The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014597	Prevotella intermedia strain OMA14 chromosome I	2280262	1671133	1729752	2280262	transposase,integrase	Bacillus_phage(50.0%)	48	1670773:1670832	1730054:1730414
1670773:1670832	attL	GTGTAACTAATCACTGAAAATGAAGAGATATCGAAGTTGATGTAAACTAACTGATAATGA	NA	NA	NA	NA
WP_096405349.1|1671133_1672363_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.1	3.6e-26
WP_096405348.1|1672375_1673620_+|integrase	site-specific integrase	integrase	A0A218M9P0	Mycobacterium_phage	25.0	3.6e-05
WP_096405347.1|1673616_1674021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096405346.1|1674085_1675393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007410958.1|1675394_1676174_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_096405345.1|1676203_1678582_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_096405344.1|1678907_1680635_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.6e-40
WP_096405343.1|1680660_1682415_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	2.7e-27
WP_096405342.1|1682447_1683062_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172419412.1|1683977_1684133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148664602.1|1684811_1685102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096405341.1|1685650_1686619_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_096405340.1|1686623_1687085_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_096405339.1|1687447_1687879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096405338.1|1687862_1688942_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_096405849.1|1689337_1689523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096405852.1|1690831_1692049_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096405855.1|1692175_1693108_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_096405863.1|1694279_1695005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096405866.1|1695078_1695540_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_112199952.1|1695536_1696439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096405871.1|1696419_1698219_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_044047448.1|1698438_1698837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096405876.1|1699407_1700037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096405879.1|1700119_1700944_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096405882.1|1701155_1701680_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_096405885.1|1701831_1702488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096405888.1|1702525_1703293_-	Omp28 family outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_096405891.1|1703305_1704979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024998745.1|1704988_1705477_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_148664608.1|1705581_1707465_-	Omp28-related outer membrane protein	NA	NA	NA	NA	NA
WP_096405897.1|1707585_1709949_-	C10 family peptidase	NA	NA	NA	NA	NA
WP_096405903.1|1710194_1711133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096405338.1|1711943_1713023_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_096405339.1|1713006_1713438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096405340.1|1713800_1714262_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_096405341.1|1714266_1715235_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_148664602.1|1715783_1716074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172419412.1|1716752_1716908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096405342.1|1717823_1718438_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096405343.1|1718470_1720225_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	2.7e-27
WP_096405344.1|1720250_1721978_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.6e-40
WP_096405345.1|1722303_1724682_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_007410958.1|1724711_1725491_+	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_096405346.1|1725492_1726800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096405347.1|1726864_1727269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096405348.1|1727265_1728510_-|integrase	site-specific integrase	integrase	A0A218M9P0	Mycobacterium_phage	25.0	3.6e-05
WP_096405349.1|1728522_1729752_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.1	3.6e-26
1730054:1730414	attR	TCATTATCAGTTAGTTTACATCAACTTCGATATCTCTTCATTTTCAGTGATTAGTTACACGGTAAAAGCGGCTGTTTTGCATTGCAAAACAGCCGCTTTCGCAATGTCAAACCGAAATTGCTATTTTTTATCAGAATTATCTTTACAAAATTGAAGAGCTTTTTAAGCATCTCCCTTCAATAATAAAAGGAAAAGCAGTTCTGCATAAAATCTCTGCCAAACTCGTTTAACGGCAGTGCAAGTAAAAAACAAATGCACCGATGAAGCTATTTACATGTTTCATCGGTGCATTGCGTTTTAATCGATTAAGGAATTATAAATACATCTTTTACAGTACAATGCCATATCCTATTGTTAAGAC	NA	NA	NA	NA
>prophage 1
NZ_AP014598	Prevotella intermedia strain OMA14 chromosome II	867855	228346	312595	867855	protease,tRNA,integrase	unidentified_phage(42.86%)	56	309020:309035	325637:325652
WP_096408258.1|228346_229468_-|integrase	site-specific integrase	integrase	B8R670	Lactobacillus_phage	29.2	2.4e-08
WP_096408263.1|229596_230547_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096408267.1|230896_232630_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096408276.1|233371_236470_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096408280.1|237277_238192_+	phosphate butyryltransferase	NA	NA	NA	NA	NA
WP_096408285.1|238198_239263_+	butyrate kinase	NA	NA	NA	NA	NA
WP_096408294.1|239657_240950_-	peptidase M64	NA	NA	NA	NA	NA
WP_028905328.1|241084_242068_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096408299.1|242072_243263_+	DUF4421 domain-containing protein	NA	NA	NA	NA	NA
WP_096408304.1|243259_244207_+	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_014708379.1|244359_244677_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014708378.1|244694_244985_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_096408318.1|245471_245864_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_096408323.1|245882_246500_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_096408327.1|246673_247018_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_096408332.1|247023_247875_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_096408337.1|248042_248855_+	glycogen/starch synthase	NA	NA	NA	NA	NA
WP_096408341.1|248851_250309_+	DUF4270 domain-containing protein	NA	NA	NA	NA	NA
WP_025000786.1|250298_250430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096408347.1|250558_253084_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	38.8	6.1e-121
WP_096408352.1|253903_256921_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096408357.1|257322_259428_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	32.2	2.3e-73
WP_096408362.1|260378_263078_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	20.6	1.7e-12
WP_148664623.1|264873_266445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096408377.1|266696_268316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096408381.1|268561_270187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096408386.1|270208_270409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148664624.1|270733_271015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096409419.1|271314_272478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096408396.1|273228_275295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096408401.1|275503_276802_+	TIGR00341 family protein	NA	NA	NA	NA	NA
WP_172419458.1|277361_277529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096409422.1|277584_282030_+	adhesin	NA	NA	NA	NA	NA
WP_096408411.1|282164_284705_+	C10 family peptidase	NA	NA	NA	NA	NA
WP_096408416.1|285069_286080_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_014708315.1|286048_286669_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_096408421.1|286928_290207_-	DUF2723 domain-containing protein	NA	NA	NA	NA	NA
WP_096408431.1|290846_292076_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.0	2.5e-27
WP_096408435.1|292104_293382_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_009347062.1|293844_294180_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009347063.1|294186_294561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096408440.1|294564_296625_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_009347065.1|296612_296921_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009347066.1|297017_297728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096408445.1|297724_298786_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_096405013.1|301030_301690_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036883557.1|301954_304345_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006948328.1|306600_307080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006948330.1|307074_307518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006948332.1|307728_308355_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_006948333.1|308357_308666_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006948337.1|308689_308956_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
309020:309035	attL	GCCGTACTTCTCGGGT	NA	NA	NA	NA
WP_006948338.1|309273_309429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006948339.1|309512_309992_-	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_024990780.1|310045_311329_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	27.9	1.4e-17
WP_006948341.1|311341_312595_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	29.2	3.6e-29
325637:325652	attR	ACCCGAGAAGTACGGC	NA	NA	NA	NA
>prophage 2
NZ_AP014598	Prevotella intermedia strain OMA14 chromosome II	867855	572144	633894	867855	protease,integrase	unidentified_phage(50.0%)	49	575928:575947	625916:625935
WP_006948341.1|572144_573398_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	29.2	3.6e-29
WP_024990780.1|573410_574694_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	27.9	1.4e-17
WP_006948339.1|574747_575227_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_006948338.1|575310_575466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006948337.1|575783_576050_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
575928:575947	attL	GGTATCAGCAAGCGTACCCT	NA	NA	NA	NA
WP_006948333.1|576073_576382_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006948332.1|576384_577011_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_006948330.1|577221_577665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006948328.1|577659_578139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036883557.1|580394_582785_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_096405013.1|583049_583709_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096408445.1|585953_587015_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_009347066.1|587011_587722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009347065.1|587818_588127_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096408440.1|588114_590175_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_009347063.1|590178_590553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009347062.1|590559_590895_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096409008.1|591557_593264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096409010.1|595245_597231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004352490.1|597487_597691_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096409013.1|598048_598357_+	DUF3853 family protein	NA	NA	NA	NA	NA
WP_096409016.1|598353_599406_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_096409018.1|599588_600479_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_096409021.1|600581_600929_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_096409024.1|600925_601852_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_096409027.1|601873_602533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028896451.1|602687_603971_-	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	46.1	7.3e-62
WP_096409476.1|603983_605273_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_096409030.1|605842_607075_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	42.8	6.2e-34
WP_096409033.1|607100_607568_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_096409036.1|607706_608054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096409039.1|609136_609970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096409042.1|610503_611010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096409047.1|611477_611969_-	lysozyme	NA	A0A2I7S753	Vibrio_phage	33.3	7.0e-05
WP_096409050.1|611980_612439_-	DUF3872 domain-containing protein	NA	NA	NA	NA	NA
WP_096409053.1|612451_613042_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_096409056.1|613788_615006_+	hypothetical protein	NA	I3PUW5	Vibrio_phage	30.0	3.7e-31
WP_039422572.1|623266_624502_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.1	4.6e-29
WP_096404883.1|624516_624879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096404884.1|624928_625231_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096404885.1|625268_625547_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004362427.1|625768_626122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
625916:625935	attR	GGTATCAGCAAGCGTACCCT	NA	NA	NA	NA
WP_004332869.1|626105_626426_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096409062.1|628463_628943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096409064.1|629647_630106_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_096409067.1|630112_630763_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_096409070.1|630988_631348_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096409073.1|631769_633422_-	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	41.1	2.5e-46
WP_096409075.1|633657_633894_-|protease	protease inhibitor I9 family protein	protease	NA	NA	NA	NA
