_3134036_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_004193971.1|3134119_3134719_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.3	3.8e-05
WP_004192146.1|3134824_3135298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024901020.1|3135309_3136548_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_004197638.1|3136704_3136944_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.6e-10
WP_004197597.1|3137087_3137837_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	5.8e-19
WP_004193828.1|3137887_3138820_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004191537.1|3138890_3139880_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_004192749.1|3139879_3140986_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_004192741.1|3141124_3141304_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_004193919.1|3141400_3142033_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_004192535.1|3142276_3142924_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004193677.1|3142920_3143643_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191725.1|3143681_3144683_-	S49 family peptidase	NA	NA	NA	NA	NA
WP_004193415.1|3144692_3145088_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004193798.1|3145385_3146393_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192715.1|3147156_3150429_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_004532083.1|3150568_3151681_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_004192903.1|3151714_3152338_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_004191191.1|3152449_3153760_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_004192965.1|3153796_3154084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199373.1|3154080_3154584_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193862.1|3154826_3156302_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_011203830.1|3156298_3157288_-	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	25.8	4.1e-12
WP_004193636.1|3157353_3158796_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004192015.1|3158851_3159514_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004202995.1|3159658_3160858_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.7	1.2e-55
WP_004193394.1|3160942_3161209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004205776.1|3161126_3161450_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_004197812.1|3161937_3162417_+	protein CreA	NA	NA	NA	NA	NA
WP_004536352.1|3163007_3163796_+	DUF4088 family protein	NA	NA	NA	NA	NA
WP_004189585.1|3163980_3164487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189709.1|3164824_3165046_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_004189199.1|3165170_3166577_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_038802950.1|3166894_3168014_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197806.1|3168210_3168384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189867.1|3168398_3169793_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004190145.1|3170271_3170778_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_162473585.1|3170965_3171172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189917.1|3171723_3172434_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|3175272_3176736_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189292.1|3176893_3178504_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3178516_3178699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3178671_3179931_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3180198_3180777_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_096325434.1|3180970_3182091_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_096325434.1|3183202_3184323_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197793.1|3184915_3185131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|3185386_3185863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190100.1|3185885_3186146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|3186487_3187708_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 9
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	3240585	3249427	3573819		Bacillus_phage(16.67%)	8	NA	NA
WP_004189214.1|3240585_3241986_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004200795.1|3241954_3242941_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004190173.1|3242999_3243992_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|3244063_3244381_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|3244704_3245607_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_024901052.1|3245832_3247140_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|3247318_3248242_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004190087.1|3248584_3249427_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 10
NZ_CP009739	Burkholderia mallei strain Turkey8 chromosome 1, complete sequence	3573819	3510569	3568094	3573819	transposase,protease,portal,tRNA	Vibrio_phage(17.65%)	51	NA	NA
WP_004191998.1|3510569_3512033_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|3512199_3512970_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|3513001_3513841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190092.1|3513967_3515440_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|3515442_3516933_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|3517045_3517345_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_024901104.1|3517710_3518754_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|3518873_3519947_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189260.1|3519943_3520456_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|3520639_3523048_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|3523059_3524208_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004190168.1|3524558_3525335_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|3525331_3526117_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|3526538_3526991_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|3527010_3527643_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|3527736_3528471_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|3528938_3529622_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|3529622_3532031_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|3532032_3532623_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|3532619_3534029_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|3534398_3535256_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|3535365_3536001_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|3536121_3537105_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|3537136_3537640_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|3537868_3539059_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|3539118_3539490_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|3539700_3542310_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|3542531_3543587_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|3544036_3545053_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|3545173_3546043_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|3546080_3546485_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|3546875_3548096_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_009918009.1|3548558_3548813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|3549412_3550532_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200731.1|3550584_3551067_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|3551063_3551348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|3551420_3552512_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004200729.1|3552910_3553321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|3553457_3554333_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|3554343_3555456_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004201742.1|3555484_3556579_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189434.1|3556721_3557690_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189874.1|3557792_3558362_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189689.1|3558954_3559503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|3559766_3561215_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004200727.1|3561233_3562847_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|3563006_3563948_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|3563944_3565039_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|3565440_3565857_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|3566042_3566597_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_038802950.1|3566974_3568094_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 1
NZ_CP009740	Burkholderia mallei strain Turkey8 chromosome 2, complete sequence	2120572	171060	214787	2120572	plate,transposase	Streptococcus_phage(40.0%)	29	NA	NA
WP_004191998.1|171060_172524_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004554722.1|172662_173562_-	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196258.1|173725_174973_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004188170.1|175125_176058_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188660.1|176602_177343_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004202300.1|177362_177647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187552.1|177786_178152_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004196252.1|178593_180510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188385.1|180721_183682_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_011204674.1|183709_183940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|184246_185467_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004188150.1|185596_186655_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_004187705.1|187580_189065_+	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004187879.1|189110_190979_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SHV8	Klosneuvirus	23.1	1.9e-18
WP_004187502.1|191007_191979_+	quinone oxidoreductase	NA	A0A2P1ELD9	Moumouvirus	25.2	6.6e-07
WP_004187006.1|192033_192960_+	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004196246.1|193202_194549_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188288.1|195134_195365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188530.1|199488_200754_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188743.1|200842_202189_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004187276.1|202210_202714_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188308.1|202820_203306_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004188012.1|203422_204922_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004196243.1|204956_205538_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011204222.1|207695_209159_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004188539.1|210590_211337_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_004187921.1|211333_212299_+	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004187068.1|212285_212867_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187986.1|212897_214787_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009740	Burkholderia mallei strain Turkey8 chromosome 2, complete sequence	2120572	503963	560972	2120572	transposase	Streptococcus_phage(33.33%)	45	NA	NA
WP_004191998.1|503963_505427_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004551552.1|505629_506466_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200939.1|506465_506960_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200941.1|507141_507981_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200942.1|508230_509271_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	23.5	2.4e-10
WP_004200943.1|509638_510784_+	cytochrome P460	NA	NA	NA	NA	NA
WP_004200944.1|510972_512181_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184941.1|512585_513362_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004200946.1|513377_514247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200950.1|515090_516506_+	amino acid permease	NA	NA	NA	NA	NA
WP_004200952.1|517101_517344_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004184704.1|517494_517785_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	37.8	4.4e-07
WP_024901083.1|518178_519495_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004201904.1|519916_520414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266679.1|520531_521416_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_038802950.1|521526_522647_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198724.1|523668_525723_-	sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein	NA	NA	NA	NA	NA
WP_004204041.1|525982_526438_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_004194708.1|526434_527289_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_004194588.1|527336_528683_+	MFS transporter	NA	NA	NA	NA	NA
WP_004194610.1|529084_530194_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_004194640.1|530431_531514_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004194602.1|531570_532668_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.5	5.5e-26
WP_004194612.1|532645_533593_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004194685.1|533582_534443_+	2-aminoethylphosphonate ABC transport system, membrane component PhnV	NA	NA	NA	NA	NA
WP_004199121.1|534486_535758_+	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
WP_004194628.1|535754_537209_+	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004194622.1|537213_537765_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_073699529.1|538204_538321_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_038802950.1|543918_545039_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198117.1|545209_545356_+	DUF3563 family protein	NA	NA	NA	NA	NA
WP_011204222.1|545480_546944_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004198119.1|547152_547431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198120.1|547443_548289_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004198121.1|548437_549409_-	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004266709.1|549596_550385_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004191998.1|550589_552053_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198124.1|552196_553396_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004199587.1|553683_555774_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004266710.1|555997_556549_+	membrane protein	NA	NA	NA	NA	NA
WP_004198127.1|556608_556938_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004198128.1|556997_557840_+	iron transporter OFeT family	NA	NA	NA	NA	NA
WP_004198129.1|557836_559237_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_004199588.1|559296_559707_+	heme-binding protein	NA	NA	NA	NA	NA
WP_038802333.1|559852_560972_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP009740	Burkholderia mallei strain Turkey8 chromosome 2, complete sequence	2120572	1633738	1708436	2120572	plate,tRNA,transposase	Leptospira_phage(23.08%)	59	NA	NA
WP_004203245.1|1633738_1634551_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004203246.1|1634550_1637178_-	membrane protein	NA	NA	NA	NA	NA
WP_004188178.1|1637313_1638435_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004525190.1|1638433_1638595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187693.1|1638776_1639844_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_004187882.1|1639892_1640543_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_004187125.1|1640620_1640770_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004187091.1|1640766_1642176_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004187288.1|1642567_1643863_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004187652.1|1643855_1644803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187998.1|1645522_1646050_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187349.1|1646210_1648934_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_004188364.1|1649185_1650430_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_096325434.1|1651641_1652761_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200651.1|1652772_1652916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187842.1|1652991_1653966_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004188362.1|1654062_1655364_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004188825.1|1655416_1655689_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_004187935.1|1655690_1656392_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004188402.1|1656413_1658189_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004187439.1|1658193_1658562_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004536542.1|1658566_1658983_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004196014.1|1659182_1659992_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187735.1|1660281_1661265_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_004188261.1|1661462_1662482_+	lyase	NA	NA	NA	NA	NA
WP_004188791.1|1662638_1663148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188028.1|1663224_1664676_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_004187807.1|1664723_1667441_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_004187717.1|1667687_1670405_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	25.2	2.0e-13
WP_004188259.1|1670505_1672170_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004204352.1|1672193_1672466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1672761_1673881_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196172.1|1675313_1676573_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.6	2.1e-05
WP_004190781.1|1676673_1677720_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190757.1|1677794_1678895_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.0	6.3e-22
WP_004200631.1|1679003_1680533_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.9	2.2e-12
WP_004196164.1|1681627_1682653_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190808.1|1683003_1685241_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004190837.1|1685328_1685724_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190603.1|1685884_1686421_-	cytochrome b	NA	NA	NA	NA	NA
WP_004190805.1|1686689_1687325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204344.1|1687455_1688220_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	38.7	4.7e-08
WP_004190911.1|1688498_1688810_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204342.1|1689254_1689587_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190614.1|1689785_1691201_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_004190588.1|1691189_1691333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190461.1|1691656_1692334_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190245.1|1692296_1693235_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190776.1|1693231_1694656_-	cytosine permease	NA	NA	NA	NA	NA
WP_011204340.1|1695172_1696153_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045589205.1|1696165_1696927_+	acyltransferase family protein	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	34.4	1.2e-16
WP_096325451.1|1696826_1697946_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	1.6e-49
WP_004196154.1|1697974_1699033_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004196151.1|1698962_1699616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|1699690_1701895_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004203276.1|1701891_1704546_-	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	30.9	2.7e-79
WP_004190820.1|1704524_1706003_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190509.1|1705999_1707871_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|1707875_1708436_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP009740	Burkholderia mallei strain Turkey8 chromosome 2, complete sequence	2120572	1784086	1843456	2120572	integrase,portal,tRNA,transposase	Leptospira_phage(22.22%)	53	1775802:1775861	1838142:1839092
1775802:1775861	attL	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCC	NA	NA	NA	NA
WP_011204325.1|1784086_1785127_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.7e-93
WP_004195713.1|1785517_1786327_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004266656.1|1786477_1788382_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004190235.1|1788465_1789350_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|1789346_1789640_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|1789909_1791016_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004191998.1|1791166_1792630_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190656.1|1792754_1793624_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|1793682_1794558_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004204467.1|1794710_1794932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038763983.1|1795271_1797065_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|1797426_1798809_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190446.1|1799127_1801908_-	DNA polymerase I	NA	A0A1J0GVZ7	Streptomyces_phage	31.0	5.6e-51
WP_004530319.1|1801909_1802659_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190924.1|1802655_1802925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190916.1|1803076_1803361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190352.1|1804020_1804512_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004203322.1|1804947_1805211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1807115_1808235_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009950031.1|1808792_1809080_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
WP_004195697.1|1809076_1809763_+|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_004190957.1|1809846_1811373_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004190726.1|1811528_1811927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190439.1|1812020_1813016_+	homoserine kinase	NA	NA	NA	NA	NA
WP_004190835.1|1813006_1813819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038730270.1|1813950_1814202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190487.1|1814321_1814774_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011832128.1|1814911_1815331_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004190391.1|1815443_1815602_-	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_004190691.1|1815698_1816847_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004204469.1|1817097_1817796_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004195689.1|1818236_1819037_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190258.1|1819049_1819724_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004190506.1|1819725_1820427_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
WP_004190826.1|1820970_1821819_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_004195687.1|1821853_1823776_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_004190990.1|1823973_1824357_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_004190343.1|1824454_1825330_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190540.1|1825396_1826317_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004190659.1|1826409_1827189_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004190954.1|1827274_1828615_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004190469.1|1828611_1829241_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004190582.1|1829399_1831043_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_004190434.1|1832327_1832783_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004190743.1|1832847_1834086_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_004195676.1|1834338_1834749_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004190802.1|1834990_1835584_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004533441.1|1835679_1836534_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195671.1|1836764_1837091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190721.1|1837273_1838161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1838188_1839309_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
1838142:1839092	attR	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCA	NA	NA	NA	NA
WP_004190833.1|1839374_1840454_-	putative membrane protein	NA	NA	NA	NA	NA
WP_004190269.1|1842451_1843456_-|transposase	transposase	transposase	NA	NA	NA	NA
