The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	18443	146019	3172118	integrase,transposase,tRNA	Shigella_phage(30.0%)	107	80654:80713	145263:146044
WP_036764621.1|18443_19355_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_044180337.1|19364_21434_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_086957381.1|21654_22905_+	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_086957382.1|22951_25363_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.4	2.8e-115
WP_044180344.1|25382_26465_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_044180347.1|26468_27566_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	31.7	1.5e-52
WP_044180348.1|27567_28992_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_075985093.1|30254_30449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957384.1|31204_31905_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_005302269.1|32768_32906_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_036765202.1|32918_33275_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_075985224.1|33241_33499_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.0	2.4e-17
WP_044180350.1|33501_35124_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_075985093.1|35437_35632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957385.1|35640_36849_+|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_086958432.1|37262_37457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957386.1|38903_40271_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_086957387.1|40440_40881_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_086957388.1|41318_43208_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_005302257.1|43217_43838_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_005302255.1|43854_44652_+	ParA family protein	NA	V5UP47	Mycobacterium_phage	32.3	4.4e-17
WP_044180357.1|44668_45550_+	ParB/RepB/Spo0J family partition protein	NA	A0A2K9V477	Faecalibacterium_phage	29.0	2.9e-09
WP_065170996.1|45734_46124_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_086957389.1|46132_46918_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_005302247.1|46986_47244_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_036764613.1|47320_47791_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_044180363.1|47806_48340_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_065170997.1|48356_49898_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_044180367.1|49942_50809_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_005302228.1|50841_52248_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_044180370.1|52265_52688_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_044180372.1|52878_54237_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	35.0	1.3e-29
WP_086957390.1|54443_55211_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086957391.1|55228_57061_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.3	5.2e-130
WP_172426107.1|57693_58974_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_086957393.1|59128_60337_-|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|60345_60540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036764610.1|61294_61660_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044180378.1|61735_63295_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_044180380.1|63296_65138_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_044180382.1|65246_66176_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_044180383.1|66215_66473_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_069107766.1|66475_68122_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	7.6e-64
WP_086957394.1|69326_70523_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985035.1|70531_70726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957395.1|70975_71680_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.8	1.4e-38
WP_086957089.1|71676_71973_-|transposase	transposase	transposase	Q716C1	Shigella_phage	47.4	1.4e-16
WP_069107415.1|72881_73178_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	47.4	4.8e-17
WP_044173665.1|73174_74026_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	1.1e-50
WP_086957396.1|74816_75513_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044178777.1|76987_77590_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_086957397.1|77676_78666_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_086957398.1|78708_80046_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_005302176.1|80226_80493_-	YihD family protein	NA	NA	NA	NA	NA
80654:80713	attL	GGTAGTGACCCCAATTGATTTATTTAGTATATAATCATCCTTTTTAAGGATGGATTATTC	NA	NA	NA	NA
WP_086956953.1|80713_81410_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_005302173.1|81456_81630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957399.1|82008_82683_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044178790.1|82848_83508_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_044178793.1|83556_84909_-	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_086957400.1|85429_86126_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044178796.1|86211_87657_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_044178799.1|87663_89040_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_044178802.1|89228_90506_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_086957401.1|90644_91589_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.8	1.8e-09
WP_086957402.1|91601_92114_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	8.8e-19
WP_086957403.1|92402_93461_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_086957404.1|93463_94552_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_044178816.1|94554_95028_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_044178819.1|95128_95686_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_044178823.1|95753_96875_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_005302138.1|96877_97363_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_044178827.1|97556_98114_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_086957405.1|98117_99029_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_044178835.1|99037_99865_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_086957406.1|99871_100138_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_086957407.1|100127_100679_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_086957408.1|112532_114260_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	9.3e-20
WP_086957409.1|114320_115880_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044178850.1|115936_116914_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086957410.1|116916_117858_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_165761751.1|117919_118063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|118139_118837_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957412.1|118892_119630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957413.1|119951_121319_-	YjiH family protein	NA	NA	NA	NA	NA
WP_086957414.1|123102_123799_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_125653055.1|123710_124463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957415.1|124455_125775_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_044178888.1|125881_127240_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_086957416.1|127412_128252_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_086957417.1|128449_130492_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.6	2.5e-40
WP_086957418.1|130566_131037_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086957419.1|131119_131689_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_044178901.1|131735_133235_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_044178904.1|133250_134555_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	32.8	3.9e-47
WP_005302085.1|134667_134994_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	41.2	5.3e-17
WP_044178906.1|135204_136464_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_086957420.1|136646_138503_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_044178912.1|138561_138828_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_044178915.1|138835_139540_+	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_086957421.1|139635_140529_-	DMT family transporter	NA	NA	NA	NA	NA
WP_044178921.1|140640_141063_-	universal stress protein	NA	NA	NA	NA	NA
WP_005302067.1|141317_141845_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_036764584.1|141928_142267_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_044179332.1|142409_143600_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145956559.1|144065_144917_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	1.9e-50
WP_069107415.1|144913_145210_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	47.4	4.8e-17
WP_086956953.1|145322_146019_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
145263:146044	attR	GGTAGTGACCCCAATTGATTTATTTAGTATATAATCATCCTTTTTAAGGATGGATTATTCATGGCTACTATTGATGTGAAATGTCGTTTTTGTAATCAAGCGGAGCAAGTCCGCAAATATGGGACTAATCCACGAGGAGCTCAGCGATATCGCTGCTTTGATTGCAATCGAACATTTCTTCTTGATTACGCTTATGAAGCTTGTAAACCTGGCGTTAAGGAAAAGATTGTTGATATGGCGATGAATAGTTCAGGAGTAAGAGAGACGGGTCGAGTTTTGAAAGTCGGCTATAATACAGTACTACGCACTTTAAAAAACTCACACCGAAGCAAGTAACAACAATTCCCTTTGATATAGCCCACATTGAACTGATATGTGAAGTTGATGAGCAATGGTCGTTTGTCGGTAAAAAAAAGAATCAGCGCTGGTTATGGTATGCGTGGGAACCTAGATATAAGCGAGTCATTGCTCATGTATTTGGGAAACGGGACTCAGAAACATTCCATAAACTCCAACGTCTTCTTTTGCCGTTTACTATTCCTATTTATTGCACAGATGATTTTAAGGTGTATTCAAGCTATTTACCAAGAGAAAATCACATCATAGGTAAGCGATACACGCAACGAATTGAAAGAACAAATTTAACATTACGATCTCGACTAAAAAGATTAGTAAGAAAAACCATTGGTTTTTCGAAAAGCGAAGAGATGCACGATAAGGTTATTGGAACGTTTATAGAACGTGAATTTTACCATTAATAAATCAATTGGAGTCACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	150200	215446	3172118	transposase,tRNA	uncultured_Mediterranean_phage(14.29%)	53	NA	NA
WP_086957414.1|150200_150898_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|152269_152967_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957426.1|153169_153847_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_044178945.1|153905_154367_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_086957427.1|154528_156517_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_044178947.1|156564_157338_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044178950.1|157428_157893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957428.1|158237_159425_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_086957429.1|159421_160702_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_044178958.1|160706_161462_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_086957430.1|161461_162394_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_086957431.1|162799_165379_+	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_086957432.1|165452_165764_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_005302030.1|165843_165960_+	lipoprotein	NA	NA	NA	NA	NA
WP_044178967.1|165999_167253_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005302025.1|167261_168092_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_044178970.1|168088_168811_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_005302019.1|168807_169728_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.6	1.9e-16
WP_044178973.1|169755_170508_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_044178976.1|170716_172888_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	7.4e-115
WP_165761753.1|172935_174711_-	gamma-glutamyltransferase	NA	Q5GF27	Diachasmimorpha_longicaudata_entomopoxvirus	24.1	1.6e-06
WP_069107497.1|175779_177072_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_086957435.1|178960_179257_+	DUF3630 family protein	NA	NA	NA	NA	NA
WP_044178988.1|179396_180116_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	60.2	2.3e-65
WP_172426108.1|180718_182011_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_086957437.1|182450_183148_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957438.1|183927_186699_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.9	2.7e-77
WP_086956953.1|187695_188393_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_165761754.1|188534_189092_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_044179011.1|189084_190458_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_044179008.1|190563_191031_-	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_086957440.1|191046_191589_-	GTPase-activating protein	NA	NA	NA	NA	NA
WP_086957441.1|191588_192230_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044178999.1|193226_193844_-	cytochrome c4	NA	NA	NA	NA	NA
WP_005301998.1|194078_194744_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_075985093.1|195746_195941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957442.1|196592_197289_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957443.1|197392_199255_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_086958434.1|199707_200712_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_005301967.1|200904_202317_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_044179023.1|202334_203396_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	3.0e-05
WP_044179026.1|203496_204063_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_044179029.1|204187_205597_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_005301957.1|206179_208009_+	translational GTPase TypA	NA	A0A1B0RXH7	Streptococcus_phage	42.1	4.7e-22
WP_044179032.1|208194_208734_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005301955.1|208735_209383_-	DUF2959 domain-containing protein	NA	NA	NA	NA	NA
WP_044179035.1|209574_210495_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_044179038.1|210491_210929_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_068968268.1|210968_211886_+	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_086957385.1|212085_213294_-|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|213302_213497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125653058.1|213709_214552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957445.1|214748_215446_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	234952	302208	3172118	integrase,transposase,tRNA	Vibrio_phage(20.0%)	57	228195:228209	300669:300683
228195:228209	attL	ATGCAGCACAACGCC	NA	NA	NA	NA
WP_044179089.1|234952_236059_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_086957451.1|236445_238275_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.9	1.2e-06
WP_086958436.1|238325_238997_+	ATPase	NA	NA	NA	NA	NA
WP_044179096.1|239054_239876_+	glutamate racemase	NA	NA	NA	NA	NA
WP_044179099.1|239844_240297_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_044179102.1|246272_246911_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_044179105.1|246921_248271_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_044179108.1|248387_248816_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086957452.1|248891_249929_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_086366228.1|249925_250882_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_086957453.1|250881_251616_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_069107610.1|252185_253370_+	elongation factor Tu	NA	M4M9V7	Vibrio_phage	60.5	3.4e-05
WP_005301853.1|253606_253990_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_036764546.1|254001_254547_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	31.3	1.3e-12
WP_005301848.1|254672_255101_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_044179122.1|255105_255810_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_005301842.1|256033_256528_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_044179125.1|256587_256953_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_044179128.1|257178_261204_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.4	3.0e-21
WP_086957454.1|261303_265521_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.8	6.5e-67
WP_044179135.1|265654_266137_-	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_044179138.1|266294_267077_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_086957455.1|267247_268315_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_044179144.1|268465_269377_-	D-2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	29.3	8.7e-09
WP_005301821.1|269438_270026_+	DUF416 family protein	NA	NA	NA	NA	NA
WP_086957456.1|270461_271670_-|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|271678_271873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957457.1|273898_274954_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005301812.1|275183_275456_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	63.3	9.1e-23
WP_044179153.1|275500_276193_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_044179156.1|276321_277608_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_086957458.1|277645_279244_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.3	8.2e-71
WP_036764534.1|279467_279953_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_086957459.1|280069_280351_+	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_086957385.1|280726_281935_-|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|281943_282138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165761755.1|282393_283668_-	toprim domain-containing protein	NA	A0A1J0GWC9	Alteromonas_phage	30.6	1.0e-23
WP_086957461.1|283768_284164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958438.1|284163_284400_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_086957462.1|284419_284650_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_125653060.1|284758_285547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002542007.1|285646_285943_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_044179190.1|285965_286931_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_086957464.1|287107_287992_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005301759.1|288178_289636_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_036764527.1|289628_289946_-	YhdT family protein	NA	NA	NA	NA	NA
WP_086957465.1|290207_291404_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|291412_291607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957466.1|291964_293308_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_086957467.1|293320_293767_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_044179201.1|293796_294249_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_086957468.1|294755_296705_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.2	7.6e-87
WP_086956953.1|298096_298793_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957470.1|298798_299989_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_086957471.1|300004_300535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957472.1|300536_300824_-	hypothetical protein	NA	NA	NA	NA	NA
300669:300683	attR	GGCGTTGTGCTGCAT	NA	NA	NA	NA
WP_086957473.1|301011_302208_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	424380	478502	3172118	transposase,tRNA	Shigella_phage(22.22%)	44	NA	NA
WP_086956953.1|424380_425077_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|427055_427752_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957509.1|427996_428968_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_044176926.1|429149_429620_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_086957510.1|429992_430931_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_065170805.1|431022_431214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044176920.1|431314_432286_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	22.7	7.3e-06
WP_005301462.1|432564_432876_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_005301460.1|432894_433152_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_005301458.1|433217_434138_+	DMT family transporter	NA	NA	NA	NA	NA
WP_044176916.1|434227_435403_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_044176914.1|435564_436353_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_044176911.1|436349_436826_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_044176910.1|436851_437334_+	type 3 dihydrofolate reductase	NA	V9LZM6	Vibrio_phage	42.1	7.7e-33
WP_086957511.1|437440_438262_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A0A0YRJ8	Escherichia_phage	43.1	1.2e-06
WP_086957512.1|438387_439200_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_086957513.1|439196_440186_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_044176901.1|440178_441483_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_086957514.1|441534_443883_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_044176897.1|444055_444895_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_165761756.1|444969_445665_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_096498156.1|445839_448794_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	1.1e-23
WP_086957517.1|450596_451301_-	thiamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	5.4e-27
WP_086958454.1|451293_452889_-	thiamine/thiamine pyrophosphate ABC transporter, permease protein	NA	NA	NA	NA	NA
WP_086957518.1|452961_453951_-	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_044176885.1|454202_455003_-	DUF547 domain-containing protein	NA	NA	NA	NA	NA
WP_044176882.1|455064_455667_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_086957519.1|455666_457091_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_044176879.1|457124_458216_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_044176877.1|458243_459785_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_086956987.1|460514_461215_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957521.1|461352_462309_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_044176874.1|462704_464522_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.9	8.5e-48
WP_044176871.1|464901_466626_+	acetolactate synthase 3 large subunit	NA	H8ZJ31	Ostreococcus_tauri_virus	27.7	3.1e-39
WP_036764453.1|466618_467116_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_082212496.1|467453_468077_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_005301418.1|468451_469864_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_096498157.1|470664_471933_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_096498158.1|471941_472763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957522.1|472753_473209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044176855.1|473205_473847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044173665.1|474670_475522_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	1.1e-50
WP_069107415.1|475518_475815_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	47.4	4.8e-17
WP_086956953.1|477805_478502_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	536593	593489	3172118	transposase,tRNA	Klosneuvirus(12.5%)	38	NA	NA
WP_086959091.1|536593_537802_-|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|537810_538005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957538.1|538419_539628_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|539636_539831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065170771.1|540773_541175_-	DUF2061 domain-containing protein	NA	NA	NA	NA	NA
WP_086957539.1|541377_544239_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	2.5e-147
WP_044176774.1|544267_544720_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_036764432.1|544824_546333_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	2.7e-47
WP_044176772.1|546527_547628_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_086957540.1|547627_548698_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_044176768.1|548767_549259_-	RDD family protein	NA	NA	NA	NA	NA
WP_075985093.1|550847_551042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|552491_553188_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957541.1|553192_554671_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.7	4.4e-87
WP_086956953.1|554795_555493_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957542.1|555615_555960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957543.1|562050_562434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069531382.1|562729_564142_-	phosphoglucomutase/phosphomannomutase family protein	NA	A0A1X9I671	Streptococcus_phage	26.3	6.2e-30
WP_086956953.1|564601_565298_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_165761757.1|565209_567396_-	N,N'-diacetylchitobiose phosphorylase	NA	NA	NA	NA	NA
WP_125653062.1|567428_568829_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_086957545.1|568821_570561_-	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_086957546.1|571434_572406_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.3e-14
WP_044176763.1|572405_573431_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044176762.1|573433_574420_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_086957547.1|574566_576243_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086957548.1|576943_580336_-	response regulator	NA	W8CYF6	Bacillus_phage	28.8	4.8e-20
WP_044176758.1|580649_581669_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_086957549.1|581868_582957_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005301305.1|583330_584623_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_086957550.1|584983_586384_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_005301299.1|586445_586787_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	48.2	8.5e-26
WP_086957551.1|586894_588196_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	38.7	2.4e-12
WP_005301293.1|588323_589511_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044176747.1|589610_590216_+	DedA family protein	NA	NA	NA	NA	NA
WP_005301289.1|590299_590914_-	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_086957552.1|591030_591864_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_086957554.1|592280_593489_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	686398	756157	3172118	protease,transposase,tRNA	Ostreococcus_lucimarinus_virus(10.0%)	55	NA	NA
WP_065172244.1|686398_688345_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	44.1	9.5e-122
WP_044176610.1|688412_689249_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	28.2	6.7e-16
WP_044176608.1|689297_690635_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_044176605.1|690957_691302_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_005301149.1|691716_692172_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_044176603.1|692194_693679_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_086957587.1|693707_696512_+	translation initiation factor IF-2	NA	NA	NA	NA	NA
WP_005301142.1|696613_697015_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_086957588.1|697017_697965_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_005301136.1|698090_698360_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_086957589.1|698703_700830_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_086957590.1|700907_701861_+	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_044176592.1|701971_702850_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_044176589.1|702863_703871_-	U32 family peptidase	NA	Q6DW11	Phage_TP	29.7	1.6e-19
WP_036764391.1|706253_706775_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_036764389.1|706764_707271_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005301112.1|707454_708552_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_044176584.1|708674_709076_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_086957591.1|709065_709512_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_044176580.1|709619_711206_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.5	1.5e-32
WP_086957592.1|711532_713611_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_086957593.1|713707_714502_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_086957594.1|716243_716414_+	DUF1427 family protein	NA	NA	NA	NA	NA
WP_005301079.1|716787_717564_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_086957595.1|717825_719157_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	42.5	2.2e-77
WP_044176566.1|719167_720388_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_005301066.1|720849_721464_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_044176562.1|721653_722646_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_086957596.1|722834_725189_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_044176558.1|725283_726672_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_086957597.1|726787_727798_-	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	44.2	2.1e-19
WP_086957598.1|728050_729718_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	27.7	7.1e-41
WP_044176553.1|732048_732366_+	trp operon repressor	NA	NA	NA	NA	NA
WP_086957599.1|732517_733018_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_086957600.1|733021_733719_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_086957601.1|734297_735212_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_086957602.1|735223_737632_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_086957603.1|737979_738366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957604.1|738439_740101_+	Twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
WP_044176545.1|740190_740829_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086957605.1|741454_742183_+	sporulation protein	NA	NA	NA	NA	NA
WP_086956953.1|742493_743191_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_005300982.1|743898_744381_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.5	2.7e-25
WP_036764355.1|744574_745009_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_044176514.1|744998_745295_+	RnfH family protein	NA	NA	NA	NA	NA
WP_036765125.1|745400_745757_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_096498163.1|746012_747680_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_005300967.1|747872_748754_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_005300962.1|748973_749594_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_005300958.1|749808_751725_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	50.0	1.8e-144
WP_096498164.1|751821_752961_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.0	4.8e-25
WP_086957615.1|753018_753411_-	type IV pilin protein	NA	NA	NA	NA	NA
WP_086957616.1|753545_753893_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_086957617.1|753948_754645_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|755460_756157_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	815354	876022	3172118	protease,transposase,tRNA	uncultured_Mediterranean_phage(15.0%)	56	NA	NA
WP_161946855.1|815354_816074_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_165761759.1|815986_816463_+|protease	trypsin-like serine protease	protease	Q0ZP54	Neodiprion_abietis_NPV	46.5	5.5e-07
WP_044177449.1|816557_817610_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_044176437.1|817918_819052_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.1	1.2e-92
WP_005300808.1|819075_819414_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	4.5e-11
WP_086957639.1|819457_821311_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_086957640.1|821324_822272_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	50.8	1.0e-57
WP_086956953.1|822313_823011_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957641.1|823548_824352_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_044176430.1|824617_825349_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_044176428.1|825459_825981_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_044176426.1|826012_827227_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_086957642.1|827264_827651_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	4.3e-50
WP_036764320.1|827668_827992_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	43.9	2.0e-21
WP_044176421.1|828067_828583_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_086957643.1|828717_830571_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.7	9.1e-106
WP_044176417.1|830573_830912_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_172426139.1|830974_831169_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005300759.1|831456_832743_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.5	1.1e-33
WP_086957645.1|832801_834079_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.7	1.4e-36
WP_036764314.1|834180_834606_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	40.5	7.8e-21
WP_086957646.1|834988_836107_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_068967869.1|836160_836916_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_086957647.1|836908_837892_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_044176405.1|837905_839027_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_086957648.1|839123_840392_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044176402.1|840405_841020_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044176399.1|841031_842195_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_044176398.1|842408_843908_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_086956953.1|844322_845020_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957649.1|846113_846350_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_086957650.1|846467_847814_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	38.0	2.6e-38
WP_044176390.1|848123_849587_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.6	1.2e-97
WP_096498166.1|849701_851285_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_086957651.1|851756_853319_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_086957652.1|853463_854309_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_044176382.1|854400_855531_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	3.0e-35
WP_086957653.1|855753_856641_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036764301.1|856676_857189_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_086957654.1|857736_859116_-	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	37.7	3.3e-12
WP_086957655.1|859610_863516_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.0	1.0e-122
WP_086957656.1|863851_864265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005300696.1|864331_864670_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_086956953.1|864815_865513_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957657.1|865845_867096_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.3	5.2e-97
WP_005300690.1|867292_867742_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_086957658.1|867761_868898_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.8	1.0e-46
WP_005300686.1|868918_869575_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	31.8	9.6e-18
WP_086957659.1|869602_870706_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	37.7	5.0e-59
WP_005300681.1|870915_871386_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	7.1e-31
WP_096498167.1|871385_871853_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_044176370.1|871937_872924_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_068967876.1|872960_873446_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_044176367.1|873570_873810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069107566.1|874239_875262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|875324_876022_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	980956	1047744	3172118	transposase	Bacillus_thuringiensis_phage(20.0%)	56	NA	NA
WP_086957018.1|980956_981653_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|982972_983670_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044176245.1|984015_984399_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.3	2.0e-07
WP_086957701.1|984435_985158_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_044176239.1|985167_987471_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_086957702.1|987545_988772_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_086957703.1|988810_989587_+	ParA family protein	NA	Q8JL10	Natrialba_phage	34.5	2.4e-20
WP_086957704.1|989576_990785_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_086957705.1|991288_991507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957706.1|992278_992512_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_044176230.1|992895_993546_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	3.3e-10
WP_005300379.1|993548_994217_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_086957707.1|994442_995174_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_036764222.1|995181_995388_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_044176226.1|995384_995864_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_044176224.1|995867_997829_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_086957708.1|997840_998395_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_036764218.1|998391_998916_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_065170170.1|998912_1000193_+	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_044176217.1|1000463_1001279_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_044176214.1|1003072_1004314_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_086956953.1|1004734_1005432_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957709.1|1005487_1006204_-	DUF3379 domain-containing protein	NA	NA	NA	NA	NA
WP_044177410.1|1006190_1006760_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_086957710.1|1007409_1008720_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_086957711.1|1008719_1010840_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_086957713.1|1011429_1014195_-	insulinase family protein	NA	A0A1V0SJA4	Klosneuvirus	28.1	9.4e-99
WP_044176204.1|1014631_1015105_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_065170518.1|1015193_1015493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005300331.1|1015587_1016118_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_005300328.1|1016171_1017104_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_172426111.1|1017735_1019028_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_044176202.1|1019121_1019826_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	65.8	1.2e-82
WP_036764211.1|1021552_1022014_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005300318.1|1022125_1022992_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_005300316.1|1023126_1023549_+	YbaY family lipoprotein	NA	NA	NA	NA	NA
WP_086957715.1|1023877_1024183_-	MGMT family protein	NA	NA	NA	NA	NA
WP_086957716.1|1024294_1025032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044176199.1|1025437_1025632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172426111.1|1026595_1027888_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_075985035.1|1028873_1029068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044176197.1|1031709_1032177_+	2TM domain-containing protein	NA	NA	NA	NA	NA
WP_086957718.1|1033805_1036235_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|1036911_1037608_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_125653063.1|1037519_1037726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957719.1|1038430_1039128_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957720.1|1039804_1040296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957721.1|1040292_1040898_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086958480.1|1041041_1041317_+	nitrogen fixation protein NifW	NA	NA	NA	NA	NA
WP_086957722.1|1041337_1042366_-	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_086957723.1|1042553_1043591_-	FUSC family protein	NA	NA	NA	NA	NA
WP_075985021.1|1043990_1044464_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_044176193.1|1044539_1045478_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165761764.1|1045679_1045835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957724.1|1045945_1046512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957002.1|1047047_1047744_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	1123675	1241252	3172118	protease,transposase,tRNA	Bacillus_phage(16.67%)	103	NA	NA
WP_044176104.1|1123675_1125406_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.6	5.0e-90
WP_086957757.1|1125820_1126405_+	VOC family protein	NA	NA	NA	NA	NA
WP_172426140.1|1126485_1127325_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.6	1.8e-13
WP_086957759.1|1127577_1129536_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	3.3e-90
WP_086957761.1|1129536_1130238_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_096498176.1|1130743_1131301_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_086957765.1|1131307_1132210_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_086956953.1|1132262_1132960_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_065170246.1|1133177_1134872_+	long-chain-fatty-acid--CoA ligase FadD	NA	Q75ZG1	Hepacivirus	25.9	3.0e-39
WP_044176088.1|1135036_1136185_+	ribonuclease D	NA	NA	NA	NA	NA
WP_172426113.1|1136800_1138093_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_005300172.1|1138160_1138424_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_044176085.1|1138429_1139242_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_044176083.1|1139264_1139927_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_086957769.1|1140133_1140412_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_068945948.1|1140422_1141394_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_086956953.1|1141614_1142311_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_005300165.1|1142473_1142869_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_086957771.1|1143527_1145123_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_044176074.1|1145276_1145855_+	thymidine kinase	NA	A0A023W530	Serratia_phage	56.8	9.2e-57
WP_086957773.1|1145864_1146077_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|1147506_1148204_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044176072.1|1148298_1148919_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_044176070.1|1148915_1149689_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_086957775.1|1149698_1150436_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_044176064.1|1150450_1151077_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_086958487.1|1151076_1152150_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_165761784.1|1152162_1153206_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_086957779.1|1153230_1154526_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_086957781.1|1154530_1155427_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_044176055.1|1156349_1157585_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|1157655_1158353_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044176052.1|1158649_1159543_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_044176051.1|1159607_1160351_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_005300139.1|1160400_1160895_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_086957782.1|1161091_1162471_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	26.3	2.0e-49
WP_086957784.1|1162765_1163860_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_086957786.1|1164118_1164816_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957788.1|1164861_1165392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957790.1|1165624_1166017_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082212509.1|1166013_1166310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957792.1|1166393_1169093_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005300130.1|1169900_1170539_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_086956953.1|1171225_1171922_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_125653064.1|1171833_1172022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044176046.1|1172115_1173090_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_086957794.1|1173093_1174605_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_086957796.1|1174623_1175421_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_044177381.1|1175509_1176484_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_044176041.1|1176502_1177231_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_086957798.1|1178540_1180319_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	22.5	8.4e-08
WP_086957800.1|1180550_1181297_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_044176035.1|1181313_1181835_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	1.1e-08
WP_036764132.1|1182004_1182628_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_044176033.1|1182646_1183657_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.8	1.3e-08
WP_044176031.1|1183825_1184728_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_044176030.1|1185051_1185927_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005300094.1|1186408_1187116_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_086957802.1|1187112_1187991_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_044176027.1|1188052_1188520_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_044176024.1|1189549_1191136_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_036764126.1|1191154_1192291_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_044176023.1|1192302_1192407_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_086957804.1|1192403_1192706_+	cytochrome bd biosynthesis protein	NA	NA	NA	NA	NA
WP_172426114.1|1193330_1194623_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_036764119.1|1195325_1196012_+	protein TolQ	NA	NA	NA	NA	NA
WP_044176020.1|1196014_1196458_+	protein TolR	NA	NA	NA	NA	NA
WP_086957808.1|1196468_1197560_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_044176015.1|1197571_1198921_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_044176013.1|1198968_1199514_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_044176011.1|1199530_1200265_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_086957810.1|1200432_1201476_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_096498212.1|1201680_1203459_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.9	1.6e-43
WP_044176009.1|1203502_1204078_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_065170285.1|1204693_1205029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958491.1|1205144_1206773_+	histidine kinase	NA	NA	NA	NA	NA
WP_044175256.1|1206791_1207511_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_086957812.1|1207760_1208972_+	MFS transporter	NA	NA	NA	NA	NA
WP_036764111.1|1209285_1209738_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_044175261.1|1210069_1210810_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_044175264.1|1210823_1212029_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_036764108.1|1212073_1212421_+	phasin family protein	NA	NA	NA	NA	NA
WP_044175267.1|1212480_1214253_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_086957814.1|1217806_1218503_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_044177128.1|1219132_1219975_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_086957816.1|1220049_1220748_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_086956953.1|1221056_1221754_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957818.1|1222273_1222456_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086957821.1|1223013_1223710_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_086957823.1|1223735_1224089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165761767.1|1224048_1224363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065170292.1|1224495_1225923_-	amino acid permease	NA	NA	NA	NA	NA
WP_044175275.1|1226082_1227525_-	amino acid permease	NA	NA	NA	NA	NA
WP_086957827.1|1227632_1228085_-	beta-galactosidase subunit beta	NA	NA	NA	NA	NA
WP_086957829.1|1228089_1231191_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	32.4	1.6e-150
WP_086957831.1|1231500_1232487_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_044175283.1|1232822_1233155_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_086957833.1|1233259_1234885_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.5	4.2e-22
WP_086956953.1|1237275_1237973_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_125653065.1|1238131_1238329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|1238614_1239312_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_165761768.1|1239338_1240235_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_086957087.1|1240555_1241252_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	1261614	1299296	3172118	protease,transposase,tRNA	Bacillus_virus(25.0%)	24	NA	NA
WP_086957860.1|1261614_1262670_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	2.8e-19
WP_086957862.1|1262752_1263001_-	YciN family protein	NA	NA	NA	NA	NA
WP_086957864.1|1263584_1266233_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	34.3	1.4e-88
WP_086957868.1|1268231_1269017_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_086957871.1|1269092_1269854_-	DNA repair protein	NA	NA	NA	NA	NA
WP_086957872.1|1270155_1271130_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_086957874.1|1271307_1272504_+	methyltransferase	NA	NA	NA	NA	NA
WP_086956953.1|1272711_1273408_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957876.1|1273433_1275410_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.3	1.3e-17
WP_086957878.1|1275645_1276863_-	amino acid permease	NA	NA	NA	NA	NA
WP_069107472.1|1277206_1278421_+	CinA family nicotinamide mononucleotide deamidase-related protein	NA	NA	NA	NA	NA
WP_086956953.1|1279499_1280196_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957880.1|1281197_1281895_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957882.1|1281940_1284244_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_036764080.1|1284291_1284582_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	G9IAA2	Pseudomonas_phage	50.0	6.5e-11
WP_068968191.1|1284578_1285712_-	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	74.0	4.0e-165
WP_086957884.1|1285758_1288026_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2I7S840	Vibrio_phage	67.8	5.4e-302
WP_044175343.1|1288511_1289222_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_096498177.1|1289882_1292507_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	33.8	8.1e-100
WP_065170325.1|1292720_1293803_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.6	5.5e-87
WP_069107497.1|1294421_1295714_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_086957821.1|1296186_1296883_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_086957814.1|1297750_1298448_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|1298598_1299296_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	1323912	1379470	3172118	transposase	Powai_lake_megavirus(20.0%)	45	NA	NA
WP_086956969.1|1323912_1324609_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175383.1|1324916_1326458_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_044175385.1|1326560_1327043_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	46.4	4.1e-10
WP_086956953.1|1327392_1328089_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957914.1|1328116_1328497_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075985035.1|1329361_1329556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096498179.1|1329967_1331176_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|1331184_1331379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957918.1|1331731_1333177_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_005298771.1|1333573_1334428_-	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	26.8	4.5e-07
WP_096498180.1|1334766_1335464_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957920.1|1336189_1337038_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_086957922.1|1337700_1338831_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_086957924.1|1339150_1339819_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086957926.1|1339935_1342212_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_044175389.1|1342404_1343607_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_086957928.1|1343680_1345006_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_086957930.1|1345015_1345690_-	response regulator	NA	NA	NA	NA	NA
WP_005298782.1|1345916_1347599_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_044175391.1|1347912_1348179_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	76.9	2.9e-29
WP_044175393.1|1348551_1349769_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_172426115.1|1350668_1351961_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_044175394.1|1352117_1352705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957934.1|1352787_1352892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957936.1|1353692_1353893_-	DUF3861 family protein	NA	NA	NA	NA	NA
WP_086957939.1|1353999_1354431_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086957941.1|1354502_1355381_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_036763616.1|1355919_1357281_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_086957944.1|1357517_1358771_-	septum formation protein	NA	NA	NA	NA	NA
WP_086957946.1|1358961_1359561_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_044175401.1|1359625_1361035_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	32.9	1.2e-44
WP_086957948.1|1361197_1362715_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_086957950.1|1363106_1364144_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044175405.1|1364145_1365240_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_086957952.1|1368444_1369473_-	dihydroorotase	NA	NA	NA	NA	NA
WP_086957954.1|1369607_1371572_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.6	3.9e-30
WP_005298803.1|1371805_1372156_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_165761769.1|1372350_1372662_+	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_044175410.1|1372739_1373399_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_165761770.1|1373439_1374291_+	phosphotransferase	NA	NA	NA	NA	NA
WP_065170364.1|1375160_1376450_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065170365.1|1376511_1377168_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_086956953.1|1377608_1378305_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_005298823.1|1378334_1378460_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_086956953.1|1378772_1379470_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	1390342	1463531	3172118	transposase,tRNA	Bodo_saltans_virus(33.33%)	57	NA	NA
WP_086956953.1|1390342_1391039_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175419.1|1391182_1391734_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_086957967.1|1392037_1392733_-	DedA family protein	NA	NA	NA	NA	NA
WP_044175423.1|1393449_1394010_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_044175424.1|1394363_1394705_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_005298837.1|1394868_1395417_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_165761771.1|1395517_1396186_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_165761772.1|1396213_1397098_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_044175426.1|1397922_1399680_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.0	1.6e-59
WP_044175427.1|1399679_1400714_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_086957975.1|1400694_1400874_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_044175428.1|1400875_1401622_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_036763653.1|1401722_1402088_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_069107497.1|1402969_1404262_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_086957978.1|1404306_1405701_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_005298854.1|1406987_1407785_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_044175432.1|1407803_1409126_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_044175433.1|1409106_1409856_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_086957980.1|1409855_1414316_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_086957982.1|1414470_1415403_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_086957984.1|1415838_1417527_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_075985093.1|1418043_1418238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044175436.1|1419856_1420108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005298874.1|1420408_1421392_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.2	9.0e-36
WP_086957986.1|1421411_1423799_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.6	6.6e-08
WP_036763671.1|1424315_1424612_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_044175440.1|1424863_1425895_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_086957988.1|1425978_1426974_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_044177175.1|1426973_1427735_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2H4UU96	Bodo_saltans_virus	26.0	1.8e-07
WP_172426115.1|1428328_1429621_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_086957990.1|1429657_1430701_-	FUSC family protein	NA	NA	NA	NA	NA
WP_086957992.1|1432993_1433680_-	NrdJb	NA	A0A191VYJ2	Roseobacter_phage	38.2	1.9e-32
WP_086957331.1|1435533_1436231_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957996.1|1437085_1438096_-	porin	NA	NA	NA	NA	NA
WP_086958000.1|1438409_1439435_-	porin	NA	NA	NA	NA	NA
WP_086956953.1|1440850_1441547_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958496.1|1442879_1443128_-	high-potential iron-sulfur protein	NA	NA	NA	NA	NA
WP_086957384.1|1443208_1443909_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958002.1|1444248_1444884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044177177.1|1445032_1445443_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_086958004.1|1445518_1446925_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_086956953.1|1448060_1448758_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_005298903.1|1449980_1450685_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_086957719.1|1451245_1451943_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958006.1|1452635_1453727_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_086958008.1|1453891_1454521_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005298924.1|1454577_1454754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958010.1|1454950_1455580_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_086958012.1|1455886_1457242_+	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_005298931.1|1457389_1457755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065170418.1|1457859_1458252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036763687.1|1458476_1458761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958498.1|1458947_1459805_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086958014.1|1459862_1461104_+	peptidase T	NA	NA	NA	NA	NA
WP_086956953.1|1461311_1462008_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958015.1|1462013_1462847_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_086957384.1|1462830_1463531_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	1478769	1505303	3172118	protease,transposase	Morganella_phage(33.33%)	23	NA	NA
WP_086958029.1|1478769_1479849_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_086956953.1|1480118_1480815_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958031.1|1480888_1481821_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.3	2.2e-55
WP_086958033.1|1482109_1483036_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	43.8	2.6e-61
WP_086958035.1|1483168_1484005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958037.1|1485821_1486304_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_086958039.1|1486566_1487625_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	3.9e-85
WP_069107490.1|1487916_1488789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|1488875_1489573_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958041.1|1489665_1490646_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_044175476.1|1491182_1492301_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_086958043.1|1492301_1493255_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_086958500.1|1493264_1494998_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_086956953.1|1495085_1495782_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_005298985.1|1496645_1497161_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.4	4.4e-18
WP_086958045.1|1497343_1497688_-	response regulator	NA	NA	NA	NA	NA
WP_086956953.1|1497697_1498394_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958502.1|1498482_1499427_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_086958047.1|1499530_1500655_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_086958049.1|1500685_1501597_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044175488.1|1501828_1503022_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.6	9.5e-40
WP_086958051.1|1503024_1504056_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	90.4	1.3e-21
WP_086956953.1|1504605_1505303_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	1539718	1600231	3172118	protease,transposase,tRNA	Shigella_phage(25.0%)	51	NA	NA
WP_086958090.1|1539718_1541440_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_044175595.1|1541636_1542566_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	81.2	4.8e-124
WP_044175596.1|1542921_1543269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044175599.1|1543350_1544292_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_086958091.1|1544571_1545327_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_044175602.1|1545402_1546080_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_044175604.1|1546082_1546283_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_086958093.1|1546283_1548704_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.3	5.8e-76
WP_044175608.1|1548700_1549192_-	FixH family protein	NA	NA	NA	NA	NA
WP_065172042.1|1549287_1550280_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_044175611.1|1550276_1550456_-	cbb3-type cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_005299428.1|1550466_1551078_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_044175613.1|1551089_1552520_-	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_044175615.1|1552805_1553249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958095.1|1553524_1554222_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958097.1|1555055_1556222_+	FIST C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096498181.1|1556226_1558308_+	response regulator	NA	A0A1V0SGX0	Hokovirus	35.2	4.7e-50
WP_086956953.1|1560234_1560932_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175625.1|1561010_1561262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172426116.1|1561434_1562460_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_161946848.1|1562674_1563406_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044175631.1|1563395_1563833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|1564109_1564806_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958103.1|1565017_1565416_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_069530656.1|1565415_1565721_-	DUF3634 family protein	NA	NA	NA	NA	NA
WP_044175637.1|1565875_1566331_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_086958106.1|1566531_1568274_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_044175640.1|1568343_1568859_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_036763867.1|1569052_1569226_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_086958108.1|1569384_1571406_-	DUF3466 family protein	NA	NA	NA	NA	NA
WP_086958110.1|1571405_1573334_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.6	1.1e-48
WP_044175647.1|1573320_1573584_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_086958112.1|1573583_1575722_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_044175652.1|1576497_1577037_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_036763857.1|1577227_1578241_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_086958114.1|1578454_1578679_-	DUF2835 domain-containing protein	NA	NA	NA	NA	NA
WP_086958117.1|1578771_1581396_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_044175660.1|1581696_1582896_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_086958121.1|1582982_1583645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958124.1|1583833_1585843_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	5.8e-90
WP_044175666.1|1585859_1586480_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_036763852.1|1586590_1587049_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_086958126.1|1587136_1588942_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.3e-40
WP_086958129.1|1589051_1590245_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_086958131.1|1590228_1592853_+	MCE family protein	NA	NA	NA	NA	NA
WP_069107416.1|1593950_1594802_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
WP_069107415.1|1594798_1595095_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	47.4	4.8e-17
WP_086958133.1|1596288_1596552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075985093.1|1597904_1598099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125653067.1|1598916_1599492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|1599534_1600231_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	1604329	1665177	3172118	lysis,transposase	Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	50	NA	NA
WP_086958141.1|1604329_1605026_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175682.1|1605632_1607054_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_069107505.1|1607195_1607711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036763782.1|1607884_1608229_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_086958143.1|1608225_1608906_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_044175685.1|1609100_1609988_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_086958145.1|1610020_1610718_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958147.1|1610948_1611833_+	DMT family transporter	NA	NA	NA	NA	NA
WP_086958149.1|1611994_1613170_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_044175692.1|1613276_1613915_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_044175694.1|1614227_1614521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958153.1|1614759_1615188_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_044175696.1|1615359_1615728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075985093.1|1616295_1616490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958156.1|1616498_1617707_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_005299205.1|1620240_1621137_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_086958158.1|1621577_1623266_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_096498182.1|1623508_1624183_+	YdcF family protein	NA	NA	NA	NA	NA
WP_065170498.1|1624664_1626035_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_086956953.1|1626954_1627651_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_096498183.1|1628238_1629525_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	1.9e-46
WP_044175704.1|1629751_1630663_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_044175705.1|1630791_1631514_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_096498184.1|1631626_1631911_-	DUF3802 family protein	NA	NA	NA	NA	NA
WP_086956953.1|1631957_1632654_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_096498185.1|1632974_1634207_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_005299177.1|1634322_1635876_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_096498186.1|1636307_1637005_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|1638102_1638799_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_069107515.1|1639061_1639427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096498187.1|1639423_1640152_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_096498188.1|1640148_1640613_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_086956987.1|1640668_1641368_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_096498189.1|1641704_1642199_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_044175786.1|1642335_1643577_+	MFS transporter	NA	NA	NA	NA	NA
WP_096498190.1|1643566_1644232_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_096498191.1|1644341_1648256_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	30.0	4.1e-55
WP_096498192.1|1648595_1649561_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_096498193.1|1651645_1653349_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_022614736.1|1654464_1654857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145956561.1|1655149_1656070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958141.1|1656156_1656853_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_005299521.1|1658960_1659482_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_086958161.1|1660007_1660910_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_044175782.1|1660950_1661946_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005299529.1|1662183_1662540_-	phasin family protein	NA	NA	NA	NA	NA
WP_086958163.1|1662580_1663219_-	phasin family protein	NA	NA	NA	NA	NA
WP_086958165.1|1663381_1663963_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_065172075.1|1664158_1664359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|1664480_1665177_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	1794333	1903612	3172118	protease,holin,transposase,tRNA	Klosneuvirus(14.29%)	82	NA	NA
WP_086958279.1|1794333_1795965_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	35.1	4.4e-72
WP_044175524.1|1796173_1796440_+	acyl-CoA-binding protein	NA	A0A0M3SGU0	Mollivirus	46.6	3.4e-06
WP_086958281.1|1796571_1798254_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_172426119.1|1798678_1799971_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_036763737.1|1803522_1804002_-	DUF1456 family protein	NA	NA	NA	NA	NA
WP_086958285.1|1804103_1805207_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_086958287.1|1805546_1806044_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.2	3.5e-12
WP_086958289.1|1807136_1807607_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086958291.1|1807662_1808016_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_145956562.1|1808101_1808290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958293.1|1808517_1808985_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_086956953.1|1809071_1809769_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_125653070.1|1810052_1810442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096498197.1|1811218_1812193_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	37.2	1.6e-37
WP_044175519.1|1812305_1814072_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_086958299.1|1814448_1814685_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_086958301.1|1817296_1818217_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005299068.1|1818323_1818977_-	GTP cyclohydrolase I FolE	NA	Q6WI31	Vibrio_phage	55.4	5.7e-55
WP_086958303.1|1819271_1820507_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_075984950.1|1820519_1821278_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	28.3	2.2e-05
WP_044175512.1|1821486_1822695_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_086958305.1|1823045_1823888_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086958307.1|1824279_1825644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075985035.1|1826408_1826603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958309.1|1826611_1827820_+|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_086958311.1|1828089_1829721_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	40.3	4.3e-91
WP_044175506.1|1829823_1831368_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_086958313.1|1831360_1832524_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_086956953.1|1832799_1833496_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958524.1|1835582_1836824_-	amidohydrolase	NA	NA	NA	NA	NA
WP_044175503.1|1836906_1837986_-	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_044175502.1|1837985_1840451_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044175500.1|1840431_1841103_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	9.2e-24
WP_075985035.1|1841971_1842166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958315.1|1842174_1843383_+|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_086958317.1|1843530_1843983_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_086956953.1|1844691_1845388_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958319.1|1845299_1846091_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_086956953.1|1846074_1846772_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175494.1|1846980_1848576_-	ABC-F family ATPase	NA	A0A1V0SGN0	Hokovirus	25.9	1.1e-48
WP_086956953.1|1848812_1849509_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_107208937.1|1849556_1850135_+	fimbrial protein	NA	NA	NA	NA	NA
WP_065171447.1|1850155_1850407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957414.1|1850686_1851384_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_145956563.1|1852541_1854650_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_086958327.1|1854707_1855589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958329.1|1855682_1856380_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_086958334.1|1857280_1859467_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_005299129.1|1860075_1860999_+	agmatinase	NA	NA	NA	NA	NA
WP_086956953.1|1862141_1862839_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_036764014.1|1864833_1865394_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_075984991.1|1865510_1867364_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_005299769.1|1867363_1868008_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_005299771.1|1868749_1869301_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044175797.1|1869303_1871001_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	2.3e-15
WP_086958338.1|1871000_1871843_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_068969545.1|1874254_1875268_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_086956953.1|1875459_1876156_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_172426106.1|1876206_1877061_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_165761729.1|1877130_1877325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044175800.1|1877450_1877699_+	DUF3297 family protein	NA	NA	NA	NA	NA
WP_075985035.1|1880035_1880230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958342.1|1881306_1881501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956947.1|1881509_1882718_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_044175813.1|1883911_1884793_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_044175815.1|1885175_1885343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044175816.1|1885457_1886141_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_086956948.1|1886133_1886991_-	malonyl-ACP O-methyltransferase BioC	NA	A0A1X9I669	Streptococcus_phage	21.1	7.6e-07
WP_086956949.1|1886992_1888186_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_005299815.1|1888169_1889222_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_044175818.1|1889405_1890683_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.1	3.9e-23
WP_044175820.1|1890754_1891321_+	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_086956950.1|1892792_1893489_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_165761730.1|1893538_1894384_+	L-lactate permease	NA	NA	NA	NA	NA
WP_036764032.1|1894565_1895285_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_036764035.1|1895296_1896712_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_086958344.1|1896726_1897476_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_044175825.1|1897701_1898604_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956951.1|1898685_1899900_-	ROK family protein	NA	NA	NA	NA	NA
WP_044175826.1|1900129_1900798_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1B0Z0A9	Vibrio_phage	30.1	1.0e-11
WP_086956952.1|1901021_1902422_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.8	5.1e-85
WP_086956953.1|1902914_1903612_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	2069469	2122841	3172118	transposase	Hokovirus(28.57%)	35	NA	NA
WP_086957018.1|2069469_2070167_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957020.1|2070607_2070880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957021.1|2070833_2071532_+	response regulator	NA	A0A1V0SGX0	Hokovirus	51.8	7.8e-10
WP_086957022.1|2071531_2071996_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_086957023.1|2071988_2073233_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_082212413.1|2073286_2074207_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_044175231.1|2074330_2074768_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_086957024.1|2075150_2077238_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.8	1.8e-65
WP_044175226.1|2077320_2078796_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_086957025.1|2078981_2081900_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	34.5	4.0e-55
WP_086957026.1|2082054_2083128_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_044175219.1|2083244_2083703_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_086958350.1|2084965_2087056_-	DNA helicase IV	NA	A0A1P8CWU5	Bacillus_phage	24.3	3.2e-14
WP_044175214.1|2087396_2089562_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_086957027.1|2089682_2090852_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_086957028.1|2091550_2094193_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	29.4	4.5e-66
WP_086956953.1|2095179_2095876_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957001.1|2097193_2097891_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958694.1|2099017_2099715_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957030.1|2100129_2103048_-	retention module-containing protein	NA	NA	NA	NA	NA
WP_044175208.1|2103284_2103938_+	LysE family translocator	NA	NA	NA	NA	NA
WP_044175206.1|2104409_2105576_+	DUF1887 family protein	NA	NA	NA	NA	NA
WP_086957031.1|2105708_2106476_-	uridine phosphorylase	NA	NA	NA	NA	NA
WP_096498198.1|2106941_2109407_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.5	3.7e-131
WP_086958352.1|2109576_2110050_-	response regulator	NA	NA	NA	NA	NA
WP_086957033.1|2110059_2111388_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|2113024_2113722_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044177110.1|2113942_2114359_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_086957034.1|2114537_2115851_-	DUF945 family protein	NA	NA	NA	NA	NA
WP_086957035.1|2116028_2117978_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_086957036.1|2117974_2118475_+	response regulator	NA	NA	NA	NA	NA
WP_086957037.1|2118635_2119631_+	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	44.1	1.1e-65
WP_044175192.1|2119653_2120586_-	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_005298539.1|2120689_2121280_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_086957038.1|2122144_2122841_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	2160866	2226151	3172118	protease,transposase,tRNA	uncultured_Mediterranean_phage(15.38%)	50	NA	NA
WP_086957053.1|2160866_2162915_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	29.1	5.1e-57
WP_086957054.1|2163268_2164612_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_086956953.1|2164616_2165314_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175125.1|2168119_2169436_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_044175122.1|2169658_2170528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065172628.1|2170576_2171887_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.1	6.5e-90
WP_086958356.1|2172071_2173415_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.6	5.2e-87
WP_086957057.1|2173521_2174133_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_096498199.1|2174265_2177487_-	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	47.8	5.8e-84
WP_005298455.1|2177973_2178468_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_044175111.1|2179931_2180891_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.2	4.3e-59
WP_065172631.1|2181039_2182821_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	31.0	9.9e-17
WP_086957059.1|2182813_2184535_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.8	4.9e-21
WP_086957060.1|2184738_2185452_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_044175103.1|2185455_2186148_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005298441.1|2186347_2186566_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005298439.1|2186698_2188963_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	4.9e-170
WP_036763487.1|2189007_2189328_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.0	6.5e-12
WP_005298437.1|2189585_2189807_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	3.3e-15
WP_044175096.1|2190232_2191486_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	70.4	3.6e-13
WP_096498200.1|2191628_2192276_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_086957062.1|2192552_2193665_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_086958358.1|2193680_2194301_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_086957063.1|2194383_2195751_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.8	6.3e-112
WP_086957064.1|2197525_2198677_+	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
WP_044175082.1|2198754_2199117_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_065172673.1|2202932_2203469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044175071.1|2203879_2204329_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_044175069.1|2204331_2204577_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_005298402.1|2204573_2205053_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_172426122.1|2205126_2206128_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_086956953.1|2206450_2207147_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175065.1|2207224_2207452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958360.1|2207572_2208148_+|protease	Lon protease	protease	NA	NA	NA	NA
WP_086956953.1|2208703_2209401_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175059.1|2209956_2210316_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_086957069.1|2210328_2211768_-	sigma-54-dependent Fis family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	26.0	4.1e-05
WP_068969135.1|2212115_2214143_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_065172651.1|2214338_2214770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957070.1|2215803_2216541_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005298387.1|2216921_2217503_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_044175052.1|2217504_2218083_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_086957071.1|2218085_2220275_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_075984913.1|2220268_2221327_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_044175048.1|2221335_2221968_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_086957072.1|2221970_2222657_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_044175043.1|2222730_2223381_+	endonuclease III	NA	NA	NA	NA	NA
WP_086957073.1|2223547_2224459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957074.1|2224701_2225412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957075.1|2225454_2226151_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	2240890	2305776	3172118	protease,transposase,tRNA	Shigella_phage(33.33%)	46	NA	NA
WP_086957001.1|2240890_2241588_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957079.1|2241630_2242272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957080.1|2242275_2242800_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_086957081.1|2242790_2244863_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.3	2.0e-29
WP_005304755.1|2244977_2245496_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_086957082.1|2247405_2250963_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_086957083.1|2250974_2251463_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_044175024.1|2252278_2253292_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	57.2	9.7e-102
WP_005298347.1|2253368_2253587_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_086957084.1|2253634_2255503_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_086957085.1|2255543_2255804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044175020.1|2256054_2257677_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	3.2e-14
WP_086957087.1|2259566_2260263_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175018.1|2260550_2262458_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.3	3.9e-35
WP_044175015.1|2262457_2262919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957089.1|2263746_2264043_+|transposase	transposase	transposase	Q716C1	Shigella_phage	47.4	1.4e-16
WP_044173665.1|2264039_2264891_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	1.1e-50
WP_086956953.1|2266947_2267644_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|2267984_2268682_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086958366.1|2268708_2272224_-	chitinase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_086957002.1|2272261_2272959_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957092.1|2273014_2273845_-	glucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|2274430_2275128_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044175011.1|2275303_2276398_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_065171081.1|2276397_2277432_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_044175007.1|2277632_2278181_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_086957094.1|2278246_2280259_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_044175002.1|2280519_2282373_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_044175000.1|2282640_2283654_+	asparaginase	NA	NA	NA	NA	NA
WP_044174998.1|2283730_2284015_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_165761736.1|2284217_2285057_+	DUF2989 domain-containing protein	NA	NA	NA	NA	NA
WP_172426123.1|2285133_2286426_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_086957097.1|2287020_2287416_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_044174993.1|2287753_2288749_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_086957098.1|2289072_2289948_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_044174989.1|2291076_2293011_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_086957099.1|2293061_2294333_+	YeaH/YhbH family protein	NA	NA	NA	NA	NA
WP_086957100.1|2294419_2295949_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_036763447.1|2296032_2296884_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_044174983.1|2297480_2299070_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_086958368.1|2299299_2299812_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_044174978.1|2299890_2300514_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_044174977.1|2300695_2301640_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_086956953.1|2302337_2303034_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957101.1|2303813_2304797_+	3',5'-cyclic-nucleotide phosphodiesterase	NA	NA	NA	NA	NA
WP_044174972.1|2304924_2305776_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 21
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	2322037	2396336	3172118	protease,transposase,tRNA	Bacillus_phage(23.08%)	54	NA	NA
WP_069107416.1|2322037_2322889_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
WP_069107415.1|2322885_2323182_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	47.4	4.8e-17
WP_086957110.1|2323277_2323895_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_044174938.1|2323904_2324462_+	rhombosortase	NA	NA	NA	NA	NA
WP_086957111.1|2324548_2324887_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|2324969_2325667_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_044174934.1|2325759_2326047_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086957112.1|2326210_2328118_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005298263.1|2328468_2328741_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.3e-21
WP_086957113.1|2328941_2331305_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.4	9.2e-228
WP_044174926.1|2331521_2332811_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.5	2.1e-133
WP_005298256.1|2332923_2333547_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.7	5.4e-63
WP_086957114.1|2333652_2334951_-	trigger factor	NA	NA	NA	NA	NA
WP_005298253.1|2335798_2336659_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	7.8e-36
WP_044174922.1|2336891_2337794_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.4	3.5e-63
WP_086957116.1|2340265_2341318_-	response regulator	NA	W8CYM9	Bacillus_phage	33.6	1.8e-10
WP_086957117.1|2341640_2342516_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086957118.1|2342866_2344384_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.0	6.8e-83
WP_044174917.1|2344453_2344945_-	CvpA family protein	NA	NA	NA	NA	NA
WP_086957119.1|2345009_2345690_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_086957120.1|2345743_2347012_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_044174908.1|2347154_2348081_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_086957121.1|2348374_2349160_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_165761737.1|2349331_2349784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957124.1|2350364_2354207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957125.1|2354462_2355476_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_044174899.1|2355459_2356644_-	4-phosphoerythronate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.7	3.4e-21
WP_044174896.1|2356646_2357813_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.4	1.0e-115
WP_005298224.1|2358558_2359773_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_086957126.1|2359962_2362098_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_086957127.1|2362219_2363170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|2363224_2363922_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|2364450_2365148_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957128.1|2365641_2367762_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_086957129.1|2367855_2368725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086957130.1|2368816_2369794_-	OmpA family protein	NA	NA	NA	NA	NA
WP_165761738.1|2372333_2373311_+	OmpA family protein	NA	NA	NA	NA	NA
WP_086956953.1|2374436_2375133_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957133.1|2376078_2377134_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_086957134.1|2377147_2378224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044174882.1|2378375_2378648_-	YfcL family protein	NA	NA	NA	NA	NA
WP_044174880.1|2378670_2379222_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_086957135.1|2379567_2380203_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_044174875.1|2381461_2382550_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.0	3.5e-89
WP_044174873.1|2382684_2384589_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_044174871.1|2385019_2385874_-	phospholipase A	NA	NA	NA	NA	NA
WP_165761739.1|2386055_2387255_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_044174867.1|2387431_2388274_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044174865.1|2388270_2389077_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005298143.1|2389097_2389406_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_086957136.1|2389576_2392699_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_044174859.1|2392698_2393808_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_086957137.1|2395056_2395584_+	response regulator	NA	NA	NA	NA	NA
WP_086956953.1|2395639_2396336_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_AP018045	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 1	3172118	2818158	2869259	3172118	protease,transposase	uncultured_Mediterranean_phage(20.0%)	49	NA	NA
WP_044174296.1|2818158_2818662_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.7	3.3e-26
WP_005303729.1|2818663_2819302_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_086957283.1|2819387_2820125_-	cytochrome c1	NA	NA	NA	NA	NA
WP_086957284.1|2820121_2821387_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_086957285.1|2821386_2821980_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_005303719.1|2822394_2822787_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_005303716.1|2822802_2823231_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_086957286.1|2823499_2824603_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_086956953.1|2824892_2825590_-|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_086957287.1|2825627_2826008_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_172426128.1|2826121_2827489_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.9	2.5e-07
WP_086957288.1|2827636_2828752_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	29.3	2.4e-13
WP_172426129.1|2828837_2830130_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_044174284.1|2830747_2832004_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005303697.1|2832014_2832269_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_036764771.1|2832288_2832600_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_065170841.1|2832602_2833238_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_036764769.1|2833247_2833727_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_044174280.1|2833752_2834535_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_044174277.1|2834563_2835376_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.6	4.7e-22
WP_044174275.1|2835818_2836784_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_086957290.1|2836800_2837769_+	KpsF/GutQ family sugar-phosphate isomerase	NA	E3T535	Cafeteria_roenbergensis_virus	27.2	1.4e-17
WP_044174272.1|2837768_2838326_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	61.9	1.0e-44
WP_044174270.1|2838322_2838886_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_036764766.1|2838866_2839373_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_005303670.1|2839382_2840108_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	2.4e-22
WP_044174268.1|2840179_2841643_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_036764763.1|2841679_2841967_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_044174264.1|2841969_2842419_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_086957291.1|2842455_2843307_+	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	33.3	1.2e-07
WP_086957292.1|2843303_2843576_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_044174260.1|2843836_2845195_+	magnesium transporter	NA	NA	NA	NA	NA
WP_044174258.1|2845290_2846634_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_044174256.1|2846745_2847270_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_005303649.1|2847368_2848817_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_086957293.1|2849673_2853558_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_044174252.1|2853571_2855041_-	ribonuclease G	NA	NA	NA	NA	NA
WP_044174250.1|2855049_2855631_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_172426130.1|2855683_2856976_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_044174248.1|2857590_2858079_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_005303632.1|2858068_2859031_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005303629.1|2859072_2860116_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.0	7.1e-07
WP_125653053.1|2860474_2862184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|2862341_2863038_+|transposase	IS1-like element ISPda1 family transposase	transposase	NA	NA	NA	NA
WP_065170864.1|2863075_2863711_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_172426131.1|2863707_2865117_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_086957297.1|2865332_2867273_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_086958401.1|2867589_2868090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069107416.1|2868407_2869259_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
>prophage 1
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	3858	71811	1054589	transposase,integrase	Escherichia_phage(56.25%)	56	31319:31378	71775:72554
WP_086959225.1|3858_4556_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	1.0e-65
WP_044178045.1|5310_7683_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_086959223.1|7773_8471_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	9.1e-67
WP_044178048.1|8546_9176_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_086959221.1|9193_9808_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_086957554.1|9921_11130_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985035.1|11138_11333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075985093.1|12232_12427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959219.1|12435_13644_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_086959217.1|15367_15766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075985093.1|19838_20033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959212.1|20041_21250_+|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|21320_22018_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959210.1|22138_23230_-	choloylglycine hydrolase family protein	NA	A0A1J0F9I3	Only_Syngen_Nebraska_virus	28.1	2.6e-28
WP_096498215.1|23652_24350_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	3.1e-67
WP_075985035.1|25058_25253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044177810.1|27835_29140_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_044177806.1|29711_31040_+	membrane protein	NA	NA	NA	NA	NA
31319:31378	attL	GGTGGTGACTCCAATTGATTTATTAATGGTAAAATTCACGTTCTATAAACGTTCCAATAA	NA	NA	NA	NA
WP_086956953.1|31340_32038_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959205.1|33008_33705_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	5.3e-67
WP_069107745.1|33781_34672_-	DMT family transporter	NA	NA	NA	NA	NA
WP_044177803.1|34863_35409_-	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_086959203.1|35531_35924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075985093.1|36277_36472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145956565.1|36480_36711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096498216.1|36618_36900_-	hypothetical protein	NA	Q71TE9	Escherichia_phage	40.6	9.1e-10
WP_086959200.1|37337_38546_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985035.1|38554_38749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959197.1|39016_39406_+	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_086959195.1|39406_40528_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_065171186.1|40630_41164_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_086959193.1|41514_42435_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_086959192.1|42523_43294_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|43298_43996_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_005307051.1|47244_47439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044173675.1|48442_49099_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	42.8	2.1e-25
WP_086959190.1|49181_49637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044177745.1|49817_50507_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_086959188.1|50923_52123_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985156.1|52131_52326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044177743.1|52335_52932_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	29.6	8.2e-08
WP_086959186.1|53829_54999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044177737.1|55108_56353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069107415.1|56891_57188_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069107416.1|57184_58036_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
WP_086959182.1|58054_58729_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_086959180.1|59049_59826_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_086959178.1|59828_63125_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	2.1e-57
WP_069107758.1|63205_64468_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	32.0	7.0e-17
WP_086959176.1|64457_65975_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.5	2.1e-84
WP_044177724.1|66015_66642_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_086959174.1|66804_68172_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_086959172.1|68164_69229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125653095.1|69195_70101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959170.1|70112_71072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|71114_71811_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
71775:72554	attR	TTATTGGAACGTTTATAGAACGTGAATTTTACCATTAATAAATCAATTGGAGTCACCACCAAACTACTGATGGAACTCAGTATTTAGAGTGGGTTGTAAGTGAACACGCATATCGTGCTGTTAAACTAATTGGCAAGATGAACGCTATTTATCGTTATCGCGCCCAAGAATTGGTGCGTCATCACGCTAGTTCATTGCCTAAAAATCGGGTTCAAGATCTTCAATTTGGAATAAAAGATAATAAGTTGTTTCGAGTTAAGCATACAAGACAATCTGTGTGGTTCAGCAATCAAGCTAAAGCAACTAAGAACGGATTTAATAATATAAATACGTTGTTTAACATCCCCGTGGAGGAAGCTGATATTGAACAGTTAGAGGCTCTAGGATGTAATGTTCAATCTATTTCTGCGAGTAGTCCGAAATTTCGCTTACCTTATCAAGTCGGCATTCCTTTTAACTTTACTTCACATCAATTTAGACACACGTTTGCTTGGTTCATTGTTGCCAACCGCTTAGGCGATCTTGATGACATTAAATACAATTTCAAGCACTTAGAAAACAGTATGACGCTAGTTTATAGTCATCGCGGCTATGACACTATGGCTGAATTGGTGCGTTTAACCGAAAGCTTTGAGGCTTATCTAATCGAACAAGCTATGACTGATATGGTGAGTGCAGCAGAGCAAGGTCACTTAGCTGGTAGAGGTGGTGAGAAGTTTGTCGAAAGGCTGAAACTGGTTCTCGGAGATGACTTTGAAAGTGGCTCTTCCCCCCATTTCG	NA	NA	NA	NA
>prophage 2
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	80082	133732	1054589	transposase,tRNA	Escherichia_phage(62.5%)	47	NA	NA
WP_086956953.1|80082_80780_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_165761807.1|81703_82369_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_086959157.1|82571_83765_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_086959155.1|84275_84972_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044179805.1|86787_87423_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_153274604.1|87528_87675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005304109.1|88076_88286_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	69.4	8.8e-18
WP_086956953.1|89172_89870_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959151.1|89879_90203_+	DUF3157 family protein	NA	NA	NA	NA	NA
WP_065170589.1|90319_91045_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	2.9e-31
WP_086959149.1|91174_92620_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_086959146.1|92631_93885_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086959143.1|93891_95298_-	YfcC family protein	NA	NA	NA	NA	NA
WP_086959141.1|95368_96478_-	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_044179585.1|96680_97613_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956953.1|97738_98435_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_069107668.1|98629_99508_+	6-carboxytetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	28.3	9.8e-18
WP_086956953.1|100869_101566_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_075985093.1|101952_102147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082212505.1|103479_104103_+	LysE family transporter	NA	NA	NA	NA	NA
WP_086956953.1|104262_104959_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959133.1|104996_105758_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086959131.1|106070_106799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959129.1|106888_108442_-	sulfatase	NA	NA	NA	NA	NA
WP_044179595.1|108859_109636_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044179597.1|109685_110966_+	tagatose-bisphosphate aldolase subunit KbaZ	NA	NA	NA	NA	NA
WP_086959127.1|110976_112149_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_044179601.1|112167_112668_+	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_005306168.1|112702_113467_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_044179603.1|113456_114350_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_044179605.1|114410_114854_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_044179607.1|114855_116010_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_086959125.1|116042_116873_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_086959124.1|116972_117731_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	NA	NA	NA	NA
WP_086959122.1|117748_118792_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_086956953.1|118903_119601_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959374.1|120136_122053_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.9	2.7e-12
WP_086959120.1|122187_123699_+	GNAT family N-acetyltransferase	NA	M1HUK8	Acanthocystis_turfacea_Chlorella_virus	27.9	2.3e-06
WP_005304207.1|123749_124412_-	deoxynucleoside kinase	NA	H9YAI7	Vibrio_phage	40.6	6.0e-36
WP_086956953.1|125561_126258_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959118.1|126914_128006_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_044179623.1|128028_128685_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_044179625.1|128907_129363_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956953.1|130062_130760_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_096498218.1|130797_131841_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_086956953.1|132235_132932_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_005304224.1|133132_133732_+|tRNA	tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY	tRNA	NA	NA	NA	NA
>prophage 3
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	145839	200679	1054589	transposase	Escherichia_phage(69.23%)	55	NA	NA
WP_086956953.1|145839_146536_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959102.1|146554_147082_-	Fic family protein	NA	NA	NA	NA	NA
WP_086959100.1|147069_147767_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044179648.1|148032_148383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044179650.1|148453_148960_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_086959097.1|149115_149517_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_005304256.1|149587_150121_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_086959095.1|150243_150708_-	exoribonuclease R	NA	NA	NA	NA	NA
WP_165761804.1|150947_153320_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_086959093.1|153684_154203_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_075985093.1|154560_154755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959091.1|154763_155972_+|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_086959089.1|156493_157191_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959086.1|159299_160499_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|160507_160702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036765435.1|161272_161572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959084.1|161797_162859_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_044179679.1|163491_163803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044178008.1|165389_165776_+	VOC family protein	NA	NA	NA	NA	NA
WP_044178011.1|165839_166184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|166313_167011_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_065170891.1|167156_167729_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_086956953.1|168206_168903_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044179498.1|169202_170246_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	54.1	3.2e-100
WP_086956953.1|170888_171585_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959081.1|171732_172941_-|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|172949_173144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959370.1|173402_173765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959080.1|173814_174825_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_044179502.1|174985_175345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959077.1|175337_176561_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_086959075.1|176820_177141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044179506.1|177288_177606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005305806.1|177663_177843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044179508.1|177967_179218_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_086959072.1|179725_181435_-	protein BatD	NA	NA	NA	NA	NA
WP_086959070.1|183764_184730_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_044179514.1|184736_185219_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_044179516.1|185215_186163_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_044179788.1|186159_187116_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_086959068.1|187277_187974_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	2.0e-66
WP_086959065.1|187958_188333_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_044179519.1|188345_188756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165761803.1|188807_188972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069107497.1|189602_190895_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.5e-30
WP_005305780.1|191029_191329_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_086959063.1|191444_193364_-	RecQ family ATP-dependent DNA helicase	NA	A0A2K9L3P7	Tupanvirus	36.8	6.8e-56
WP_069107741.1|193554_194040_-	CreA family protein	NA	A0A2I7SAK3	Vibrio_phage	37.8	3.4e-20
WP_036765788.1|194246_194582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044177842.1|195473_196496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959061.1|196492_196807_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_086959059.1|196905_197454_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086956953.1|198250_198948_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959057.1|198974_199508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|199982_200679_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
>prophage 4
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	211551	269282	1054589	transposase	Escherichia_phage(55.0%)	53	NA	NA
WP_086956953.1|211551_212248_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_068968726.1|212294_212711_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_044178211.1|212774_213347_-	porin family protein	NA	NA	NA	NA	NA
WP_044178687.1|213436_214015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959050.1|214342_216220_+	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_086959048.1|216216_216966_+	3'-5' exonuclease	NA	A0A0A8WJ41	Clostridium_phage	27.6	4.5e-11
WP_086959046.1|217154_218819_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.9	7.1e-25
WP_075985080.1|219021_220068_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.6	6.7e-82
WP_044178227.1|220146_221199_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_044178230.1|221297_222458_+	galactokinase	NA	NA	NA	NA	NA
WP_044178232.1|222467_223532_+	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_154097833.1|223642_223801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959044.1|224158_225157_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.5	1.6e-19
WP_044178238.1|225462_226011_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_044178241.1|226020_226248_+	helix-turn-helix transcriptional regulator	NA	A0A2K9V490	Faecalibacterium_phage	41.4	7.6e-07
WP_086959042.1|226350_227049_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_086956953.1|227258_227956_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044178256.1|228050_229400_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_086959040.1|233395_234652_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_086959038.1|234722_235847_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_044178265.1|235959_236352_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|236632_237329_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086956953.1|237912_238609_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_125653094.1|238520_238907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069107596.1|238969_239563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959035.1|239782_241120_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_125653093.1|241360_241930_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_044178280.1|241988_243092_-	GGDEF domain-containing protein	NA	A0A249XXD1	Clostridium_phage	33.3	2.4e-05
WP_086959031.1|243418_245557_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.3	1.2e-266
WP_044178274.1|245649_246126_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	61.4	1.4e-50
WP_086959029.1|246218_248807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|248815_249513_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959028.1|249543_249801_+	DUF2960 family protein	NA	NA	NA	NA	NA
WP_044178293.1|249846_250194_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_086959026.1|250227_251136_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_005304393.1|251432_251786_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_044178299.1|251852_252608_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_086959016.1|252789_253486_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959024.1|253397_254414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|254531_255228_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_075985160.1|255552_256113_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.1	3.2e-14
WP_086959022.1|256196_256712_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_086959368.1|256715_258770_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_086959020.1|259405_261388_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036765470.1|261371_262400_-	glutathione synthase	NA	NA	NA	NA	NA
WP_086959018.1|262519_262870_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_044178311.1|263061_263931_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_165761801.1|264144_264315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075985162.1|264632_264830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959016.1|264856_265553_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959016.1|265584_266281_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086956953.1|266312_267009_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086956953.1|268584_269282_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
>prophage 5
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	281492	339320	1054589	transposase,integrase	Escherichia_phage(44.44%)	44	281668:281682	312011:312025
WP_086957566.1|281492_283094_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
281668:281682	attL	TAAGCAGGAAGACTA	NA	NA	NA	NA
WP_086957567.1|283102_285526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107208894.1|285536_287759_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J185	uncultured_Caudovirales_phage	25.1	3.7e-05
WP_086957569.1|287761_288313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957570.1|288365_288743_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	66.0	9.0e-29
WP_086959009.1|288957_289260_-	autonomous glycyl radical cofactor GrcA	NA	A0A0G2SSP2	Proteus_phage	47.9	1.3e-17
WP_086956953.1|290991_291689_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_075985035.1|291985_292180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096498219.1|292188_293397_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_086959005.1|294056_295352_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_068968896.1|295663_296338_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_086959003.1|296792_299138_+	chitinase	NA	A0A097P8Z3	Sucra_jujuba_nucleopolyhedrovirus	27.6	6.9e-26
WP_086959001.1|299659_300223_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_172426110.1|300824_302117_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.1e-30
WP_086958999.1|302178_302517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958997.1|302557_303514_-	ribokinase	NA	NA	NA	NA	NA
WP_086956969.1|303805_304502_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	1.2e-66
WP_086958994.1|304413_305700_-	cytosine permease	NA	NA	NA	NA	NA
WP_086958992.1|305712_306747_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	26.5	3.6e-11
WP_086958991.1|306895_307633_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956953.1|309615_310312_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958987.1|310719_312582_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	29.4	2.7e-65
312011:312025	attR	TAGTCTTCCTGCTTA	NA	NA	NA	NA
WP_065171387.1|312649_314116_+	DUF4118 domain-containing protein	NA	W8CYF6	Bacillus_phage	32.3	2.5e-21
WP_086958985.1|314108_314804_+	response regulator	NA	NA	NA	NA	NA
WP_086958983.1|314911_315190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096498221.1|315231_315468_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_086956953.1|315378_316076_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044178352.1|316471_316861_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_065171392.1|316962_317724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167792589.1|318946_320440_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_086958979.1|320514_321528_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_172426110.1|322139_323432_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.1e-30
WP_125653092.1|324840_325890_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_086958971.1|327766_328288_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_096498222.1|328485_329182_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	1.2e-66
WP_086958967.1|329403_331110_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	36.8	4.3e-86
WP_172426144.1|331184_331364_+	ATPase	NA	NA	NA	NA	NA
WP_044178450.1|331466_332408_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_086956969.1|333219_333917_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	1.2e-66
WP_086958965.1|334001_334646_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_086958963.1|334871_336023_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_165761799.1|336092_336371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|336464_337161_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958690.1|338623_339320_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	7.0e-67
>prophage 6
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	358035	428645	1054589	transposase,protease	Escherichia_phage(38.89%)	53	NA	NA
WP_086956953.1|358035_358733_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_165761816.1|359040_359931_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_044179758.1|360002_360818_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044179759.1|360942_361785_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_165761815.1|361795_362515_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	2.9e-31
WP_086956953.1|362831_363529_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_165761797.1|364903_365077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|365481_366178_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958949.1|366245_366602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958947.1|366579_367158_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_068969416.1|367169_367490_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_005305171.1|367576_367756_+	DUF2986 domain-containing protein	NA	NA	NA	NA	NA
WP_086958945.1|368231_369437_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985093.1|369445_369640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044179916.1|374881_375775_-	aspartoacylase	NA	NA	NA	NA	NA
WP_036765673.1|375870_376314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068969410.1|376464_377130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958941.1|377367_377889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044179922.1|377893_378949_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_086956953.1|379197_379894_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958937.1|380181_380865_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_044180079.1|381363_382827_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	26.8	1.7e-46
WP_044180076.1|383196_383598_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_086958934.1|383734_384649_-	DnaJ domain-containing protein	NA	A0A1V0SBY2	Catovirus	55.8	1.3e-17
WP_086958932.1|384783_386679_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.7	2.6e-148
WP_005305122.1|386819_387242_-	Hsp20 family protein	NA	A0A2H4N7P1	Lake_Baikal_phage	35.0	2.0e-16
WP_044180070.1|387760_388996_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_086958928.1|392951_393752_-	DUF2076 family protein	NA	NA	NA	NA	NA
WP_086958926.1|394222_395080_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|395930_396628_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959361.1|396696_397863_-	MFS transporter	NA	NA	NA	NA	NA
WP_065171846.1|398433_399003_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_086958924.1|399089_400412_-	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	23.4	9.6e-09
WP_044180038.1|400748_401438_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_107208910.1|401437_402517_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	31.3	6.9e-21
WP_086956953.1|404124_404822_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044180032.1|405453_406164_-	DUF4336 domain-containing protein	NA	NA	NA	NA	NA
WP_086958922.1|406182_408891_-	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
WP_044180027.1|409313_411776_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	47.1	2.3e-16
WP_086958920.1|411893_414074_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_086958918.1|414128_416276_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_044180017.1|417203_418850_-	ABC-ATPase domain-containing protein	NA	NA	NA	NA	NA
WP_086958914.1|419028_420357_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_086958912.1|420346_421006_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	2.4e-32
WP_036766011.1|421002_421356_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_044180009.1|421583_421817_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_086958910.1|421966_422371_+	recombinase family protein	NA	NA	NA	NA	NA
WP_172426145.1|422407_422842_+	recombinase family protein	NA	A0A1X9I6J1	Streptococcus_phage	29.6	3.5e-08
WP_125653090.1|422890_423379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044180003.1|423541_424213_-	recombinase family protein	NA	A0A2I7REZ1	Vibrio_phage	48.4	1.0e-46
WP_086958904.1|425867_426560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044179997.1|426816_427197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|427948_428645_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
>prophage 7
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	432239	536728	1054589	transposase,tRNA,integrase	Escherichia_phage(33.33%)	97	439167:439226	535971:536752
WP_086958862.1|432239_433448_-|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_086959359.1|433456_433651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958862.1|434064_435273_-|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_086959359.1|435281_435476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958894.1|435889_437098_-|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_075985035.1|437106_437301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958892.1|437841_439185_-	site-specific DNA-methyltransferase	NA	A0A222ZMD5	Mycobacterium_phage	38.2	2.2e-48
439167:439226	attL	TTTGTAAAGGTAGACTTATATTGGAGACCTGTTTAGAGGTATGATTTCATACAAATAAAG	NA	NA	NA	NA
WP_069107415.1|439234_439531_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
439167:439226	attL	TTTGTAAAGGTAGACTTATATTGGAGACCTGTTTAGAGGTATGATTTCATACAAATAAAG	NA	NA	NA	NA
WP_069107416.1|439527_440379_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
WP_044179973.1|440640_440919_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_086958890.1|441161_441599_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086959357.1|441808_442003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958884.1|445112_446192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958882.1|447246_448362_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_044179938.1|448382_449141_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.5	2.9e-10
WP_086958881.1|449395_449752_-	YibL family ribosome-associated protein	NA	NA	NA	NA	NA
WP_044179935.1|449867_450203_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_086958879.1|450361_451381_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_044179912.1|452464_452791_-	cytochrome c	NA	NA	NA	NA	NA
WP_044179910.1|452941_453439_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_086958874.1|453433_453952_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_086959355.1|454118_455171_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_086959353.1|455282_456212_-	alpha/beta hydrolase	NA	A0A2K9VI81	Mycobacterium_phage	25.9	2.7e-05
WP_005304975.1|456486_457503_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.8	1.3e-82
WP_086958872.1|457724_459071_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.0	1.1e-41
WP_086958813.1|459270_459968_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	1.3e-65
WP_086959351.1|460073_461384_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005304970.1|461457_462000_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_086958870.1|462281_462689_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	42.9	2.4e-19
WP_086959349.1|462704_463997_+	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	39.9	4.3e-78
WP_086956953.1|464839_465536_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958868.1|465983_466463_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_069107416.1|467058_467910_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
WP_086957089.1|467906_468203_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_044179890.1|468444_468858_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_086956953.1|469610_470307_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_036765606.1|470808_471132_-	YdbL family protein	NA	NA	NA	NA	NA
WP_044180089.1|471149_471359_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_086958866.1|471440_473384_-	YdbH domain-containing protein	NA	NA	NA	NA	NA
WP_125653089.1|474148_474352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959347.1|474846_475041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958862.1|475049_476258_+|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_125653088.1|476405_477170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036765605.1|477584_477914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958860.1|478276_480976_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036765604.1|481097_481607_-	membrane protein	NA	NA	NA	NA	NA
WP_086958858.1|482051_482639_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_044179876.1|482815_483370_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_086958856.1|483573_484566_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_086958854.1|484658_485606_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075985191.1|485825_486020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958852.1|486028_487237_+|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_065171044.1|487724_488081_+	DUF3319 domain-containing protein	NA	NA	NA	NA	NA
WP_069107415.1|488674_488971_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069107416.1|488967_489819_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
WP_069107729.1|490389_490701_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
488607:489852	attR	TTTGTAAAGGTAGACTTATATTGGAGACCTGTTTAGAGGTATGATTTCATACAAATAAAGAGGTTTACATGCCAAGAAGAATTACACCTGAGTTTAAACGTGAGTGTGCTGAACTAGTCATCACTCTTGGCTACAGTCACAAAGATGCTGCCGCAGCAATGAACGTTGGTTTATCGTCGATTCAACGCTGGGTAACACAATATCAGCAAGAACTATCTGGAATTACGCCTAAGGCCACAGCTTTGACTCCTGATCAACTCAGAATTCAAGAATTAGAAAAGCAGCTCAAACAACTTCAAAGTGACAATGAACTGTTAAAAAAAGCTTCGGCCTTCTTCGCAATCGAAATGAACAAAAACAGATAGTTGCGGTAAAACTAAAGAAGATAGGCTACCCAGTCACACAGATTTGCCGTTGTTTAACACTTTCTGCCAGCTCGTATTATCATCGTTTGCAGCCTAAAGCCATCAATACGGAAATAGTGCGGTTAAAAGCTGTAATGCATCAAATTCATAACGAAATGGATGCAACCTATGGTAAGCGTCGGATGTTATCTGAATTAAAGGATATGGGATTCACCGTTGGCCTCGAAAAGGTTCGACGTTGGATGAAGAAACTTAACTTAGTGGCGAAACGTCCGAAGCTACATCGATATCCATCTGGTGGTTTAGCGTCAGTTATCGCGCCTAATAAACTTAATCGCCAATTTAACCCTGAGCAACTCAACACGTATTGGTCGGGTGATATAACCTATATTCGAACGCAACAAGGTTGGTTATATCTCGCTATCATCATGGATTTATGCTCTCGTCGTGTAATTAGTTGGGCGTTCTCTGATAAACCAAACAGCGAGCTAACTACTCGAGCATTACGACTGGCGGTACAAAAACGAAGAGCTTGTCGTAATGTGGTTTTTCACTCCGATCAAGGGTGTCAGTACACGAGTGCGGTTTATCAAAGCTCACTAAAAGAGTTTGGTGTTGAATCTAGTATGAGCCGCGCTGGCAACTGTTTGGATAACGCAGTGACAGAGCGATTTTTTAGAAGTCTCAAGTCAGAACGAGTTAATTACCGTCGTTATGAGACAAGAAGCCAAGCTATTGCAGACATAATCGACTATATCGAGCCGTTTTATAATCAGAAAAGAAAACACCAGAAGTTGGGCAATATCTCCCCAGTACAATATGAGATGAATTTACTGAAAAGTGCCTAAAACAGTCTCCAAATTTAGTTGACCATTACAGTT	NA	NA	NA	NA
WP_086958848.1|490816_491203_+	hypothetical protein	NA	NA	NA	NA	NA
488607:489852	attR	TTTGTAAAGGTAGACTTATATTGGAGACCTGTTTAGAGGTATGATTTCATACAAATAAAGAGGTTTACATGCCAAGAAGAATTACACCTGAGTTTAAACGTGAGTGTGCTGAACTAGTCATCACTCTTGGCTACAGTCACAAAGATGCTGCCGCAGCAATGAACGTTGGTTTATCGTCGATTCAACGCTGGGTAACACAATATCAGCAAGAACTATCTGGAATTACGCCTAAGGCCACAGCTTTGACTCCTGATCAACTCAGAATTCAAGAATTAGAAAAGCAGCTCAAACAACTTCAAAGTGACAATGAACTGTTAAAAAAAGCTTCGGCCTTCTTCGCAATCGAAATGAACAAAAACAGATAGTTGCGGTAAAACTAAAGAAGATAGGCTACCCAGTCACACAGATTTGCCGTTGTTTAACACTTTCTGCCAGCTCGTATTATCATCGTTTGCAGCCTAAAGCCATCAATACGGAAATAGTGCGGTTAAAAGCTGTAATGCATCAAATTCATAACGAAATGGATGCAACCTATGGTAAGCGTCGGATGTTATCTGAATTAAAGGATATGGGATTCACCGTTGGCCTCGAAAAGGTTCGACGTTGGATGAAGAAACTTAACTTAGTGGCGAAACGTCCGAAGCTACATCGATATCCATCTGGTGGTTTAGCGTCAGTTATCGCGCCTAATAAACTTAATCGCCAATTTAACCCTGAGCAACTCAACACGTATTGGTCGGGTGATATAACCTATATTCGAACGCAACAAGGTTGGTTATATCTCGCTATCATCATGGATTTATGCTCTCGTCGTGTAATTAGTTGGGCGTTCTCTGATAAACCAAACAGCGAGCTAACTACTCGAGCATTACGACTGGCGGTACAAAAACGAAGAGCTTGTCGTAATGTGGTTTTTCACTCCGATCAAGGGTGTCAGTACACGAGTGCGGTTTATCAAAGCTCACTAAAAGAGTTTGGTGTTGAATCTAGTATGAGCCGCGCTGGCAACTGTTTGGATAACGCAGTGACAGAGCGATTTTTTAGAAGTCTCAAGTCAGAACGAGTTAATTACCGTCGTTATGAGACAAGAAGCCAAGCTATTGCAGACATAATCGACTATATCGAGCCGTTTTATAATCAGAAAAGAAAACACCAGAAGTTGGGCAATATCTCCCCAGTACAATATGAGATGAATTTACTGAAAAGTGCCTAAAACAGTCTCCAAATTTAGTTGACCATTACAGTT	NA	NA	NA	NA
WP_086958846.1|491199_491897_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	1.2e-66
WP_044180121.1|492371_493553_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_086958843.1|493719_493929_+	DUF3081 family protein	NA	NA	NA	NA	NA
WP_086956953.1|493971_494668_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_125653087.1|494937_495552_-	MliC family protein	NA	NA	NA	NA	NA
WP_125653086.1|495734_495959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958837.1|495869_496567_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	4.1e-67
WP_086958835.1|496576_496888_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_086958833.1|496884_497226_-	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_086958831.1|498076_499780_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	29.1	3.9e-47
WP_086958829.1|499769_501071_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_069107497.1|501389_502682_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.5e-30
WP_086958825.1|505901_506168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172426125.1|506739_508032_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.9e-30
WP_086957089.1|508860_509157_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145956566.1|509153_510005_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.1	5.5e-50
WP_086958823.1|511344_512523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958821.1|512690_513188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958819.1|513180_515763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958817.1|515763_517413_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_086958815.1|517396_518929_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_086958813.1|520492_521190_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	1.3e-65
WP_086958811.1|521236_522112_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	35.7	3.1e-11
WP_165761793.1|522269_522482_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_086959345.1|522538_523780_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_086958807.1|524258_525143_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	28.9	1.1e-29
WP_086956953.1|525460_526157_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958806.1|526162_527065_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	41.4	7.3e-08
WP_044178544.1|527289_528216_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.0	3.7e-15
WP_005304906.1|528314_529424_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_086958804.1|529697_530036_+	AraC family ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|530224_530921_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958800.1|531230_531674_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_086958798.1|531848_532757_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069107719.1|532777_533182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044173484.1|533267_533798_-	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_086958794.1|534016_534853_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	46.3	2.4e-58
WP_044173481.1|534933_535452_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2H4P7V9	Pseudomonas_phage	35.2	3.0e-06
WP_005304893.1|535680_535830_-	YoaH family protein	NA	NA	NA	NA	NA
WP_086956953.1|536031_536728_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
535971:536752	attR	AGGTAGTGACCCCAATTGATTTATTTAGTATATAATCATCCTTTTTAAGGATGGATTATTCATGGCTACTATTGATGTGAAATGTCGTTTTTGTAATCAAGCGGAGCAAGTCCGCAAATATGGGACTAATCCACGAGGAGCTCAGCGATATCGCTGCTTTGATTGCAATCGAACATTTCTTCTTGATTACGCTTATGAAGCTTGTAAACCTGGCGTTAAGGAAAAGATTGTTGATATGGCGATGAATAGTTCAGGAGTAAGAGAGACGGGTCGAGTTTTGAAAGTCGGCTATAATACAGTACTACGCACTTTAAAAAACTCACACCGAAGCAAGTAACAACAATTCCCTTTGATATAGCCCACATTGAACTGATATGTGAAGTTGATGAGCAATGGTCGTTTGTCGGTAAAAAAAAGAATCAGCGCTGGTTATGGTATGCGTGGGAACCTAGATATAAGCGAGTCATTGCTCATGTATTTGGGAAACGGGACTCAGAAACATTCCATAAACTCCAACGTCTTCTTTTGCCGTTTACTATTCCTATTTATTGCACAGATGATTTTAAGGTGTATTCAAGCTATTTACCAAGAGAAAATCACATCATAGGTAAGCGATACACGCAACGAATTGAAAGAACAAATTTAACATTACGATCTCGACTAAAAAGATTAGTAAGAAAAACCATTGGTTTTTCGAAAAGCGAAGAGATGCACGATAAGGTTATTGGAACGTTTATAGAACGTGAATTTTACCATTAATAAATCAATTGGAGTCACCACCC	NA	NA	NA	NA
>prophage 8
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	560025	620874	1054589	transposase	Escherichia_phage(56.52%)	57	NA	NA
WP_086956953.1|560025_560723_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_145955745.1|561134_561428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069107416.1|561527_562379_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
WP_069107415.1|562375_562672_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_086958783.1|562704_563013_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|564377_565074_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959343.1|565361_565733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958781.1|565737_566046_-	monooxygenase	NA	NA	NA	NA	NA
WP_044180138.1|566155_567046_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044180136.1|567132_567651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|567779_568476_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958779.1|568528_569035_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_096498238.1|569109_569568_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_005304727.1|569680_570493_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_086958775.1|570627_571314_+	site-specific DNA-methyltransferase	NA	A0A2I7R760	Vibrio_phage	33.0	2.5e-24
WP_086958773.1|571302_571932_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	34.4	6.8e-13
WP_044180125.1|572000_573350_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005304722.1|573493_574072_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A088C537	Shewanella_sp._phage	42.7	1.8e-36
WP_086958771.1|574428_575172_+	glycerophosphoryl diester phosphodiesterase	NA	Q89384	Paramecium_bursaria_Chlorella_virus	26.8	4.0e-20
WP_086958769.1|575671_576369_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	50.4	4.7e-63
WP_086958767.1|576433_577567_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	33.1	2.0e-26
WP_086956953.1|578001_578699_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_036765723.1|579227_579407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165761792.1|580036_581281_+	maltoporin LamB	NA	NA	NA	NA	NA
WP_086958765.1|581383_582199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|582425_583123_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044178512.1|585197_586697_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_086958763.1|586791_587505_+	ribonuclease T	NA	NA	NA	NA	NA
WP_086956953.1|589194_589891_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086956953.1|592800_593497_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_069107497.1|594283_595576_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.5e-30
WP_086958758.1|596276_597794_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044178495.1|597783_599001_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_036765724.1|599515_599776_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_086958757.1|599928_601068_+	amidohydrolase	NA	NA	NA	NA	NA
WP_165761791.1|601146_602532_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_086958753.1|602612_603041_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082212524.1|603260_604121_+	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_086956953.1|604529_605227_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044179752.1|605868_606324_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_065171885.1|606528_606789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082212514.1|606778_607291_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044179748.1|607429_607834_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|607961_608659_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_069107497.1|609095_610388_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.5e-30
WP_044179746.1|610710_610917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|611588_612286_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958749.1|612835_613843_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_086956953.1|614255_614952_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_036765555.1|615086_615377_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_086958748.1|615439_616342_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_086958747.1|616488_617376_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068969439.1|617378_618074_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.7	5.4e-11
WP_044179738.1|618098_618419_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	35.6	9.7e-08
WP_082212497.1|618431_618806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044179736.1|618985_619882_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_086957066.1|620177_620874_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	2.0e-66
>prophage 9
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	642447	696513	1054589	transposase	Escherichia_phage(76.47%)	41	NA	NA
WP_086957821.1|642447_643144_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	1.3e-65
WP_044178387.1|644523_644883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|649052_649750_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958723.1|649792_649969_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_044178382.1|650335_650704_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|651053_651750_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044178002.1|652519_652915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036765712.1|653122_653374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|653659_654356_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044177994.1|655335_656253_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_086956987.1|656777_657478_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044177989.1|658565_658820_+	membrane protein	NA	NA	NA	NA	NA
WP_086958718.1|658875_659085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958716.1|659115_660369_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_086958694.1|660352_661050_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	7.7e-66
WP_044177983.1|661572_662484_-	ROK family protein	NA	NA	NA	NA	NA
WP_065171428.1|662758_663862_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_044178629.1|663910_664474_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_086958714.1|664476_666120_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_086958712.1|666156_667503_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_086958711.1|667834_668695_-	ModD protein	NA	NA	NA	NA	NA
WP_086958709.1|669453_670839_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_086958707.1|670838_672182_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_086956953.1|672623_673320_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959335.1|674749_676672_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.2e-49
WP_065171421.1|677197_679201_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	25.9	1.4e-27
WP_086957400.1|680302_680999_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	7.7e-66
WP_065171419.1|681621_682347_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_086956953.1|682459_683157_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958700.1|683904_684552_-	YdcF family protein	NA	NA	NA	NA	NA
WP_005305582.1|684636_685176_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_044177945.1|685315_685633_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	46.2	4.5e-13
WP_086958699.1|685804_686461_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_086958697.1|686760_687213_+	DUF3069 domain-containing protein	NA	NA	NA	NA	NA
WP_086958694.1|688485_689182_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	7.7e-66
WP_086956953.1|689590_690287_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958690.1|690824_691522_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	7.0e-67
WP_086959333.1|692037_692487_-	NfeD family protein	NA	NA	NA	NA	NA
WP_065171410.1|692489_693410_-	SPFH/Band 7/PHB domain protein	NA	A0A2K9L3L2	Tupanvirus	31.3	4.5e-21
WP_165761789.1|693693_694674_+	YdcF family protein	NA	NA	NA	NA	NA
WP_086956953.1|695815_696513_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
>prophage 10
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	718439	766070	1054589	transposase	Escherichia_phage(54.55%)	39	NA	NA
WP_086956953.1|718439_719136_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958661.1|719635_720394_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
WP_086958659.1|722417_724133_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_082212500.1|724432_725236_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_036765533.1|725858_726278_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_086956953.1|726360_727057_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044179701.1|727389_728508_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_036765525.1|728789_729173_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_086958657.1|729293_732167_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	2.7e-266
WP_086958654.1|732448_733312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958652.1|733314_734271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069107415.1|734373_734670_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_086958650.1|734666_735362_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.4	3.1e-35
WP_086956953.1|735388_736085_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958647.1|736219_736919_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	4.5e-66
WP_044179693.1|737111_738245_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_065171936.1|738339_738852_-	lipoprotein	NA	NA	NA	NA	NA
WP_086958645.1|738949_739717_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069107656.1|740944_741445_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044179690.1|742118_742724_+	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_036765757.1|742780_743455_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_075985093.1|743982_744177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958643.1|744185_745394_+|transposase	IS91-like element ISPda2 family transposase	transposase	NA	NA	NA	NA
WP_044177933.1|745702_747277_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	29.5	5.7e-32
WP_165761787.1|747439_749098_-	type I restriction-modification system endonuclease	NA	NA	NA	NA	NA
WP_086956953.1|749135_749833_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959329.1|749859_751695_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_086958638.1|752195_753149_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_036765767.1|753220_753646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958636.1|753980_755273_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	1.2e-48
WP_044177925.1|755412_757269_-	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_005305527.1|757427_758411_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005305530.1|758494_758755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075985093.1|759301_759496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958582.1|759504_760713_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_086958634.1|761733_762897_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_044177915.1|762978_764697_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	1.4e-36
WP_086958632.1|764896_765250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|765372_766070_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
>prophage 11
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	777611	844701	1054589	transposase	Escherichia_phage(63.64%)	54	NA	NA
WP_086956953.1|777611_778309_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044180407.1|779421_780312_-	phosphotransferase	NA	NA	NA	NA	NA
WP_075985035.1|780974_781169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096498243.1|781177_782386_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|782714_783412_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044177888.1|783606_784119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044177890.1|784220_784949_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_086958628.1|785209_786898_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_086956953.1|789885_790582_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086956953.1|790966_791664_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_065171320.1|791751_792351_+	LemA family protein	NA	NA	NA	NA	NA
WP_086958622.1|792351_793107_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_044178197.1|793109_793727_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_086956953.1|793976_794673_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958620.1|794682_794910_+	YgjV family protein	NA	NA	NA	NA	NA
WP_086958618.1|794916_795651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044178684.1|795725_797408_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_044178191.1|797617_798154_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_086958614.1|799462_800347_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_044178183.1|800506_801655_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_069107594.1|801857_802091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958612.1|802455_802803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172426110.1|803205_804498_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.1e-30
WP_086958610.1|805093_805996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036766063.1|806171_806714_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_086958609.1|806716_807751_+	alkene reductase	NA	NA	NA	NA	NA
WP_086958607.1|807834_808827_-	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_086958605.1|808837_809962_-	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_044178168.1|809961_810216_-	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_086958603.1|810245_812606_-	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_086958601.1|812760_813702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168443798.1|814089_814257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036765843.1|814377_814728_+	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
WP_065171305.1|814830_815475_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_065171304.1|815552_816827_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_065171303.1|816852_817233_-	RidA family protein	NA	NA	NA	NA	NA
WP_044178151.1|818308_818638_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_086958599.1|818866_820339_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_086958597.1|820475_821645_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_044178145.1|823338_824331_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.7	3.5e-19
WP_086959325.1|824679_824874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958596.1|824882_826091_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_044178142.1|826701_826899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068968744.1|827170_827605_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	47.0	2.3e-15
WP_172426110.1|827658_828951_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	1.1e-30
WP_086956953.1|829675_830373_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_145956567.1|831071_831827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958592.1|832039_832909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044178130.1|832995_833919_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_086959324.1|833972_834971_-	patatin family protein	NA	NA	NA	NA	NA
WP_086956953.1|836466_837164_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_172426143.1|839678_839834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959323.1|842897_843092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958586.1|843504_844701_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_AP018046	Photobacterium damselae subsp. piscicida strain 91-197 chromosome 2	1054589	849451	990445	1054589	transposase,integrase	Escherichia_phage(60.0%)	114	930043:930102	994198:994978
WP_086956953.1|849451_850149_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958584.1|850204_851506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075985093.1|853539_853734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958582.1|853742_854951_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_044178099.1|855505_856399_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_086956953.1|857739_858436_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_096498244.1|858793_859405_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044178087.1|859604_860711_+	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	23.8	8.3e-06
WP_096498245.1|860714_863765_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_096498246.1|863831_864722_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_096498247.1|865119_866532_+	amidohydrolase	NA	A0A0B5JBX3	Pandoravirus	20.1	8.2e-06
WP_044178075.1|866761_867733_-	arginase family protein	NA	NA	NA	NA	NA
WP_065171253.1|867778_868513_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036765862.1|868897_869620_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_096498248.1|869771_869972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086958663.1|869980_870678_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	1.0e-65
WP_044178072.1|871344_871923_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_005306107.1|871932_872565_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_069107586.1|872557_873532_-	sugar kinase	NA	NA	NA	NA	NA
WP_044178069.1|873677_874532_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_044178660.1|874812_876282_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_005306120.1|876541_878173_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_068968787.1|878243_879497_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_096498249.1|879755_882836_+	chondroitinase	NA	NA	NA	NA	NA
WP_096498250.1|882910_883607_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	1.0e-65
WP_096498251.1|884350_886771_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_086956969.1|887282_887980_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	1.2e-66
WP_086956953.1|888375_889072_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_065170572.1|889336_890602_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_086958580.1|891067_891760_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_086956953.1|891768_892466_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958578.1|893054_893751_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	2.4e-67
WP_086959321.1|893798_894533_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956953.1|894823_895520_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_005305940.1|895588_895789_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_036765846.1|896526_897381_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_125653075.1|897587_898001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956953.1|897911_898609_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958576.1|898741_899962_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_086958575.1|900037_900319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075985035.1|900528_900723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958573.1|900731_901928_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985035.1|902340_902535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957554.1|902543_903752_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_165761786.1|904433_904607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958571.1|904615_905812_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985035.1|906224_906419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958569.1|906427_907636_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_044173618.1|908210_908570_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_044173665.1|909222_910074_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	1.1e-50
WP_069107415.1|910070_910367_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|910734_911432_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086958564.1|911487_911691_-	OmpA family protein	NA	NA	NA	NA	NA
WP_086958562.1|911900_912597_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	2.6e-66
WP_044173659.1|912927_913443_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	51.1	4.2e-45
WP_044173652.1|913833_914274_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_069107415.1|914713_915010_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069107416.1|915006_915858_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
WP_086958560.1|917005_918022_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956953.1|918383_919081_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044179566.1|919397_920429_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086958556.1|920435_920756_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_086958554.1|920765_921462_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_075985093.1|923070_923265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958549.1|924278_925265_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086958547.1|925267_926287_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086958545.1|926302_927676_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.1	1.5e-36
WP_044179558.1|928722_929649_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
930043:930102	attL	TGGTGGTGACTCCAATTGATTTATTAATGGTAAAATTCACGTTCTATAAACGTTCCAATA	NA	NA	NA	NA
WP_086956953.1|930065_930763_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_044179556.1|931118_932351_+	serine/threonine protein kinase	NA	D5GV78	Campylobacter_virus	26.6	1.3e-23
WP_165761813.1|932535_932919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044179552.1|935233_936634_+	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_086959315.1|936704_937301_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.0	4.5e-06
WP_165761812.1|937293_937920_-	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	27.2	2.3e-05
WP_075985141.1|937975_938269_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_086956953.1|938350_939047_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959313.1|939056_939278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959311.1|939296_939977_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_069107415.1|940351_940648_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069107416.1|940644_941496_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.5	8.5e-51
WP_165761811.1|942784_942955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165761810.1|943170_943332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959307.1|943433_944732_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_086959305.1|945466_946399_+	DMT family transporter	NA	NA	NA	NA	NA
WP_086959304.1|946413_947874_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_086958690.1|947990_948687_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	7.0e-67
WP_172426147.1|948784_951064_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_086959300.1|951737_951971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075985035.1|952228_952423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958573.1|952431_953628_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075985035.1|954040_954235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086957554.1|954243_955452_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_086959298.1|955606_956368_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.2e-19
WP_086959296.1|958668_960144_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.5	7.8e-60
WP_044179521.1|960225_961086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165761809.1|961180_961720_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_096498253.1|961944_962988_-	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_086959290.1|962988_963330_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_086959288.1|963343_964174_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_086958432.1|965053_965248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096498254.1|967613_968311_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_086959286.1|968895_969592_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	2.0e-66
WP_086956969.1|970134_970832_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	1.2e-66
WP_086959385.1|971479_972811_+	DUF3943 domain-containing protein	NA	NA	NA	NA	NA
WP_086959284.1|972931_974053_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_096498255.1|974327_978266_+	AsmA family protein	NA	NA	NA	NA	NA
WP_044177754.1|978393_978831_-	hypothetical protein	NA	A0A1V0SE20	Indivirus	43.8	4.6e-24
WP_086959280.1|979097_980438_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	41.3	1.8e-18
WP_044177759.1|980781_981840_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_086959278.1|981970_983296_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_086959276.1|983357_984854_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_086959274.1|985022_985685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959272.1|985687_988831_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_086957400.1|989748_990445_+|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.3	7.7e-66
994198:994978	attR	TATTGGAACGTTTATAGAACGTGAATTTTACCATTAATAAATCAATTGGAGTCACCACCAAAGAATAACATTTCAATATACTGACTAATCTAAGGCGCTAAACGTTCAATTGACCAGTTTTCATGATCGACTTTGGTATATAAAAATCGATCATGAAGTCTGTGATCGCCACCTTGCCAAAATTCGATACTCGATATCTTCACCCGATACCCACCCCAAAAAGATGGCAACGGAACATCGCCTTCAGAAAACTTTTTCTTTAATTCAAAATACTTACTTTCTAATAATTGACGAGTACTTAGACGCGAACTTTGCTTACTTGCCCAAGCAGCTATTTGGCTCTCTTTAGGGCGAGATGAAAAATATTTAACAACTTCAAAAGAAGATAATTTTTCAGCAGTTCCCGTTACGTGAATTTGTCGTTCTAGAGCGTGCCATGGAAAATGAAGGCTGATATTTGCATTATCTTGTAAATGCAGAGCTTTTCGACTACCTAAGTTAGTGTAAAAAACAAACCCATCATCCCCAACATCTTTAAGTAAAACGATACGTTGGTATGGACGACCTTCGGTGTCTACGGTTGCTACCGTCATTGCAGTAGGATCGGAAAGTTGAGCATCAATCGCTTGCTGTAGCCATATATTAAATAAATCGAGAGGATTCTGAGTCAAATCTTCTCTTCTTAAACCACCTTTAGTGTAATCTCTTCTAATATCAGAAAGATCCATATCTAATACCCTCTAAATCTTATTTCATCATAACTTTGATCTAAATTTAACAC	NA	NA	NA	NA
>prophage 1
NZ_AP018047	Photobacterium damselae subsp. piscicida strain 91-197 plasmid p91-197-1, complete sequence	37140	0	9492	37140	transposase	Stx2-converting_phage(16.67%)	10	NA	NA
WP_086959649.1|379_679_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	46.2	2.4e-16
WP_086959685.1|878_1982_-	DUF3560 domain-containing protein	NA	A0A2K9V3V9	Faecalibacterium_phage	27.3	1.2e-07
WP_086959647.1|2672_2963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086959645.1|3220_3667_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.4	4.4e-22
WP_086959643.1|3911_5384_+	hypothetical protein	NA	Q9MBM1	Phage_Gifsy-1	48.3	3.0e-88
WP_086959583.1|5662_5857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086959641.1|5865_7074_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_086956953.1|7734_8432_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
WP_125653105.1|8536_8728_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_086959636.1|8874_9492_+	helix-turn-helix transcriptional regulator	NA	R9TNM0	Vibrio_phage	32.6	4.9e-24
>prophage 2
NZ_AP018047	Photobacterium damselae subsp. piscicida strain 91-197 plasmid p91-197-1, complete sequence	37140	18672	19370	37140	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_086956953.1|18672_19370_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	51.7	7.0e-67
>prophage 3
NZ_AP018047	Photobacterium damselae subsp. piscicida strain 91-197 plasmid p91-197-1, complete sequence	37140	29592	31218	37140	transposase	Mycobacterium_phage(50.0%)	3	NA	NA
WP_086959669.1|29592_30165_+	ParA family protein	NA	A0A222ZPP5	Mycobacterium_phage	40.4	1.0e-07
WP_086959667.1|30157_30478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086958578.1|30520_31218_-|transposase	IS1-like element ISPda1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	2.4e-67
