The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017901	Mycobacterium tuberculosis strain NCGM946K2	4380602	2927118	2962485	4380602	integrase,tRNA,head,capsid,protease,transposase,terminase	Tupanvirus(11.11%)	39	2955920:2955947	2966902:2966929
WP_003413486.1|2927118_2929197_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2929305_2929533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049950823.1|2929529_2930915_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2931259_2931760_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003906873.1|2931776_2932217_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2932363_2933041_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2933025_2933379_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2933391_2933817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2933813_2934488_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2934565_2935387_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2935522_2936416_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2936418_2937237_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2937251_2938433_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2938491_2938923_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2939436_2940678_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2940987_2941350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2941696_2942821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2942822_2943362_+	archease	NA	NA	NA	NA	NA
WP_003413616.1|2943501_2944800_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2944838_2945120_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2945264_2945750_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2945776_2946031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899405.1|2948400_2948643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2948643_2949321_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2949516_2950173_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2950335_2950782_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2950956_2951289_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2951408_2951768_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2951869_2952328_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2952463_2952844_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2952840_2954337_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2954571_2954763_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2955920:2955947	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2956053_2956485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2956481_2957480_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2957493_2957958_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2958177_2959438_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2959725_2961165_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2961172_2961706_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2961858_2962485_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2966902:2966929	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 2
NZ_AP017901	Mycobacterium tuberculosis strain NCGM946K2	4380602	3696102	3713007	4380602	transposase,protease	Burkholderia_virus(60.0%)	14	NA	NA
WP_087902221.1|3696102_3697364_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003913037.1|3697496_3698561_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_087902221.1|3699304_3700565_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_031746334.1|3700608_3701709_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003913449.1|3701803_3702241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|3702427_3703688_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3703973_3704135_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3704156_3705686_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3705618_3706557_-	sigma-70 family RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_003902446.1|3706565_3707933_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3708001_3709219_+	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3709314_3710823_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3710819_3711971_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3712161_3713007_-|protease	PDZ-interacting protease regulator Ppr1	protease	NA	NA	NA	NA
