The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017620	Escherichia coli strain MRY15-131	5042704	541206	599659	5042704	tail,tRNA,portal,head,capsid,integrase,holin,protease,terminase,lysis	Enterobacteria_phage(47.27%)	75	551357:551403	600082:600128
WP_000912345.1|541206_542592_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143508.1|542627_543149_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|543256_543469_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|543470_544337_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|544808_545351_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988384.1|545569_546262_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001361257.1|546292_548902_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691076.1|548914_549922_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255235.1|549932_550448_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805414.1|550450_551083_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
551357:551403	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_061092788.1|551416_552580_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	3.7e-198
WP_000488407.1|552778_553057_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|553104_553323_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|553421_553703_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_032255841.1|553713_554271_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.9	3.2e-62
WP_045173744.1|554267_554426_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	1.8e-23
WP_024228451.1|554422_555103_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_052953584.1|555099_555885_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000995439.1|555890_556187_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_061092790.1|556262_556469_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.3	4.2e-28
WP_061092791.1|557024_557342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092792.1|557473_557743_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	75.3	4.8e-32
WP_064767403.1|557823_558513_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.4	1.2e-92
WP_001067459.1|558617_558848_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_061092794.1|558929_559469_+	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_077249156.1|559465_560485_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	6.7e-111
WP_001566186.1|560481_561183_+	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.0	7.9e-127
WP_000145912.1|561179_561482_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	2.6e-42
WP_001070442.1|561549_561882_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|561973_562081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|562138_563665_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_001567061.1|563776_564094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|564298_565228_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001309322.1|565326_565428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|565424_565880_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224919.1|565879_566050_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|566042_566333_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|566329_566692_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_032139865.1|566688_566829_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001205470.1|566913_567270_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|567249_568464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|568466_569642_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001120496.1|569933_570260_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001518397.1|570263_570740_+	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.1	9.5e-84
WP_001228695.1|570956_571139_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|571229_571523_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001307652.1|571885_572080_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453566.1|572468_573014_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001518400.1|572988_574914_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|574910_575117_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001518401.1|575113_576715_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
WP_001518402.1|576695_578015_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	4.8e-234
WP_001299443.1|578024_578357_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063252.1|578412_579438_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
WP_001518405.1|579479_579878_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	84.1	5.2e-51
WP_000752994.1|579889_580243_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001518407.1|580254_580833_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683145.1|580829_581225_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001518408.1|581232_581973_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
WP_001518409.1|581988_582411_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_001518410.1|582437_582827_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.1	3.4e-55
WP_001567091.1|582819_585381_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.2	0.0e+00
WP_000847401.1|585377_585707_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001518412.1|585706_586405_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	9.9e-130
WP_024177847.1|586409_587153_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_000090882.1|587089_587692_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_061092795.1|587752_591232_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001228252.1|591299_591899_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_061092796.1|591963_594336_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	68.8	7.9e-163
WP_061092797.1|594335_594617_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_000235975.1|594626_595331_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_016245272.1|595341_595635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|595827_596496_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|597034_598519_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_061092798.1|598705_599659_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
600082:600128	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
NZ_AP017620	Escherichia coli strain MRY15-131	5042704	953689	963131	5042704		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569365.1|953689_954616_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783133.1|954620_955352_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|955332_955440_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|955499_956231_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|956452_958138_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001308766.1|958134_958854_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001361590.1|958900_959371_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
WP_001296231.1|959411_959873_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001361589.1|959997_961998_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	94.9	0.0e+00
WP_001292746.1|961994_963131_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
>prophage 3
NZ_AP017620	Escherichia coli strain MRY15-131	5042704	1066237	1074954	5042704		Enterobacteria_phage(42.86%)	8	NA	NA
WP_020233187.1|1066237_1067632_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.7e-19
WP_000183060.1|1067806_1068700_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_042343238.1|1069072_1070158_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_001023616.1|1070157_1071057_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_023141668.1|1071115_1071994_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	5.1e-107
WP_001100791.1|1071998_1072547_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_001362820.1|1072578_1073817_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_000735124.1|1073826_1074954_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
>prophage 4
NZ_AP017620	Escherichia coli strain MRY15-131	5042704	1128721	1240383	5042704	transposase,plate,integrase	uncultured_Caudovirales_phage(33.33%)	88	1124320:1124379	1242200:1242215
1124320:1124379	attL	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCT	NA	NA	NA	NA
WP_061092887.1|1128721_1129606_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
1124320:1124379	attL	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCT	NA	NA	NA	NA
WP_161971438.1|1129675_1130029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072275302.1|1130389_1130746_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_061092889.1|1130811_1131066_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	61.2	1.7e-15
WP_061092890.1|1131062_1131524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092891.1|1132136_1132472_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_085949836.1|1132475_1133689_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_077249117.1|1133661_1134207_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_063117468.1|1134203_1134638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117471.1|1136139_1136655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117478.1|1136828_1137224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117472.1|1138597_1142656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063117473.1|1142670_1143078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063117474.1|1143074_1143992_-	radical SAM protein	NA	NA	NA	NA	NA
WP_000532923.1|1144707_1145424_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060216.1|1145765_1147220_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_063117475.1|1148951_1150004_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_130090963.1|1150264_1158244_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_063117477.1|1158770_1159037_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_063117479.1|1159061_1159628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949836.1|1160243_1161457_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_077252459.1|1161604_1165693_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.6	1.5e-23
WP_061093069.1|1165703_1166045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077249107.1|1166089_1166803_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.5	8.2e-23
WP_052895708.1|1166805_1167099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016248851.1|1167221_1167530_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_021550960.1|1167533_1167851_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	41.9	9.3e-11
WP_072693178.1|1167974_1169237_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.8	2.5e-70
WP_061093028.1|1169803_1170721_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
1169400:1169481	attR	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAAT	NA	NA	NA	NA
WP_001011018.1|1170822_1171773_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
1169400:1169481	attR	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAAT	NA	NA	NA	NA
WP_061093029.1|1175840_1176674_-	DUF4225 domain-containing protein	NA	A0A140XBD0	Dickeya_phage	43.3	3.0e-24
WP_061093030.1|1176843_1177980_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_115314324.1|1178086_1178461_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_164726265.1|1178437_1178581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093031.1|1178606_1179164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096427308.1|1179176_1180709_-	AHH domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.0	4.0e-22
WP_061093078.1|1180932_1181460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093033.1|1183212_1183506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249119.1|1183525_1187944_-	DUF4150 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.7	6.0e-23
WP_061093034.1|1187946_1189128_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_061093035.1|1189138_1191127_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016159310.1|1191340_1191859_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_061093036.1|1192541_1193048_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_061093037.1|1193067_1194552_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_061093038.1|1194554_1194977_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_061093039.1|1194981_1196805_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_061093053.1|1196771_1197815_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_061093052.1|1197831_1199118_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_061093040.1|1199114_1199648_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_061093041.1|1199650_1200994_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_061093042.1|1201827_1204566_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.1	2.9e-84
WP_061093043.1|1204562_1205306_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_061093044.1|1205310_1206738_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_123056338.1|1206846_1210278_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_061093046.1|1210288_1211644_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_061093047.1|1211665_1212145_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_061093048.1|1212197_1212497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093049.1|1212705_1213497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093050.1|1213776_1214505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096427310.1|1214525_1215738_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	1.1e-102
WP_072652861.1|1216039_1217302_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.3	3.8e-71
WP_001302302.1|1217644_1218442_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_021524272.1|1218903_1219740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021580845.1|1219955_1220174_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_059256365.1|1220255_1220546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032283297.1|1220590_1220887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519860.1|1220960_1221203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000505227.1|1221307_1221658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093068.1|1221721_1222126_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_061093067.1|1222283_1222763_-	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001519857.1|1222917_1223463_-	replication/maintenance protein RepL	NA	NA	NA	NA	NA
WP_021513673.1|1224729_1225116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519853.1|1226419_1227856_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_001519852.1|1227872_1228484_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001519851.1|1228533_1228911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093011.1|1228942_1229416_-	DUF4755 domain-containing protein	NA	NA	NA	NA	NA
WP_021513669.1|1229850_1230381_+	membrane lipoprotein lipid attachment site-containing protein	NA	NA	NA	NA	NA
WP_000177655.1|1230474_1231047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142313.1|1231105_1231588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093010.1|1231666_1233148_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_001608347.1|1233797_1234106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001608346.1|1234109_1234988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093009.1|1235292_1235658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093008.1|1235654_1235960_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_000243502.1|1236355_1236913_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_061093007.1|1236965_1238429_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_061093006.1|1238571_1238961_-	VOC family protein	NA	NA	NA	NA	NA
WP_061093005.1|1239162_1240383_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	6.2e-79
1242200:1242215	attR	TTATACCGTAAGGCTA	NA	NA	NA	NA
>prophage 5
NZ_AP017620	Escherichia coli strain MRY15-131	5042704	2537188	2550116	5042704	integrase	Escherichia_phage(83.33%)	6	2542691:2542704	2551161:2551174
WP_000368135.1|2537188_2538121_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
WP_001361863.1|2538708_2539227_-	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	1.4e-83
WP_001361862.1|2539286_2547206_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	97.9	0.0e+00
2542691:2542704	attL	TATCAAAAATCAGG	NA	NA	NA	NA
WP_000243052.1|2547230_2547851_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
WP_001181154.1|2548168_2548798_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_001224627.1|2549546_2550116_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	9.1e-49
2551161:2551174	attR	CCTGATTTTTGATA	NA	NA	NA	NA
>prophage 6
NZ_AP017620	Escherichia coli strain MRY15-131	5042704	3193807	3260791	5042704	transposase,integrase	Enterobacteria_phage(33.33%)	59	3199432:3199463	3261732:3261763
WP_039267758.1|3193807_3197305_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
3199432:3199463	attL	GTAAGCGTAAACTGACCGCCGTATGTAGCCAT	NA	NA	NA	NA
WP_000422741.1|3199516_3199942_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3199938_3200289_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_001593684.1|3200319_3201912_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
WP_000612556.1|3202007_3202355_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001171523.1|3202351_3202732_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000977396.1|3203311_3204103_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001313270.1|3204121_3206092_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001313273.1|3207963_3208071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089581225.1|3208079_3208265_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_000803221.1|3208435_3209752_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_000551919.1|3211246_3212590_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_001293447.1|3212746_3213571_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000983423.1|3213736_3215293_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000859647.1|3215292_3215982_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000760916.1|3216486_3216825_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000884152.1|3217209_3217665_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000919997.1|3217726_3219085_-	YadA-like family protein	NA	Q9MCI8	Enterobacteria_phage	76.1	5.6e-20
WP_131501864.1|3219935_3220049_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_000609007.1|3220311_3221265_-	transketolase family protein	NA	NA	NA	NA	NA
WP_001101067.1|3221257_3222088_-	transketolase	NA	NA	NA	NA	NA
WP_000470229.1|3222084_3223473_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000699820.1|3223495_3223768_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_001317566.1|3223846_3224290_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001018808.1|3224547_3225567_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	4.3e-17
WP_001366542.1|3226162_3226354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096427335.1|3226422_3226671_+	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_001167444.1|3226688_3227237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958492.1|3227514_3227748_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991578.1|3227771_3228389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126822.1|3228646_3229213_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000792543.1|3232943_3234992_-	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_153275894.1|3235184_3236412_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	6.1e-175
WP_001075491.1|3236523_3237255_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000778605.1|3237924_3238455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001107214.1|3239618_3240842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010402.1|3240942_3241827_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_001282919.1|3242029_3242710_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001097304.1|3242857_3243535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278282.1|3243540_3243774_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_085949836.1|3244198_3245412_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_000213705.1|3246019_3246505_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	3.4e-12
WP_001186715.1|3246520_3246997_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|3247065_3247287_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086770.1|3247305_3247950_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	33.8	4.5e-28
WP_001285113.1|3247999_3248368_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854719.1|3248457_3248835_+	toxin	NA	NA	NA	NA	NA
WP_000761679.1|3248831_3249320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839266.1|3249337_3249535_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001440175.1|3249619_3250465_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000208386.1|3250533_3250929_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_001440173.1|3250921_3251869_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_096427322.1|3252272_3253538_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	1.2e-77
WP_096427323.1|3253859_3255359_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001045031.1|3255540_3256281_-	porin family protein	NA	NA	NA	NA	NA
WP_001275824.1|3256390_3256867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330348.1|3258175_3258478_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001049879.1|3258775_3259117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164523141.1|3259578_3260791_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	7.9e-167
3261732:3261763	attR	ATGGCTACATACGGCGGTCAGTTTACGCTTAC	NA	NA	NA	NA
>prophage 7
NZ_AP017620	Escherichia coli strain MRY15-131	5042704	4069300	4073954	5042704	transposase	Escherichia_phage(50.0%)	6	NA	NA
WP_061092936.1|4069300_4070107_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.1	4.2e-47
WP_061092935.1|4070122_4070761_-	aldolase	NA	A0A077SK32	Escherichia_phage	52.7	6.6e-56
WP_061092934.1|4070757_4072020_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	45.8	6.0e-93
WP_096427327.1|4072676_4072880_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	2.5e-33
WP_001339397.1|4072929_4073607_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4073606_4073954_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
>prophage 8
NZ_AP017620	Escherichia coli strain MRY15-131	5042704	4576477	4622938	5042704	transposase,tail,tRNA,plate	Burkholderia_phage(28.57%)	48	NA	NA
WP_061092773.1|4576477_4577269_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
WP_061092772.1|4577283_4577739_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	2.3e-26
WP_061092771.1|4577735_4578443_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
WP_000135569.1|4578439_4580020_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
WP_000359520.1|4580022_4580739_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.8e-22
WP_000951744.1|4580731_4581847_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.4	6.9e-101
WP_001093498.1|4581837_4582197_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000679401.1|4582295_4582997_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	4.9e-12
WP_001361462.1|4583006_4584047_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	44.8	4.4e-73
WP_001269711.1|4584034_4584244_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_000271436.1|4584243_4585197_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001262479.1|4585196_4587572_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	26.1	5.9e-57
WP_015674804.1|4587673_4587802_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000658214.1|4587761_4588079_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907502.1|4588129_4588654_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_000729835.1|4588653_4590078_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.4	3.2e-191
WP_000875310.1|4590067_4590265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404767.1|4590261_4590717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777272.1|4590861_4591176_-	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_000266448.1|4591188_4591794_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000758131.1|4591796_4592084_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	1.5e-15
WP_000619864.1|4592621_4592969_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_001290321.1|4593023_4594373_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000789981.1|4594897_4596547_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000757333.1|4596900_4597143_+	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_001361463.1|4597256_4597895_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000595548.1|4597891_4598629_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000745730.1|4598628_4600725_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001328330.1|4600771_4601050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202902.1|4601264_4601675_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252058.1|4601768_4602659_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_001361466.1|4602673_4604218_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695387.1|4604371_4605562_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179165.1|4605926_4607042_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000973665.1|4607113_4608454_+	maltoporin LamB	NA	NA	NA	NA	NA
WP_170386723.1|4608697_4609669_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_001361468.1|4609768_4610689_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_061092770.1|4610916_4612497_+	SopA family protein	NA	NA	NA	NA	NA
WP_001308201.1|4612719_4613217_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455227.1|4613229_4614102_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017354.1|4614256_4616680_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002907.1|4616850_4617219_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646078.1|4617328_4617937_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001562441.1|4618009_4619335_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001296638.1|4619450_4619660_+	CsbD family protein	NA	NA	NA	NA	NA
WP_061092769.1|4619701_4620217_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_022646425.1|4620534_4621539_+	DUF2713 family protein	NA	NA	NA	NA	NA
WP_012602639.1|4621900_4622938_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 1
NZ_AP017621	Escherichia coli strain MRY15-131 plasmid pMRY15-131_1, complete sequence	116529	6769	43165	116529	transposase,integrase	Escherichia_phage(36.36%)	43	6718:6777	19193:20012
6718:6777	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|6769_7474_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001774155.1|7524_8010_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.5e-49
WP_001138064.1|8012_10979_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000427619.1|11057_12062_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_061093065.1|12280_12919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343103.1|12918_13173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774874.1|13524_14526_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_000793307.1|14701_15046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|15631_16336_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000845048.1|16783_17797_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|17952_18426_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|18495_19200_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|19321_20227_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
19193:20012	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGGATTGAATATAACCGACGTGACTGTTATATTTAGGTGGCTAAACCCGTCAAGCCCTCAGGAGTGAATCATGACCGTAGTCACGACCGCCGATACCTCCCAACTGTACGCACTTGCAGCCCGACATGGGCTCAAGCTCCATGGCCCGCTGACTGTCAATGAGCTTGGGCTCGACTATAGGATCGTGATCGCCACCGTCGACGATGGACGTCGGTGGGTGCTGCGCATCCCGCGCCGAGCCGAGGTAAGCGCGAAGGTCGAACCAGAGGCGCGGGTGCTGGCAATGCTCAAGAATCGCCTGCCGTTCGCGGTGCCGGACTGGCGCGTGGCCAACGCCGAGCTCGTTGCCTATCCCATGCTCGAAGACTCGACTGCGATGGTCATCCAGCCTGGTTCGTCCACGCCCGACTGGGTCGTGCCGCAGGACTCGGAGGTCTTCGCGGAGAGCTTCGCGACCGCGCTCGCCGCCCTGCATGCCGTCCCCATTTCCGCCGCCGTGGATGCGGGGATGCTCATCCGTACACCGACGCAGGCCCGTCAGAAGGTGGCCGACGACGTTGACCGCGTCCGACGCGAGTTCGTGGTGAACGACAAGCGCCTCCACCGGTGGCAGCGCTGGCTCGACGACGATTCGTCGTGGCCAGATTTCTCCGTGGTGGTGCATGGCGATCTCTACGTGGGCCATGTGCTCATCGACAACACGGAGCGCGTCAGCGGGATGATCGACTGGAGCGAGGCCCGCGTTGATGACCCTGCCATCG	NA	NA	NA	NA
WP_000004159.1|20223_21462_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|21461_22046_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096427337.1|23099_23804_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.2e-138
WP_001104248.1|24720_25359_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000069427.1|25386_25839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000277845.1|25868_26330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830839.1|26355_27348_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203745.1|27344_27977_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000214084.1|27973_28360_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001064268.1|28356_30984_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001278689.1|31143_31365_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
WP_000809906.1|31499_32015_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001038341.1|32011_32263_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_001057292.1|32259_32577_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000002780.1|32573_33146_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_000146685.1|33135_34563_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_072095570.1|34562_35267_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399792.1|35277_35844_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|35865_36177_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000340272.1|36191_36551_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254386.1|36584_36812_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000332484.1|36905_37592_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|37782_38166_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000614936.1|38442_39090_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234469.1|39386_40208_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000107535.1|40328_40616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547939.1|40640_40847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042808424.1|40848_41037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|41537_41696_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_087522250.1|41795_43165_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
