The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	85500	140848	8121733	tRNA,transposase,protease	Mycobacterium_phage(28.57%)	52	NA	NA
WP_096490342.1|85500_86586_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091558.1|86635_88105_-	LCP family protein	NA	NA	NA	NA	NA
WP_096490769.1|88155_88977_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096490770.1|89247_89940_-	DUF2470 domain-containing protein	NA	NA	NA	NA	NA
WP_081986465.1|90105_90549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091552.1|90631_91549_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_033091551.1|91545_92208_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_045440376.1|92211_93030_-	ESX secretion-associated protein EspG	NA	NA	NA	NA	NA
WP_052087080.1|93026_93467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155240167.1|93471_93624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986172.1|94998_95583_-	PPE domain-containing protein	NA	NA	NA	NA	NA
WP_033089872.1|95599_95911_-	PE domain-containing protein	NA	NA	NA	NA	NA
WP_033089873.1|95991_96345_-	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_045438212.1|96365_97442_-	septum formation family protein	NA	NA	NA	NA	NA
WP_036546360.1|97703_99293_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9M4	Catovirus	30.7	8.5e-52
WP_033089875.1|99445_100705_+|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	32.7	3.9e-60
WP_052086813.1|100849_102649_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_045438227.1|102776_104057_+	MFS transporter	NA	NA	NA	NA	NA
WP_033089876.1|104224_104416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089877.1|104446_105388_+	DMT family transporter	NA	NA	NA	NA	NA
WP_033089878.1|105451_106471_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_033089879.1|106575_106929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089891.1|106999_108544_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_052086808.1|108589_109441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089880.1|109540_110290_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_143161495.1|110968_111868_+	helix-turn-helix domain-containing protein	NA	A0A1J0MCL6	Streptomyces_phage	33.4	1.1e-29
WP_045438214.1|111874_112099_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_052086810.1|112169_112814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089882.1|112822_114493_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_033089883.1|114513_116181_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_033089884.1|116229_117894_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_071343426.1|117905_119789_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-21
WP_033089885.1|119785_120712_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033089897.1|120711_121743_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033089886.1|121978_122818_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_052086812.1|122822_125153_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_071343319.1|125386_126472_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096490771.1|126504_128163_+	SpoIID/LytB domain-containing protein	NA	NA	NA	NA	NA
WP_158543915.1|128385_128640_-	helix-turn-helix transcriptional regulator	NA	A0A076G7U2	Mycobacterium_phage	52.2	1.8e-09
WP_143161496.1|128780_129026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145961771.1|129109_129778_+	hypothetical protein	NA	G9FH77	Rhodococcus_phage	43.7	1.8e-32
WP_082062662.1|130053_130827_+	PE-PPE domain-containing protein	NA	NA	NA	NA	NA
WP_052087067.1|130974_131817_+	glycoside hydrolase family 25 protein	NA	S5VMY8	Mycobacterium_phage	52.3	1.1e-61
WP_145961772.1|131813_132056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091475.1|132060_132447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145961773.1|132439_133027_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033091476.1|133004_133583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091477.1|133794_134409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490343.1|134820_135954_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_145961774.1|136162_138586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490344.1|138627_139713_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071811668.1|139762_140848_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	157576	168943	8121733		Macacine_betaherpesvirus(100.0%)	8	NA	NA
WP_033087599.1|157576_158620_+	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	37.0	2.3e-50
WP_045437339.1|158919_160008_+	esterase family protein	NA	A0A2I6AZH7	Macacine_betaherpesvirus	33.6	3.1e-45
WP_033087619.1|160277_161270_+	esterase family protein	NA	A0A2I6AZH7	Macacine_betaherpesvirus	36.5	2.0e-43
WP_071812443.1|161497_162481_+	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	40.5	1.4e-57
WP_033087602.1|162844_163885_+	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	38.1	4.6e-38
WP_081985873.1|164259_165414_+	hypothetical protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	40.2	9.5e-37
WP_081985867.1|165521_166562_+	esterase family protein	NA	A0A2I6AZH7	Macacine_betaherpesvirus	39.1	2.0e-46
WP_081985868.1|166828_168943_+	esterase	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	36.0	2.7e-37
>prophage 3
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	251608	280694	8121733	integrase,transposase,tRNA	Gordonia_phage(25.0%)	27	247303:247319	281383:281399
247303:247319	attL	CAGCGACATGGCCCCGA	NA	NA	NA	NA
WP_033087766.1|251608_252148_+|tRNA	tRNA adenosine deaminase-associated protein	tRNA	NA	NA	NA	NA
WP_033087783.1|252174_252612_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	33.8	3.3e-06
WP_081985890.1|252796_254032_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	39.6	2.6e-64
WP_033087767.1|254036_254516_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143161505.1|254704_254884_+	helix-turn-helix domain-containing protein	NA	A0A0E3XA16	Gordonia_phage	60.0	1.7e-09
WP_033087768.1|254880_255210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071812264.1|255206_256367_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_143161506.1|256578_256797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081985894.1|256805_257708_+	site-specific DNA-methyltransferase	NA	R4JEL7	Mycobacterium_phage	26.0	5.5e-16
WP_033087769.1|257704_258310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|258518_259604_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096490346.1|259946_261080_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158543917.1|262802_263609_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_071812267.1|263768_266102_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_033090960.1|266343_266931_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081986323.1|266971_267511_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090959.1|267614_269348_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	2.1e-43
WP_081986322.1|269344_271312_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	1.4e-56
WP_033090958.1|271316_272576_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	34.6	1.2e-61
WP_033090957.1|272605_273379_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	29.9	8.7e-18
WP_033090956.1|273440_274055_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_033090955.1|274145_274913_-	RDD family protein	NA	NA	NA	NA	NA
WP_033090954.1|274965_275910_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071343319.1|276734_277820_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096490344.1|278101_279187_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343454.1|279191_279401_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_096490343.1|279560_280694_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
281383:281399	attR	CAGCGACATGGCCCCGA	NA	NA	NA	NA
>prophage 5
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	631549	664898	8121733	transposase,tRNA	Actinoplanes_phage(50.0%)	36	NA	NA
WP_033087805.1|631549_632938_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_081985896.1|632934_634005_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_033087804.1|634001_635564_+	bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_033087803.1|635965_636229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086388.1|636305_636605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033087801.1|636825_637803_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_052086386.1|637834_638338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033087799.1|638617_639130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086370.1|639129_639387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161480.1|639505_639727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033087797.1|639844_640228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045437597.1|640591_641929_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_033087827.1|642894_643539_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081985895.1|643535_644192_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_081985898.1|644197_645022_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_033087794.1|645023_646643_+	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_033087793.1|646642_647635_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_033087792.1|648842_649043_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158543926.1|649042_649432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033087790.1|649464_650205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158543928.1|650204_650858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033087788.1|650746_651220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052486665.1|651625_652384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086368.1|652380_653190_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_036552925.1|653809_655138_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091743.1|656030_656660_+	hypothetical protein	NA	Q6J7Y8	Actinoplanes_phage	35.1	6.4e-27
WP_173850104.1|656674_657199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490368.1|657360_658446_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081986529.1|658487_658994_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	37.1	9.6e-26
WP_071343319.1|659097_660183_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091740.1|660171_660600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|660723_661809_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091741.1|662314_662641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045440613.1|662909_663293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343883.1|663648_663972_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096490370.1|663971_664898_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	949791	1065854	8121733	transposase,protease	Tupanvirus(41.67%)	86	NA	NA
WP_096490380.1|949791_950877_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096490381.1|951780_952914_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091726.1|953396_953714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161470.1|953722_954223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161469.1|954314_954647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161468.1|954937_955327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490382.1|955713_956961_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071343319.1|957688_958774_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145961779.1|958783_959407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|959528_960614_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091374.1|961196_961442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106852489.1|961434_962190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155240012.1|962191_962362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145961780.1|962520_964425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155240011.1|964421_964598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036545799.1|964594_965491_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033091370.1|965487_965937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091369.1|965969_966911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091368.1|967083_967566_+	single-stranded DNA-binding protein	NA	A0A1U9WS23	Gordonia_phage	61.2	3.7e-35
WP_071344671.1|967574_967850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091366.1|967908_968331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091365.1|968327_968615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161467.1|968611_968884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091363.1|968880_969147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091362.1|969143_969446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091361.1|969445_969655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091360.1|969624_970041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091359.1|970037_970370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091358.1|970402_970588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490383.1|970916_971843_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_143161520.1|971842_971992_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036553034.1|972128_973064_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096490385.1|974315_975449_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091771.1|976067_976700_+	hypothetical protein	NA	Q6J7Y8	Actinoplanes_phage	36.4	4.9e-27
WP_158543934.1|976962_977394_-	DUF5313 family protein	NA	NA	NA	NA	NA
WP_033087303.1|977478_978948_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033087302.1|979488_981126_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.3	2.8e-26
WP_052086270.1|981199_981580_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_052086269.1|981639_981996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081985826.1|982034_982379_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033087301.1|982530_984150_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.6	5.8e-24
WP_045436979.1|984151_984619_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_052086267.1|984859_986323_+	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	37.0	2.5e-18
WP_033087300.1|986377_986770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045436982.1|988068_988908_+	M23 family metallopeptidase	NA	A0A1I9S7S4	Rhodococcus_phage	46.0	4.4e-23
WP_033087311.1|988967_989948_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162836607.1|994668_999570_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.0	8.7e-55
WP_143161177.1|999730_1000462_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	27.7	1.9e-06
WP_052086264.1|1000462_1016197_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.4	1.8e-130
WP_052086263.1|1016215_1018606_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.8	9.1e-50
WP_152615018.1|1018821_1032825_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.8	2.7e-133
WP_033087307.1|1033085_1034078_+	esterase family protein	NA	NA	NA	NA	NA
WP_096490387.1|1034220_1035459_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_052086262.1|1035483_1036278_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_045436987.1|1036406_1037657_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033087298.1|1037676_1039158_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_045436990.1|1039491_1040520_+	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	3.8e-21
WP_033087297.1|1040516_1041326_+	antibiotic transporter	NA	NA	NA	NA	NA
WP_052086261.1|1041334_1042189_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033087295.1|1042292_1043321_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033087294.1|1043286_1044501_-	lycopene cyclase	NA	NA	NA	NA	NA
WP_096490388.1|1044592_1045261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344734.1|1045366_1046596_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071344661.1|1047029_1047644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091013.1|1047652_1048129_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_084978550.1|1048184_1048739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091015.1|1048991_1049423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003938093.1|1049929_1050235_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_033091016.1|1050249_1050915_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_033091017.1|1050911_1051583_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_033091018.1|1051579_1051885_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_033091019.1|1051917_1052748_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_019931198.1|1052762_1053044_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_033091020.1|1053040_1053442_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_033091021.1|1053442_1054249_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_033091022.1|1054252_1054669_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_033091023.1|1054668_1054908_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_033091024.1|1054904_1055201_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_033091025.1|1055473_1056010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167659851.1|1058216_1059611_+	adenylosuccinate lyase family protein	NA	NA	NA	NA	NA
WP_033091026.1|1059671_1060091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091027.1|1060226_1061201_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343319.1|1061250_1062336_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033089484.1|1063379_1064378_+	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_158543936.1|1064550_1064955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986118.1|1065089_1065854_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	1313316	1401664	8121733	transposase,tRNA	Mycobacterium_phage(18.18%)	87	NA	NA
WP_033086071.1|1313316_1313781_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_045439258.1|1313891_1314137_+	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_096490371.1|1314509_1315643_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_081986373.1|1316005_1317169_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_045439261.1|1317165_1318515_-	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	25.3	5.6e-12
WP_052486764.1|1318734_1319445_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091242.1|1319581_1321078_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	36.6	9.4e-53
WP_033091241.1|1321409_1322627_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_033091240.1|1323004_1324369_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_033091244.1|1324725_1325871_+	MFS transporter	NA	NA	NA	NA	NA
WP_033091239.1|1325911_1326202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091238.1|1326215_1326443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071811623.1|1326670_1327759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036553034.1|1327869_1328805_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158543941.1|1328804_1329128_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052087126.1|1329536_1329941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091764.1|1330101_1330611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|1330796_1331882_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091223.1|1331878_1333159_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033091222.1|1333177_1334056_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033091221.1|1334077_1334941_-	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_033091220.1|1334957_1335395_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_033091219.1|1335432_1336638_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_033091218.1|1336794_1337439_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155239974.1|1337498_1337666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091217.1|1337700_1338519_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045440003.1|1338733_1339588_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036550847.1|1339657_1340464_+	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	28.9	2.3e-13
WP_033091215.1|1340856_1341858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158543943.1|1342063_1343524_-	recombinase family protein	NA	A0A0B4ZYE2	Mycobacterium_phage	32.6	4.7e-57
WP_158543945.1|1343522_1343684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091213.1|1343680_1344184_+	ribonuclease	NA	NA	NA	NA	NA
WP_033091212.1|1344184_1344688_+	barstar family protein	NA	NA	NA	NA	NA
WP_096490401.1|1344767_1345853_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033090904.1|1345949_1347575_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_155239972.1|1347694_1348816_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_096490402.1|1348816_1349455_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090901.1|1349568_1350513_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_045439791.1|1350518_1351049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090907.1|1351217_1352243_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_081986315.1|1352281_1353307_+	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_033090899.1|1353313_1354603_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_033090898.1|1354676_1355351_-	ester cyclase	NA	NA	NA	NA	NA
WP_052086979.1|1355536_1357051_+	MFS transporter	NA	NA	NA	NA	NA
WP_045439795.1|1357040_1357658_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090897.1|1357654_1358545_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_033090896.1|1358828_1359299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090895.1|1359423_1360047_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090894.1|1360401_1361940_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096490403.1|1362408_1363542_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_036553000.1|1364465_1364762_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158543947.1|1364758_1365733_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.9	2.0e-19
WP_071343611.1|1365632_1365956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036553034.1|1365955_1366891_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_033089899.1|1366962_1367403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089900.1|1367790_1368564_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_033089901.1|1368563_1370333_-	succinate dehydrogenase flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	25.4	3.9e-05
WP_033089902.1|1370349_1370781_-	succinate dehydrogenase hydrophobic membrane anchor subunit	NA	NA	NA	NA	NA
WP_071811631.1|1370869_1371262_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_033089904.1|1371562_1371964_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_033089921.1|1372060_1373347_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.9	2.3e-79
WP_158543949.1|1373380_1373698_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033089906.1|1373839_1374931_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_033089907.1|1374991_1376239_-	primosomal protein	NA	NA	NA	NA	NA
WP_033089908.1|1376265_1376595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089909.1|1376645_1376987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089910.1|1377057_1378272_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	45.5	8.3e-15
WP_033089922.1|1378426_1378750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089911.1|1379520_1381071_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.1	5.7e-61
WP_045438801.1|1381080_1381884_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_033089912.1|1382032_1382737_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_033089924.1|1383059_1384247_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_173850114.1|1384327_1385500_+	amidohydrolase	NA	NA	NA	NA	NA
WP_033089914.1|1385579_1385993_-	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033089925.1|1386077_1386557_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_033089915.1|1386861_1388265_+	NAD(P)H-quinone dehydrogenase	NA	NA	NA	NA	NA
WP_033089926.1|1388574_1389669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089916.1|1389769_1391116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089917.1|1391349_1392540_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_033089918.1|1392559_1394101_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_033089919.1|1395481_1395688_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_033089920.1|1395677_1396574_-	helix-turn-helix domain-containing protein	NA	A0A1J0MCL6	Streptomyces_phage	29.1	1.7e-17
WP_096490405.1|1396955_1398452_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_033091734.1|1398448_1399246_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.4	1.0e-34
WP_143161193.1|1399582_1399789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091777.1|1399793_1400381_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_096490407.1|1400578_1401664_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	1930551	2062977	8121733	integrase,transposase	Mycobacterium_phage(21.05%)	109	1948622:1948640	1995859:1995877
WP_096490428.1|1930551_1931880_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033090545.1|1931959_1933327_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_033090544.1|1935268_1935892_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052086923.1|1935952_1936834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090543.1|1936984_1937860_+	DMT family transporter	NA	NA	NA	NA	NA
WP_081986267.1|1937861_1938941_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_052086924.1|1939238_1939898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090542.1|1940019_1942428_+	MFS transporter	NA	NA	NA	NA	NA
WP_045439340.1|1942539_1943436_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_033090541.1|1943543_1945514_-	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	26.4	2.1e-36
WP_033090540.1|1945696_1946107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090539.1|1946347_1947124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490806.1|1947183_1948536_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.0	6.2e-19
1948622:1948640	attL	ATGCCCGCCGCGAACAGCA	NA	NA	NA	NA
WP_045439342.1|1948992_1950102_+	galactokinase	NA	NA	NA	NA	NA
WP_033090537.1|1950143_1950449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036549088.1|1950445_1950748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036549091.1|1950782_1951526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172416798.1|1951667_1953026_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_096490429.1|1954060_1955194_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091332.1|1955403_1957065_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	23.8	6.8e-28
WP_033091338.1|1957280_1958936_-	acyl-CoA synthetase	NA	Q75ZG1	Hepacivirus	27.5	1.8e-33
WP_036551765.1|1959301_1960132_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033091339.1|1960331_1961024_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033091334.1|1961049_1961856_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_158543967.1|1961883_1962756_-	serine hydrolase	NA	NA	NA	NA	NA
WP_036551767.1|1963128_1963572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091336.1|1964507_1965176_-	YdcF family protein	NA	NA	NA	NA	NA
WP_033091337.1|1965187_1965952_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096490430.1|1966924_1968355_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.1	4.8e-54
WP_033090950.1|1968814_1970053_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033090949.1|1970079_1971462_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033090948.1|1971701_1971968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490431.1|1972187_1973588_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_033090946.1|1973610_1974396_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_096490807.1|1974959_1976081_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_033090943.1|1976084_1976945_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_158543969.1|1976934_1977111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090942.1|1977168_1977858_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.9	1.4e-27
WP_033090941.1|1977857_1978763_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_081986321.1|1978833_1981059_+	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	36.4	1.1e-78
WP_033090940.1|1981071_1981392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090951.1|1981953_1982619_+	slipin family protein	NA	NA	NA	NA	NA
WP_033090939.1|1982749_1983226_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.7	3.8e-32
WP_096490432.1|1984227_1985154_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071343883.1|1985153_1985477_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091801.1|1985619_1985853_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071812250.1|1986025_1987111_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_045440530.1|1987500_1988475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986501.1|1988827_1989376_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	38.0	5.4e-22
WP_052087111.1|1990218_1990449_+	hypothetical protein	NA	W8EKE7	Mycobacterium_phage	45.9	1.8e-08
WP_158543971.1|1990488_1990698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490343.1|1990709_1991843_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_081986278.1|1991950_1992547_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033090620.1|1994148_1994544_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_081986277.1|1994594_1996136_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	28.6	4.0e-30
1995859:1995877	attR	ATGCCCGCCGCGAACAGCA	NA	NA	NA	NA
WP_033090619.1|1996198_1996564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161222.1|1996578_1996773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090618.1|1996882_1998181_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_033090617.1|1998214_1998889_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090616.1|1999005_2000520_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	33.5	2.7e-55
WP_045439529.1|2000584_2001157_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033090626.1|2001295_2001895_+	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_045439517.1|2001891_2002836_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096490434.1|2002893_2004066_-	lipase	NA	NA	NA	NA	NA
WP_033090615.1|2004220_2004565_+	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_033090614.1|2004761_2006411_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_045439533.1|2006522_2007743_+	MFS transporter	NA	NA	NA	NA	NA
WP_052086933.1|2007790_2008528_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_096490435.1|2008546_2010709_-	DUF222 domain-containing protein	NA	NA	NA	NA	NA
WP_143161223.1|2011068_2011458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490436.1|2012780_2013866_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158543974.1|2014224_2015295_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096490438.1|2015245_2017000_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091197.1|2017593_2018724_+	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_158543976.1|2018804_2020178_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_143161224.1|2020713_2021469_+	methyltransferase	NA	NA	NA	NA	NA
WP_033091196.1|2021513_2021954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091195.1|2022149_2023385_+	hypothetical protein	NA	A0A140G6E9	Arthrobacter_phage	40.5	1.9e-75
WP_033091194.1|2023431_2023644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087017.1|2023780_2025550_+	ParB N-terminal domain-containing protein	NA	A0A2P1N496	Mycobacterium_phage	34.1	1.7e-56
WP_033091193.1|2025644_2026496_+	bifunctional DNA primase/polymerase	NA	A0A221SAP5	Ralstonia_phage	33.2	1.8e-16
WP_052087015.1|2027084_2027594_+	single-stranded DNA-binding protein	NA	A0A1U9WS23	Gordonia_phage	51.7	1.8e-27
WP_033091192.1|2027797_2028001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091191.1|2028106_2028427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986364.1|2028920_2030237_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_155241655.1|2030271_2034783_+|transposase	IS630 family transposase	transposase	V5UQN3	Mycobacterium_phage	28.2	7.0e-27
WP_045440474.1|2034874_2036074_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_096490343.1|2036395_2037529_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343319.1|2038654_2039740_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091600.1|2039999_2040398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490440.1|2040505_2041264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161226.1|2041844_2042699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091603.1|2042702_2044022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087093.1|2044018_2045914_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_071343319.1|2045910_2046996_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033090992.1|2047140_2047947_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_033090993.1|2048096_2048495_-	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	35.1	1.4e-08
WP_033090994.1|2048704_2049889_+	DNA cytosine methyltransferase	NA	I6NLI4	Burkholderia_phage	35.5	2.5e-48
WP_045439496.1|2049965_2050976_+	DUF4928 family protein	NA	NA	NA	NA	NA
WP_033090995.1|2051158_2051704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161227.1|2051966_2052266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158543978.1|2052252_2053068_-	Eco29kI family restriction endonuclease	NA	NA	NA	NA	NA
WP_147459110.1|2053352_2054621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158543980.1|2054665_2057308_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_106852461.1|2058122_2058332_+	HPr-rel-A system PqqD family peptide chaperone	NA	NA	NA	NA	NA
WP_143161228.1|2058349_2059507_+	radical SAM protein	NA	NA	NA	NA	NA
WP_033090999.1|2059503_2060901_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_158543982.1|2060840_2061890_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096490441.1|2061891_2062977_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	2066516	2119792	8121733	transposase,tRNA,protease	Bacillus_phage(40.0%)	46	NA	NA
WP_052087084.1|2066516_2067785_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	29.2	1.3e-39
WP_155239282.1|2068052_2068202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145961796.1|2068818_2069472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|2069766_2070852_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052087037.1|2070885_2071869_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033091340.1|2072448_2073243_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033091341.1|2073384_2073960_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091342.1|2074160_2075411_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_033091343.1|2075667_2076627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091344.1|2076742_2077705_+	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_033091345.1|2077708_2079010_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	2.7e-32
WP_033091346.1|2079041_2080796_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_145961797.1|2080826_2081555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490343.1|2081759_2082893_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343319.1|2083325_2084411_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052087062.1|2084460_2085453_-	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033091466.1|2085452_2086343_-	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033091467.1|2086431_2086623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091468.1|2086665_2088369_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_033091469.1|2090051_2090912_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155239284.1|2090928_2091285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045440275.1|2091367_2092576_-	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_096490442.1|2092833_2094162_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071344734.1|2094645_2095875_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071811695.1|2096082_2096919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045440230.1|2096915_2097356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091415.1|2097372_2098185_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033091416.1|2098291_2099470_+	cytochrome P450	NA	NA	NA	NA	NA
WP_052087049.1|2099456_2100164_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_045440227.1|2100246_2100969_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.9	1.6e-29
WP_173850105.1|2100882_2102310_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.7	2.8e-14
WP_081986425.1|2102212_2103085_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_096490443.1|2102978_2104259_-	non-ribosomal peptide synthetase	NA	NA	NA	NA	NA
WP_096490343.1|2104948_2106082_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_063897701.1|2107279_2107942_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_033087156.1|2107964_2108621_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_052086233.1|2108758_2109505_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_052086232.1|2109508_2110063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033087155.1|2110059_2110746_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_106852475.1|2111263_2112604_+	magnesium transporter	NA	NA	NA	NA	NA
WP_033087154.1|2112848_2113811_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	85.9	2.1e-154
WP_063897700.1|2114016_2115117_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071811696.1|2115320_2117057_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_045440214.1|2117146_2118421_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_145961798.1|2118563_2119034_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_081985804.1|2119159_2119792_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 11
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	2417051	2503689	8121733	tRNA,transposase,protease	Anoxybacillus_phage(14.29%)	59	NA	NA
WP_033086141.1|2417051_2418254_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_081985687.1|2418381_2420052_+	TerD family protein	NA	A0A2P1JTY0	Anoxybacillus_phage	38.6	5.1e-07
WP_096490464.1|2420083_2421412_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096490465.1|2421590_2422289_-	endonuclease V	NA	NA	NA	NA	NA
WP_033090458.1|2422472_2423630_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_081986253.1|2423787_2424774_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033090459.1|2424861_2426661_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_033090460.1|2426698_2426899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090461.1|2427105_2427606_-	FABP family protein	NA	NA	NA	NA	NA
WP_033090462.1|2427688_2428510_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_045439245.1|2428509_2429358_-	antibiotic transporter	NA	NA	NA	NA	NA
WP_045439249.1|2429354_2430407_-	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.6	3.3e-20
WP_096490466.1|2430493_2443825_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	20.1	3.5e-74
WP_045439247.1|2443862_2444282_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_033090463.1|2444446_2445325_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036552925.1|2445565_2446894_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145961806.1|2446924_2447479_-	XRE family transcriptional regulator	NA	A0A1J0MBX1	Streptomyces_phage	28.2	6.0e-05
WP_071811668.1|2447550_2448636_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033088058.1|2449374_2450421_+	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_033088030.1|2450473_2451607_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_033088031.1|2451751_2452489_+	Zn-ribbon protein	NA	NA	NA	NA	NA
WP_033088059.1|2452824_2454042_+	bifunctional RNase H/acid phosphatase	NA	A0A2L0V0T1	Agrobacterium_phage	35.0	1.2e-05
WP_033088032.1|2454054_2454942_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_081985927.1|2455751_2456783_+	peptidase	NA	NA	NA	NA	NA
WP_033088033.1|2457238_2457571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033088034.1|2457586_2459059_+	RNB domain-containing ribonuclease	NA	NA	NA	NA	NA
WP_033088037.1|2462576_2463473_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_033088038.1|2463473_2464430_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_052086454.1|2464429_2464882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088062.1|2465114_2465972_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_081985932.1|2466181_2466634_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096490468.1|2466671_2467850_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_081985929.1|2468051_2469587_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033088040.1|2469792_2471133_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_036546584.1|2471390_2474429_+	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_052086456.1|2475039_2475705_-	sigma-70 region 4 domain-containing protein	NA	NA	NA	NA	NA
WP_158543991.1|2475917_2476298_-	ester cyclase	NA	NA	NA	NA	NA
WP_158543993.1|2476595_2477222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343900.1|2477236_2478520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088044.1|2478668_2480114_+	metallopeptidase	NA	NA	NA	NA	NA
WP_033088045.1|2480118_2480958_-	alpha/beta hydrolase	NA	A0A220T682	Eptesipox_virus	31.6	3.3e-31
WP_081985933.1|2481025_2482129_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_096490469.1|2482550_2484209_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_063897709.1|2484375_2487816_+	protein kinase	NA	S4VR00	Pandoravirus	30.0	4.3e-16
WP_096490470.1|2487838_2488576_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036546569.1|2488556_2489468_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_173850108.1|2489768_2491046_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_033088049.1|2491061_2492054_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_033088050.1|2492064_2493204_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_033088051.1|2493215_2494673_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_033088052.1|2494851_2496054_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096490471.1|2496119_2496554_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_155239319.1|2496869_2497037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121556100.1|2497187_2497655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033088055.1|2497628_2498411_-	YwiC-like family protein	NA	NA	NA	NA	NA
WP_081985934.1|2498536_2499331_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_071343319.1|2499462_2500548_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091758.1|2500837_2502274_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_096490343.1|2502555_2503689_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	2864325	2913467	8121733	transposase	Saccharomonospora_phage(25.0%)	54	NA	NA
WP_071811973.1|2864325_2865411_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096490492.1|2865399_2865993_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096490493.1|2866219_2867305_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033089975.1|2867878_2868193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089976.1|2868180_2868447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089977.1|2868863_2869307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161374.1|2869336_2869744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145961810.1|2870530_2871070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089980.1|2871454_2872573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086826.1|2872569_2874081_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_081986181.1|2874077_2874965_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_143161373.1|2874957_2875239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089981.1|2875251_2875773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986183.1|2875728_2875932_+	DUF397 domain-containing protein	NA	I4AZQ0	Saccharomonospora_phage	69.7	4.0e-07
WP_045438924.1|2876378_2877386_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_033089984.1|2877440_2877728_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_033089985.1|2877851_2878148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089986.1|2878255_2879032_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_052086828.1|2879045_2879441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089987.1|2879540_2880878_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_033090005.1|2880907_2882029_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	29.6	1.6e-17
WP_033089988.1|2882025_2882658_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_033089989.1|2882654_2883293_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_143161372.1|2883349_2883664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161371.1|2883656_2883872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089991.1|2883975_2884431_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052086829.1|2884437_2885067_-	LppP/LprE family lipoprotein	NA	NA	NA	NA	NA
WP_033089992.1|2885231_2885963_+	bifunctional 1-(5-phosphoribosyl)-5-((5- phosphoribosylamino)methylideneamino)imidazole-4- carboxamide isomerase/phosphoribosylanthranilate isomerase PriA	NA	NA	NA	NA	NA
WP_033089993.1|2885968_2886784_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_033089994.1|2886780_2887554_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_033089995.1|2887550_2887910_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_045438919.1|2887906_2888404_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033089996.1|2889243_2889699_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_033089997.1|2889887_2890193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089998.1|2890391_2891957_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_045438927.1|2892313_2893075_+	TIGR02234 family membrane protein	NA	NA	NA	NA	NA
WP_033089999.1|2893224_2894043_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.2	4.2e-31
WP_033090000.1|2894051_2895338_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_033090001.1|2895334_2896135_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_036552925.1|2896405_2897734_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071811975.1|2897940_2899101_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_033091516.1|2899124_2899640_+	TM2 domain-containing protein	NA	Q854V8	Mycobacterium_virus	44.8	2.9e-09
WP_033091515.1|2899829_2900585_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033091514.1|2900602_2901271_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_071811974.1|2901361_2902786_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_045440316.1|2902799_2903711_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_033091512.1|2903766_2904168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986449.1|2904324_2905014_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_045440313.1|2905157_2905730_-	DUF4188 domain-containing protein	NA	NA	NA	NA	NA
WP_096490371.1|2906007_2907141_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158544005.1|2907227_2907509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155239383.1|2909311_2909455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071811973.1|2910360_2911446_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036552925.1|2912138_2913467_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	3677222	3723435	8121733	transposase	Tupanvirus(16.67%)	44	NA	NA
WP_096490343.1|3677222_3678356_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091453.1|3678541_3679492_+	MCE family protein	NA	NA	NA	NA	NA
WP_052087058.1|3679507_3680149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087059.1|3680178_3680811_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143161356.1|3680876_3681428_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091455.1|3681429_3682602_-	thiolase family protein	NA	NA	NA	NA	NA
WP_033091456.1|3682645_3683746_-	chorismate-binding protein	NA	NA	NA	NA	NA
WP_052087060.1|3683738_3684908_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_096490529.1|3684907_3686740_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_071343319.1|3687025_3688111_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052087076.1|3688275_3688914_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_033091528.1|3688972_3689173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091533.1|3689186_3690200_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033091529.1|3690183_3691041_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	32.7	2.4e-29
WP_033091530.1|3691340_3692171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986457.1|3692255_3693179_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_033091531.1|3693180_3694584_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_096490343.1|3695797_3696931_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091443.1|3697072_3699100_-	SDR family oxidoreductase	NA	A0A2C9DTC1	Eastern_grey_kangaroopox_virus	31.6	4.3e-08
WP_033091444.1|3699623_3700142_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_033091451.1|3700183_3700684_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_033091445.1|3700691_3700934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490530.1|3701259_3702024_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033091446.1|3702020_3702245_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_033091447.1|3702299_3703160_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_033091448.1|3703171_3703906_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_081986431.1|3703943_3705005_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_045440255.1|3705206_3705458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|3705550_3706636_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091352.1|3706747_3707653_+	helix-turn-helix domain-containing protein	NA	A0A1J0MBX1	Streptomyces_phage	32.7	4.3e-08
WP_033091351.1|3707642_3707846_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_096490531.1|3707842_3710128_-	serine/threonine protein kinase	NA	M1HTZ5	Acanthocystis_turfacea_Chlorella_virus	30.7	9.1e-15
WP_052087038.1|3710497_3712135_+	serine/threonine protein kinase	NA	A0A2I2L395	Orpheovirus	28.1	2.5e-14
WP_045440148.1|3712315_3713671_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_033091350.1|3713667_3714498_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_033091354.1|3714636_3715263_-	MspA family porin	NA	NA	NA	NA	NA
WP_033091353.1|3715423_3716506_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_033091349.1|3716535_3717096_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	NA	NA	NA	NA
WP_096490403.1|3717249_3718383_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091693.1|3718446_3719475_-	SDR family oxidoreductase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	23.1	2.3e-05
WP_033091694.1|3719477_3720128_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_033091695.1|3720124_3720928_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_083414963.1|3720924_3722115_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_096490532.1|3722106_3723435_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	4175447	4217408	8121733	integrase,transposase	Morganella_phage(33.33%)	32	4176026:4176044	4219974:4219992
WP_096490418.1|4175447_4176581_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
4176026:4176044	attL	GTTCACCGCCGACGAAGCC	NA	NA	NA	NA
WP_096490561.1|4176653_4177439_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_033091380.1|4177435_4178641_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071811865.1|4178657_4179812_+	cytochrome P450	NA	NA	NA	NA	NA
WP_045440162.1|4179845_4181447_+	MFS transporter	NA	NA	NA	NA	NA
WP_081986407.1|4182548_4183013_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_096490562.1|4183693_4183903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091376.1|4183981_4184257_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_143161318.1|4184269_4186801_-	patatin-like protein	NA	NA	NA	NA	NA
WP_071343319.1|4186860_4187946_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_045439060.1|4188048_4189278_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033091820.1|4189905_4190100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091819.1|4191095_4191893_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_033091818.1|4191945_4193175_-	DNA polymerase IV	NA	A0A1W6JNT0	Morganella_phage	27.7	3.3e-19
WP_033091817.1|4193593_4193983_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_071811868.1|4193979_4194279_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_033091825.1|4194514_4196026_+	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_033091815.1|4196040_4196781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986533.1|4196672_4197977_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_033091814.1|4198087_4199317_+	serine hydrolase	NA	NA	NA	NA	NA
WP_033091813.1|4199337_4200078_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052087137.1|4203368_4205456_+	hypothetical protein	NA	A0A159B6I5	Gordonia_phage	37.1	2.3e-17
WP_033091811.1|4205517_4205853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121556151.1|4206188_4207067_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_071811870.1|4207605_4207821_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_033091810.1|4207981_4208401_+	transcription initiation protein	NA	NA	NA	NA	NA
WP_033091809.1|4208412_4209693_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_052087135.1|4212067_4212412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161320.1|4212648_4213500_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_033091806.1|4213713_4215024_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036553000.1|4216194_4216491_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343639.1|4216487_4217408_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
4219974:4219992	attR	GGCTTCGTCGGCGGTGAAC	NA	NA	NA	NA
>prophage 15
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	4248730	4288593	8121733	transposase	Bacillus_phage(20.0%)	39	NA	NA
WP_071343639.1|4248730_4249651_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_036553000.1|4249647_4249944_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091662.1|4250025_4250337_+	EthD family reductase	NA	NA	NA	NA	NA
WP_081986492.1|4250375_4250522_-	heme-binding protein	NA	NA	NA	NA	NA
WP_106852522.1|4250964_4251312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087105.1|4251941_4252799_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_145961820.1|4252825_4254163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071343883.1|4255275_4255599_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071811877.1|4255598_4256525_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071812356.1|4256517_4257984_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.3	4.9e-54
WP_045440755.1|4258102_4258420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|4258719_4259805_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033090147.1|4259844_4260393_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_143161322.1|4260575_4260914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090145.1|4260936_4261263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071811879.1|4261562_4262228_+	VIT family protein	NA	NA	NA	NA	NA
WP_045440425.1|4262438_4263485_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	28.6	3.0e-05
WP_071344143.1|4263681_4265523_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_158544049.1|4265600_4266857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090142.1|4266960_4267539_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.8	6.9e-36
WP_052086863.1|4267664_4269302_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_033090141.1|4269298_4270915_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_033090140.1|4270911_4272801_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_033090139.1|4272802_4273102_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_045439382.1|4273098_4273977_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_096490847.1|4273973_4275734_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_081986212.1|4275816_4278285_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_033090138.1|4278281_4279604_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_033090137.1|4279600_4280296_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_033090136.1|4280292_4281624_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_045439385.1|4281623_4282382_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_033090135.1|4282378_4282933_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_096490566.1|4283027_4283408_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_033090133.1|4283684_4284104_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
WP_052086862.1|4284321_4285416_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_033090132.1|4285798_4286227_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	25.2	1.1e-06
WP_033090131.1|4286236_4287067_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_033090130.1|4287210_4287414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490371.1|4287459_4288593_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	4506936	4548464	8121733	transposase	Thermobifida_phage(25.0%)	47	NA	NA
WP_052086249.1|4506936_4507677_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	40.7	2.5e-30
WP_033087232.1|4507746_4508457_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_033087231.1|4509173_4509722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490371.1|4509836_4510970_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158544054.1|4510981_4511503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986525.1|4511701_4511872_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071343319.1|4511860_4512946_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036553000.1|4513053_4513350_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343639.1|4513346_4514267_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_033086667.1|4514305_4514725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086715.1|4515416_4515908_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	33.8	3.6e-09
WP_045436772.1|4516121_4516538_-	VOC family protein	NA	NA	NA	NA	NA
WP_033086669.1|4516579_4517167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086164.1|4517360_4518101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033086670.1|4518142_4518994_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_033086671.1|4519062_4519854_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033086672.1|4519974_4520760_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.7	2.8e-16
WP_033086717.1|4520812_4521181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086165.1|4521158_4522025_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_033086719.1|4523094_4523652_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_033086674.1|4523766_4524126_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_033086675.1|4524243_4525452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081985759.1|4525468_4526989_-	DUF4173 domain-containing protein	NA	NA	NA	NA	NA
WP_033086721.1|4527452_4528439_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.8	1.8e-20
WP_033086676.1|4528549_4529236_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_052086167.1|4529355_4529907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081985753.1|4530020_4530614_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_033086677.1|4530639_4531839_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_033086678.1|4531914_4532250_+	YnfA family protein	NA	NA	NA	NA	NA
WP_052086176.1|4532354_4532972_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033086680.1|4533101_4534562_+	MFS transporter	NA	NA	NA	NA	NA
WP_045436777.1|4534558_4535248_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_033086681.1|4535342_4535693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033086682.1|4535882_4536872_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_033086683.1|4536897_4537533_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033086684.1|4537638_4538451_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033086685.1|4538453_4539287_+	TIGR03619 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_071811904.1|4539300_4539387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086168.1|4539389_4539632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063897699.1|4540513_4541983_+	serine hydrolase	NA	A0A2P1JQM9	Mycobacterium_phage	30.0	2.9e-14
WP_033086688.1|4542201_4542732_-	VOC family protein	NA	NA	NA	NA	NA
WP_033086689.1|4542833_4543193_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045436795.1|4543247_4544084_-	EamA family transporter	NA	NA	NA	NA	NA
WP_033086690.1|4544196_4544523_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052086170.1|4544706_4545393_+	M23 family metallopeptidase	NA	O03937	Lactobacillus_phage	47.5	1.4e-24
WP_033086730.1|4546627_4546954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158544056.1|4547162_4548464_-|transposase	transposase	transposase	A0A0R8V9X2	Thermobifida_phage	30.4	5.5e-33
>prophage 17
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	5038610	5092175	8121733	transposase	Bacteriophage(50.0%)	53	NA	NA
WP_071343319.1|5038610_5039696_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_143837569.1|5040051_5042589_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_033090739.1|5042732_5044067_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_033090738.1|5044154_5045360_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_033090732.1|5045363_5046227_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033090731.1|5046327_5046894_+	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_033090730.1|5046906_5048634_-	allophanate hydrolase	NA	NA	NA	NA	NA
WP_033090729.1|5048634_5052243_-	urea carboxylase	NA	NA	NA	NA	NA
WP_172416858.1|5052246_5052948_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090728.1|5053040_5054045_-	esterase family protein	NA	NA	NA	NA	NA
WP_071811785.1|5054047_5054512_+	HD domain-containing protein	NA	A0A1L2BX36	Bacteriophage	40.8	9.8e-17
WP_033090727.1|5054580_5055159_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071812342.1|5055348_5056548_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_106852459.1|5056587_5057226_-	NPCBM/NEW2 domain-containing protein	NA	NA	NA	NA	NA
WP_052086955.1|5057437_5058163_-	NPCBM/NEW2 domain-containing protein	NA	NA	NA	NA	NA
WP_033090725.1|5058159_5058999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036552925.1|5059017_5060346_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096490614.1|5060435_5060732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158544070.1|5060786_5061353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091688.1|5061475_5062495_+	NPCBM/NEW2 domain-containing protein	NA	NA	NA	NA	NA
WP_052087109.1|5062507_5063137_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052087108.1|5063255_5064044_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071343319.1|5064158_5065244_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091760.1|5065501_5065960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091761.1|5066114_5066447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091762.1|5066571_5067030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|5067039_5068125_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158544071.1|5068105_5068528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490616.1|5069404_5069998_-	MspA family porin	NA	NA	NA	NA	NA
WP_162836621.1|5070570_5070735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091774.1|5070731_5071877_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_081986295.1|5071922_5073170_-	DoxX family protein	NA	NA	NA	NA	NA
WP_033090748.1|5073469_5074315_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_033090747.1|5074440_5074674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490866.1|5074674_5075169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986293.1|5075556_5076207_+	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_033090746.1|5077189_5078257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162836618.1|5078322_5078478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986292.1|5078673_5079267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045439663.1|5079387_5079816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490617.1|5079778_5080600_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033090745.1|5080586_5081477_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_045439661.1|5081478_5082558_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.7	2.2e-27
WP_096490618.1|5082557_5083772_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033090744.1|5084011_5085490_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_033090750.1|5085768_5086767_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_033090743.1|5086815_5087316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090742.1|5087365_5088583_+	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_106852470.1|5088599_5088827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158544073.1|5088941_5089568_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033090740.1|5089911_5090217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344014.1|5090727_5091030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490619.1|5091041_5092175_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	5135083	5174356	8121733	transposase,protease	Tsukamurella_phage(33.33%)	40	NA	NA
WP_036552925.1|5135083_5136412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052087125.1|5136824_5137862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091756.1|5137871_5138390_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|5138458_5139544_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096490623.1|5139593_5140679_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052086865.1|5140867_5142343_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_143161286.1|5142884_5143100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173850122.1|5143288_5144242_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_143161285.1|5145413_5145638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344000.1|5146919_5147693_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_052086866.1|5147902_5148766_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_033090159.1|5148944_5149802_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033090160.1|5149798_5150650_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_052086867.1|5150654_5151704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090161.1|5151700_5152702_+	MCE family protein	NA	NA	NA	NA	NA
WP_045439067.1|5152689_5153703_+	MCE family protein	NA	NA	NA	NA	NA
WP_033090162.1|5153702_5154809_+	MCE family protein	NA	NA	NA	NA	NA
WP_045439069.1|5154805_5155876_+	MCE family protein	NA	NA	NA	NA	NA
WP_033090164.1|5155872_5156829_+	MCE family protein	NA	NA	NA	NA	NA
WP_081986221.1|5156980_5157421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086868.1|5157560_5158064_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_045439080.1|5158170_5158449_+	DUF1918 domain-containing protein	NA	NA	NA	NA	NA
WP_158544080.1|5158524_5159382_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_143161284.1|5159477_5159987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490626.1|5160129_5161479_+	polysaccharide deacetylase family protein	NA	F1B2S6	Tsukamurella_phage	36.8	2.0e-14
WP_033090166.1|5161534_5162047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090167.1|5162277_5162649_+	VOC family protein	NA	NA	NA	NA	NA
WP_033090168.1|5162678_5163257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086872.1|5163372_5164320_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_155239401.1|5164996_5165167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090169.1|5165469_5166309_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	2.7e-25
WP_033090170.1|5166311_5167472_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033090171.1|5167604_5167883_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_033090172.1|5168023_5168242_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_096490343.1|5168443_5169577_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091737.1|5169902_5171042_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_033091736.1|5171141_5171765_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155240279.1|5171790_5171940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091734.1|5172065_5172863_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.4	1.0e-34
WP_096490405.1|5172859_5174356_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	5800940	5860210	8121733	transposase	Ostreococcus_lucimarinus_virus(33.33%)	56	NA	NA
WP_096490343.1|5800940_5802074_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_081986528.1|5802241_5802685_-	DUF4254 domain-containing protein	NA	NA	NA	NA	NA
WP_036552925.1|5802819_5804148_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062614374.1|5804396_5804939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172416856.1|5805559_5806057_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_033090404.1|5806074_5807058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090394.1|5807123_5808143_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_045439202.1|5808412_5809378_+	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_033090406.1|5809486_5810596_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_052086901.1|5810760_5811567_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033090395.1|5811638_5812598_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033090396.1|5812709_5813225_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_155239315.1|5813366_5813540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090397.1|5813773_5814406_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052086902.1|5814484_5815198_+	YdcF family protein	NA	NA	NA	NA	NA
WP_033090408.1|5815423_5817352_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_052086903.1|5817550_5819194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090398.1|5819394_5819775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090399.1|5819846_5821289_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	26.5	3.2e-34
WP_033090400.1|5821720_5822452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086904.1|5822858_5824211_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045439208.1|5824210_5824924_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_096490660.1|5824937_5826431_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_033090402.1|5826873_5827329_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143161394.1|5827519_5828527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490498.1|5828782_5829916_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033090229.1|5830002_5830407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158544111.1|5830542_5832054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090231.1|5832310_5832922_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090232.1|5833030_5833516_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096490662.1|5833695_5834715_+	cutinase family protein	NA	A0A166Y6Q9	Gordonia_phage	35.8	2.5e-12
WP_033090233.1|5835713_5836013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086881.1|5836122_5836719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490882.1|5836830_5838297_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_033090234.1|5838449_5838701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090235.1|5838938_5840138_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_033090236.1|5840130_5840553_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_033090237.1|5840709_5841471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090238.1|5842384_5842645_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_052086882.1|5842747_5843878_-	lipase	NA	NA	NA	NA	NA
WP_081986227.1|5844188_5845634_-	MFS transporter	NA	NA	NA	NA	NA
WP_033090240.1|5845630_5846743_-	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_145961841.1|5846849_5847209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090242.1|5847439_5847730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986226.1|5848046_5848646_-	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_106852449.1|5848808_5849333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090245.1|5849386_5849779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090246.1|5849780_5850500_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090247.1|5850533_5851376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090249.1|5852777_5854595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145961842.1|5854841_5855201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490385.1|5855888_5857022_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_143161396.1|5857289_5857616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490664.1|5857635_5858780_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.0	4.1e-32
WP_143161397.1|5858902_5859136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490436.1|5859124_5860210_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	6265483	6440918	8121733	integrase,transposase,tRNA,protease	Gordonia_phage(11.76%)	155	6309960:6309986	6313672:6313698
WP_033086536.1|6265483_6268183_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.1	7.2e-136
WP_033086537.1|6268510_6269149_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_033086538.1|6269373_6269742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086111.1|6269843_6270770_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_033086568.1|6270766_6272344_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_033086569.1|6272462_6273053_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033086539.1|6273158_6274691_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_052086112.1|6274702_6275113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490678.1|6275329_6276766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155239901.1|6276766_6276925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086541.1|6276985_6280066_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036548341.1|6280162_6282439_-	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	33.7	2.7e-19
WP_052486574.1|6282435_6284121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158544126.1|6284117_6285320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033086543.1|6285614_6287933_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_033086544.1|6287929_6288742_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_033086545.1|6288842_6289214_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_063864944.1|6289332_6289812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086574.1|6290157_6291438_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	3.3e-139
WP_033086575.1|6291767_6292391_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	30.5	2.7e-06
WP_033086546.1|6292492_6293074_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.4	1.7e-42
WP_033086576.1|6293308_6294712_-	trigger factor	NA	NA	NA	NA	NA
WP_033086547.1|6294954_6295506_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_033086548.1|6295649_6296174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086549.1|6298474_6301054_+	polynucleotide kinase-phosphatase	NA	A0A2L0UZN4	Agrobacterium_phage	26.9	5.8e-26
WP_033086550.1|6301120_6301567_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_103557322.1|6301854_6302565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086552.1|6302574_6303789_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_033086553.1|6303895_6306148_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.4	1.6e-173
WP_033086554.1|6306183_6306990_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_033086555.1|6307100_6307790_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_096490371.1|6308000_6309134_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_045440457.1|6309459_6309858_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
6309960:6309986	attL	TGGTCGGGGTGACAGGATTTGAACCTG	NA	NA	NA	NA
WP_143161417.1|6309967_6310237_+	hypothetical protein	NA	A0A1U9WS33	Gordonia_phage	57.8	2.0e-22
WP_158544128.1|6310598_6310691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087099.1|6310708_6311077_+	MspA family porin	NA	NA	NA	NA	NA
WP_155240408.1|6311895_6312162_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_081986489.1|6312198_6312474_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_033091646.1|6313165_6313417_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A2P1N2P2	Gordonia_phage	36.1	9.3e-06
WP_071343319.1|6314082_6315168_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
6313672:6313698	attR	TGGTCGGGGTGACAGGATTTGAACCTG	NA	NA	NA	NA
WP_033090931.1|6315387_6316377_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.7	8.0e-08
WP_033090930.1|6316459_6317302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490681.1|6317309_6318206_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033090937.1|6318322_6318916_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096490893.1|6319973_6320216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090929.1|6320303_6320714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090928.1|6320791_6321397_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_033090935.1|6321393_6323190_-	ribonucleoside triphosphate reductase	NA	D9ZNH0	Clostridium_phage	42.7	3.2e-140
WP_045439826.1|6323554_6324829_+	inositol phosphorylceramide synthase	NA	NA	NA	NA	NA
WP_052086981.1|6324890_6326150_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_081986319.1|6326193_6326607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036550410.1|6326856_6327723_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_052086982.1|6328823_6329588_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_143161418.1|6329654_6329954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986317.1|6329998_6331075_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.2	4.6e-41
WP_036552925.1|6331323_6332652_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091043.1|6332849_6333053_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.5	4.7e-16
WP_033091044.1|6333798_6334149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091045.1|6334315_6335128_-	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	28.9	1.6e-09
WP_033091046.1|6335152_6335623_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_045439889.1|6335734_6336856_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_081986330.1|6336950_6337649_-	DsbA family protein	NA	NA	NA	NA	NA
WP_033091048.1|6337757_6338954_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033091049.1|6339059_6339461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063897735.1|6339503_6340820_+	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_052086992.1|6340767_6341754_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091050.1|6342312_6343149_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.2	1.1e-37
WP_033091051.1|6343505_6346094_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	33.5	6.6e-46
WP_033091052.1|6346276_6346879_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2I7SAC1	Vibrio_phage	31.8	3.8e-13
WP_071343317.1|6347194_6348328_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_096490894.1|6348295_6348883_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_052086836.1|6348895_6349810_-	DUF4333 domain-containing protein	NA	NA	NA	NA	NA
WP_052086835.1|6349806_6350370_-	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	39.0	1.1e-17
WP_045438944.1|6350533_6350968_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081986189.1|6351225_6351669_-	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_033090020.1|6351679_6351958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086834.1|6352036_6353650_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_033090019.1|6353802_6354207_-	globin	NA	NA	NA	NA	NA
WP_172416829.1|6354474_6355206_+	HNH endonuclease	NA	H6WG01	Cyanophage	34.7	2.1e-21
WP_081986191.1|6355271_6355889_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081986188.1|6355964_6356726_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_033090018.1|6356769_6357087_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_033090017.1|6357089_6357821_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_033090016.1|6358129_6358801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986190.1|6358814_6359189_-	thioesterase	NA	NA	NA	NA	NA
WP_096490682.1|6359302_6364210_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_033090014.1|6364811_6366488_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	30.0	8.1e-45
WP_052086833.1|6366498_6366948_-	single-stranded DNA-binding protein	NA	A0A2H4YHU9	Gordonia_phage	35.9	1.3e-13
WP_033090013.1|6368023_6370063_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_081986186.1|6370597_6371521_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	36.8	2.1e-34
WP_145961847.1|6371520_6371811_-	hypothetical protein	NA	Q9ETV7	Enterobacteria_phage	39.4	1.1e-10
WP_143161420.1|6371865_6372417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090010.1|6373449_6373863_-	VOC family protein	NA	NA	NA	NA	NA
WP_081986185.1|6374056_6374809_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_158544130.1|6375035_6376748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091734.1|6377282_6378080_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.4	1.0e-34
WP_096490683.1|6378076_6379573_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_071343883.1|6379699_6380023_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096490432.1|6380022_6380949_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096490684.1|6381005_6381926_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_036553000.1|6381922_6382219_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036552925.1|6383390_6384719_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033090481.1|6385078_6386722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090480.1|6386839_6387115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090479.1|6387320_6388229_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090489.1|6388313_6388832_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_033090478.1|6389421_6389760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086911.1|6389801_6391487_-	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045439432.1|6391545_6391785_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033090477.1|6392078_6392360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045439426.1|6392625_6393831_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_033090476.1|6393935_6395081_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033090475.1|6395091_6396087_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081986258.1|6396083_6396968_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.5	9.6e-13
WP_081986257.1|6396940_6397753_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_081986256.1|6397931_6398813_+|transposase	transposase	transposase	F9VHY8	Thermus_phage	36.8	4.0e-27
WP_033090474.1|6399252_6400515_-	diaminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_081986255.1|6400744_6401473_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_033090472.1|6401465_6402281_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_036549355.1|6402289_6403285_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	4.0e-15
WP_052086910.1|6403834_6406495_+	nitrate- and nitrite sensing domain-containing protein	NA	NA	NA	NA	NA
WP_045439441.1|6406550_6406934_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_033090470.1|6406930_6407368_+	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_033090469.1|6407384_6407951_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_096490343.1|6408270_6409404_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033090823.1|6409665_6409986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090829.1|6410448_6411069_+	DUF4254 domain-containing protein	NA	NA	NA	NA	NA
WP_033090822.1|6411072_6411423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045439756.1|6411423_6412587_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_052086969.1|6412650_6413715_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_033090821.1|6413844_6414465_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143161421.1|6415894_6416413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986305.1|6416772_6417309_-	DUF3558 family protein	NA	NA	NA	NA	NA
WP_033090819.1|6417711_6418308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090818.1|6418400_6418910_-	Ltp family lipoprotein	NA	A0A0K0MWU9	Gordonia_phage	47.5	8.8e-11
WP_081986304.1|6419218_6420658_+	MFS transporter	NA	NA	NA	NA	NA
WP_033090817.1|6420662_6421055_-	VOC family protein	NA	NA	NA	NA	NA
WP_158544132.1|6421316_6422624_+	cutinase family protein	NA	NA	NA	NA	NA
WP_033090815.1|6422616_6423564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090814.1|6423743_6424322_+	PadR family transcriptional regulator	NA	H9EB19	Vibrio_phage	41.5	2.1e-08
WP_033090813.1|6424318_6426346_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_052086967.1|6426346_6426964_+	VOC family protein	NA	NA	NA	NA	NA
WP_036553000.1|6427028_6427325_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096490685.1|6427321_6428242_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_052087028.1|6428285_6428717_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_033091302.1|6428908_6429703_+	SDR family oxidoreductase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	29.1	6.6e-05
WP_033091301.1|6429845_6431192_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_033091300.1|6431195_6432950_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	37.8	1.1e-65
WP_033091299.1|6433142_6433769_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	41.2	4.5e-25
WP_143161423.1|6434021_6435320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091297.1|6435588_6435774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091296.1|6436122_6436395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155239916.1|6436506_6436758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036551225.1|6437155_6439150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062614421.1|6439700_6440918_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	6488047	6591736	8121733	integrase,transposase,protease	Mycobacterium_phage(16.67%)	77	6486862:6486887	6542509:6542525
6486862:6486887	attL	TGCGCCATTAGCTCAATTGGCAGAGC	NA	NA	NA	NA
WP_071343319.1|6488047_6489133_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
6486862:6486887	attL	TGCGCCATTAGCTCAATTGGCAGAGC	NA	NA	NA	NA
WP_052087117.1|6489193_6489910_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_052087118.1|6490041_6491349_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.5	4.7e-16
WP_096490381.1|6491889_6493023_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_121556186.1|6493291_6493708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155239237.1|6493876_6494053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343611.1|6495052_6495376_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036553034.1|6495375_6496311_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_052086998.1|6496879_6497407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063897737.1|6499159_6499555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145961852.1|6499606_6500374_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_103557214.1|6502374_6503574_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	3.6e-31
WP_143161437.1|6504603_6505764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161438.1|6507021_6507237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086999.1|6507694_6508018_+	hypothetical protein	NA	NA	NA	NA	NA
6507625:6507650	attR	TGCGCCATTAGCTCAATTGGCAGAGC	NA	NA	NA	NA
WP_052087000.1|6509424_6510123_-	hypothetical protein	NA	NA	NA	NA	NA
6507625:6507650	attR	TGCGCCATTAGCTCAATTGGCAGAGC	NA	NA	NA	NA
WP_096490498.1|6510181_6511315_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091774.1|6513026_6514172_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_162836621.1|6514168_6514333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490343.1|6514714_6515848_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172416855.1|6516152_6517937_-	maturase	NA	NA	NA	NA	NA
WP_143837562.1|6519237_6519612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986232.1|6519746_6520334_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033090267.1|6520346_6521144_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_071343689.1|6521922_6522633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145961853.1|6522634_6523054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090264.1|6526542_6527379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986231.1|6527525_6527978_+	DoxX family protein	NA	NA	NA	NA	NA
WP_052086885.1|6528113_6529538_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_052086884.1|6529545_6530622_-	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	34.6	2.3e-32
WP_081986230.1|6530618_6532259_-	alanine racemase	NA	NA	NA	NA	NA
WP_045439129.1|6532905_6533580_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-14
WP_033090261.1|6533576_6534404_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	4.6e-09
WP_045439131.1|6534400_6535225_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033090260.1|6535217_6536171_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_052086886.1|6536191_6537694_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_052086883.1|6539407_6540007_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033090257.1|6540689_6541238_+	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	62.9	4.0e-25
WP_036552925.1|6541346_6542675_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091004.1|6543948_6546951_-	UPF0182 family protein	NA	NA	NA	NA	NA
WP_033091011.1|6547202_6547811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172416869.1|6547815_6548862_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_033091006.1|6548926_6550336_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_033091007.1|6550419_6551274_+	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_052086990.1|6551324_6552713_+	AarF/ABC1/UbiB kinase family protein	NA	G9E5W0	Micromonas_pusilla_virus	25.9	2.0e-20
WP_173850124.1|6552822_6553095_-	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091010.1|6553276_6553645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045439868.1|6553796_6555953_-	ATP-dependent DNA helicase UvrD2	NA	A0A068EQC7	Bacillus_phage	26.8	3.7e-42
WP_071343319.1|6557540_6558626_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033089774.1|6558650_6559118_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033089773.1|6559117_6559543_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_033089772.1|6559539_6559962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089771.1|6560092_6560323_+	mycoredoxin	NA	NA	NA	NA	NA
WP_033089770.1|6560382_6561309_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_033089785.1|6561332_6562394_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_081986156.1|6562476_6566241_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	20.5	2.0e-11
WP_096490895.1|6566237_6568433_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_071343680.1|6570075_6570861_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033089768.1|6570875_6571178_+	MGMT family protein	NA	NA	NA	NA	NA
WP_033089767.1|6571224_6571968_+	VOC family protein	NA	NA	NA	NA	NA
WP_096490896.1|6571947_6572286_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	72.5	2.4e-25
WP_081986154.1|6573026_6573908_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_081986153.1|6573957_6574917_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081986152.1|6575112_6576864_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_096490698.1|6576949_6577732_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106852438.1|6577940_6578111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071812116.1|6578070_6578514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036547859.1|6578880_6582585_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_033089764.1|6582587_6584294_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	3.9e-18
WP_033089763.1|6584290_6584971_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_033089762.1|6584967_6585702_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_033089761.1|6585706_6586369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986158.1|6586466_6587765_-	acyltransferase	NA	G9L6E5	Escherichia_phage	26.0	2.7e-16
WP_033089760.1|6587782_6588670_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_033089759.1|6588823_6589534_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_096490699.1|6589771_6590080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490343.1|6590602_6591736_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	6742959	6809633	8121733	transposase	Catovirus(25.0%)	56	NA	NA
WP_033087568.1|6742959_6744135_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	73.3	3.2e-149
WP_052486619.1|6744353_6745169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033087567.1|6745251_6747063_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	35.6	6.7e-53
WP_081985864.1|6747305_6748139_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_052086317.1|6748322_6748994_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_033087566.1|6749063_6749786_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_158544138.1|6750368_6751427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490899.1|6751435_6754114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081985862.1|6754122_6755226_-	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
WP_045437183.1|6755359_6755797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033087563.1|6756222_6756957_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_071343650.1|6756983_6758219_-	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_033087562.1|6758552_6759347_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_045437180.1|6759546_6760581_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_081985858.1|6760565_6761039_-	VOC family protein	NA	NA	NA	NA	NA
WP_033087561.1|6761044_6761884_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033087580.1|6762008_6762725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033087560.1|6762721_6763660_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	5.4e-14
WP_033087559.1|6763886_6764675_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033087558.1|6764721_6765255_-	VOC family protein	NA	NA	NA	NA	NA
WP_081985857.1|6769365_6773136_+	multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit	NA	NA	NA	NA	NA
WP_045437175.1|6773594_6774230_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033087556.1|6774247_6775741_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_052086314.1|6775815_6776436_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_172416786.1|6776584_6778159_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033087555.1|6778216_6778801_-	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_033087554.1|6778889_6779765_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033087553.1|6779808_6780960_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_033087552.1|6781096_6782893_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	27.4	1.0e-53
WP_033087551.1|6783007_6783922_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033087550.1|6783935_6784766_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033087549.1|6784802_6786335_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081985860.1|6786511_6787051_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033087548.1|6787200_6788616_+	AAA family ATPase	NA	S4TST9	Salmonella_phage	26.2	1.2e-12
WP_081985856.1|6788666_6789671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081985859.1|6789896_6790793_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_036546107.1|6790808_6791954_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	3.4e-18
WP_033087545.1|6791950_6792592_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033087544.1|6792588_6793302_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033087543.1|6793275_6793533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081985855.1|6793573_6793780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081985854.1|6793778_6794552_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033087540.1|6794548_6795928_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_033087539.1|6796008_6796341_+	hemophore-related protein	NA	NA	NA	NA	NA
WP_033087538.1|6796496_6796703_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_033087537.1|6796699_6797578_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036546114.1|6797747_6797927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033087536.1|6798005_6798401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986516.1|6799077_6799662_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	40.4	1.2e-16
WP_062614421.1|6801130_6802348_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091691.1|6802493_6803897_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145961854.1|6804094_6805729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162836621.1|6806174_6806339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091774.1|6806335_6807481_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_096490709.1|6807526_6808612_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096490710.1|6808712_6809633_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	4.0e-22
>prophage 23
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	6903087	6970970	8121733	transposase	Pseudomonas_phage(25.0%)	60	NA	NA
WP_096490403.1|6903087_6904221_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_052087132.1|6904565_6905255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083414840.1|6905384_6906815_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.1	4.8e-54
WP_158544142.1|6907706_6908915_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|6909818_6910904_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033088983.1|6910974_6912054_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_033088982.1|6912109_6912739_-	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_033088981.1|6912840_6913800_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_143161449.1|6914082_6914619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158544144.1|6914634_6915723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052486809.1|6915948_6917334_+	DUF1298 domain-containing protein	NA	NA	NA	NA	NA
WP_052086654.1|6917372_6917792_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_033088979.1|6917795_6918521_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033088978.1|6918640_6919570_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_081986057.1|6919555_6920353_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_033088976.1|6920376_6921270_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_081986054.1|6921266_6922661_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096490713.1|6922892_6925223_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_045438052.1|6925227_6925467_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_081986053.1|6925536_6927111_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_033088974.1|6927107_6927626_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_033088973.1|6927727_6928000_+	DUF2277 domain-containing protein	NA	NA	NA	NA	NA
WP_033088972.1|6928038_6931443_-	SMC family ATPase	NA	A0A1S5R3N7	Pseudomonas_phage	25.7	3.6e-07
WP_096490714.1|6931558_6933001_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_033088971.1|6933324_6934461_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_143161451.1|6934578_6935715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033088970.1|6935861_6936863_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_033088969.1|6937045_6937744_+	lipid droplet-associated protein	NA	NA	NA	NA	NA
WP_033088968.1|6937867_6938290_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_106852383.1|6938366_6939236_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_033088967.1|6939518_6940922_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_033088987.1|6941054_6942086_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_033088966.1|6942214_6942796_+	DUF4245 domain-containing protein	NA	NA	NA	NA	NA
WP_033088965.1|6942842_6943067_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_052086651.1|6943063_6944293_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	40.0	6.1e-74
WP_143161452.1|6944356_6944542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088962.1|6944693_6944996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088961.1|6945008_6945224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086650.1|6945502_6945694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086649.1|6945752_6946205_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081986056.1|6947143_6947989_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_033088959.1|6948113_6948620_-	esterase	NA	NA	NA	NA	NA
WP_071812413.1|6948765_6950166_-	PhoH family protein	NA	A0A2L0UZX2	Agrobacterium_phage	31.4	7.3e-23
WP_033088984.1|6950394_6950781_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_071344734.1|6951000_6952230_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_033091089.1|6952600_6952927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091090.1|6953003_6953309_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_081986340.1|6953433_6954810_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	49.5	7.5e-89
WP_172416846.1|6955289_6956492_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_033091092.1|6956854_6957787_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.2	1.5e-27
WP_045438056.1|6957956_6958562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091093.1|6958642_6959422_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.6	1.3e-16
WP_081986343.1|6959563_6960271_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_081986345.1|6960400_6961912_+	HAMP domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	32.4	3.1e-11
WP_033091095.1|6962237_6962714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036552925.1|6965986_6967315_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052486836.1|6968398_6968620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158544147.1|6968896_6969505_-	MspA family porin	NA	NA	NA	NA	NA
WP_036553034.1|6969711_6970647_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071343611.1|6970646_6970970_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	7293683	7398381	8121733	transposase,bacteriocin	Caulobacter_phage(16.67%)	57	NA	NA
WP_033085708.1|7293683_7294481_+|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_033085707.1|7294481_7295468_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_033085706.1|7295605_7296196_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_033085705.1|7296298_7296829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033085757.1|7296989_7297445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033085704.1|7297478_7297874_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_143161174.1|7297990_7298497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033085702.1|7298484_7300116_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_033085701.1|7300252_7301566_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	27.3	3.4e-06
WP_033085700.1|7301591_7302275_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045435802.1|7302451_7304035_+	amino acid permease	NA	NA	NA	NA	NA
WP_155239121.1|7304051_7304201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033085699.1|7304197_7304932_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_033085698.1|7304940_7305576_+	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_071811579.1|7305572_7307585_+	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_033085697.1|7307623_7309231_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_045435825.1|7309237_7310080_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_081985634.1|7310174_7310702_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033085695.1|7310746_7311892_+	lipase	NA	NA	NA	NA	NA
WP_052085983.1|7311923_7313342_-	vanadium-dependent haloperoxidase	NA	A0A1V0SKZ4	Klosneuvirus	33.6	1.2e-52
WP_033085694.1|7313574_7315143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033085693.1|7315127_7315895_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	7.0e-20
WP_033085692.1|7316074_7316878_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_033085691.1|7316897_7317467_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_096490903.1|7317628_7362007_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	23.9	1.4e-130
WP_033090534.1|7362307_7363066_-	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_033090528.1|7363102_7363528_-	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033090529.1|7363576_7364212_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033090530.1|7364208_7365381_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_033090531.1|7365511_7366561_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033090532.1|7366599_7367325_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	3.0e-28
WP_033090533.1|7367410_7368451_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_071344734.1|7368716_7369946_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_052086709.1|7370038_7371505_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_096490904.1|7371998_7373240_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_033091210.1|7373516_7374482_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091209.1|7375730_7376312_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091208.1|7376392_7377154_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_033091207.1|7377293_7377719_+	DUF4254 domain-containing protein	NA	NA	NA	NA	NA
WP_033091206.1|7377712_7379647_-	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_033091205.1|7379658_7380492_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_033091204.1|7380488_7380968_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_033091203.1|7380964_7382125_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033091211.1|7382121_7384125_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_033091202.1|7384133_7385693_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	61.1	3.5e-18
WP_033091201.1|7385781_7386375_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096490343.1|7386420_7387554_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091652.1|7387735_7388497_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_033091651.1|7388518_7388962_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_045440462.1|7389024_7390260_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096490734.1|7390613_7390892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036552925.1|7390876_7392205_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096490735.1|7392365_7392986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158544159.1|7394285_7395740_-	DUF222 domain-containing protein	NA	NA	NA	NA	NA
WP_033091766.1|7395849_7396512_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_033091767.1|7396614_7397070_+	ester cyclase	NA	NA	NA	NA	NA
WP_071343319.1|7397295_7398381_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_AP017900	Nocardia seriolae strain UTF1	8121733	8003219	8061800	8121733	integrase,transposase	Acinetobacter_phage(16.67%)	55	8023836:8023853	8060889:8060906
WP_096490343.1|8003219_8004353_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155238943.1|8004398_8006336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091624.1|8006559_8008488_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_033091625.1|8008736_8009795_+	esterase family protein	NA	A0A2I6AZH7	Macacine_betaherpesvirus	36.0	8.4e-48
WP_096490343.1|8010197_8011331_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033088207.1|8012055_8014701_-	replicative DNA helicase	NA	G9L681	Escherichia_phage	26.8	1.4e-59
WP_033088208.1|8015315_8015771_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_033088209.1|8015788_8016058_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_033088210.1|8016120_8016681_-	single-stranded DNA-binding protein	NA	A0A2H4JEL4	uncultured_Caudovirales_phage	90.2	7.6e-56
WP_033088211.1|8016817_8017108_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_033088212.1|8017341_8018715_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_071812216.1|8018774_8019563_-|transposase	transposase	transposase	M4I0N8	Staphylococcus_phage	40.7	3.0e-26
WP_081985952.1|8019498_8020206_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033088214.1|8020305_8021268_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_033088215.1|8021288_8022407_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	43.4	2.4e-61
WP_033088216.1|8022506_8023082_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.2	1.7e-34
WP_081985953.1|8023318_8024518_+	hypothetical protein	NA	NA	NA	NA	NA
8023836:8023853	attL	TCGAGGCGGCCGTCGCCG	NA	NA	NA	NA
WP_081985954.1|8024549_8025770_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_172416820.1|8025766_8028355_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0S8	Acinetobacter_phage	30.9	1.8e-30
WP_045437775.1|8028370_8029225_+	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_033088218.1|8029242_8030049_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_036549782.1|8030045_8030687_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_033088219.1|8030686_8031688_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_096490761.1|8031708_8031957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490762.1|8031957_8032440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088221.1|8032550_8033951_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.0	1.5e-12
WP_081985955.1|8033947_8035666_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_096490763.1|8035675_8038306_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_033088222.1|8038609_8039023_-	DUF5318 domain-containing protein	NA	NA	NA	NA	NA
WP_033088223.1|8039198_8039756_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033088224.1|8039748_8040846_+	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	42.9	8.4e-75
WP_033088225.1|8040906_8041332_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_033088226.1|8041342_8041798_-	effector binding domain-containing protein	NA	NA	NA	NA	NA
WP_033088227.1|8042113_8044333_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_081985957.1|8044428_8045322_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_081985958.1|8045321_8046332_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_096490764.1|8046401_8047706_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033088229.1|8047872_8048697_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_033088230.1|8048708_8049221_+	TIGR04338 family metallohydrolase	NA	NA	NA	NA	NA
WP_143161491.1|8049290_8050208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045437790.1|8050188_8051115_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_158544167.1|8051653_8052364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158544168.1|8052454_8052739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158544169.1|8052739_8053378_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_033088233.1|8053489_8054659_-	thiolase family protein	NA	NA	NA	NA	NA
WP_172416819.1|8054770_8055283_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033088234.1|8055293_8056364_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.5	1.1e-18
WP_081985960.1|8056455_8056923_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	65.6	1.1e-15
WP_158544170.1|8056873_8057383_+	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_052086515.1|8057588_8058218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088252.1|8058502_8058862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173850126.1|8059164_8059899_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_033088236.1|8059909_8060377_+	NUDIX domain-containing protein	NA	D9I6E8	Acinetobacter_virus	58.5	1.6e-06
WP_096490370.1|8060550_8061477_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
8060889:8060906	attR	CGGCGACGGCCGCCTCGA	NA	NA	NA	NA
WP_071343883.1|8061476_8061800_-|transposase	transposase	transposase	NA	NA	NA	NA
