The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017617	Escherichia coli strain MRY15-117	5117319	542482	600935	5117319	head,capsid,tRNA,terminase,lysis,holin,tail,portal,protease,integrase	Enterobacteria_phage(47.27%)	75	552633:552679	601358:601404
WP_000912345.1|542482_543868_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143508.1|543903_544425_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|544532_544745_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|544746_545613_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|546084_546627_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988384.1|546845_547538_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001361257.1|547568_550178_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691076.1|550190_551198_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255235.1|551208_551724_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805414.1|551726_552359_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
552633:552679	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_061092788.1|552692_553856_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	3.7e-198
WP_000488407.1|554054_554333_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|554380_554599_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|554697_554979_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_032255841.1|554989_555547_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.9	3.2e-62
WP_045173744.1|555543_555702_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	1.8e-23
WP_024228451.1|555698_556379_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_052953584.1|556375_557161_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000995439.1|557166_557463_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_061092790.1|557538_557745_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.3	4.2e-28
WP_061092791.1|558300_558618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092792.1|558749_559019_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	75.3	4.8e-32
WP_064767403.1|559099_559789_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.4	1.2e-92
WP_001067459.1|559893_560124_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_061092794.1|560205_560745_+	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_077249156.1|560741_561761_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	6.7e-111
WP_001566186.1|561757_562459_+	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.0	7.9e-127
WP_000145912.1|562455_562758_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	2.6e-42
WP_001070442.1|562825_563158_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|563249_563357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|563414_564941_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_001567061.1|565052_565370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|565574_566504_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001309322.1|566602_566704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|566700_567156_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224919.1|567155_567326_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|567318_567609_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|567605_567968_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_032139865.1|567964_568105_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001205470.1|568189_568546_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|568525_569740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|569742_570918_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001120496.1|571209_571536_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001518397.1|571539_572016_+	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.1	9.5e-84
WP_001228695.1|572232_572415_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|572505_572799_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001307652.1|573161_573356_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453566.1|573744_574290_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001518400.1|574264_576190_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|576186_576393_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001518401.1|576389_577991_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
WP_001518402.1|577971_579291_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	4.8e-234
WP_001299443.1|579300_579633_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063252.1|579688_580714_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
WP_001518405.1|580755_581154_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	84.1	5.2e-51
WP_000752994.1|581165_581519_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001518407.1|581530_582109_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683145.1|582105_582501_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001518408.1|582508_583249_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
WP_001518409.1|583264_583687_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_001518410.1|583713_584103_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.1	3.4e-55
WP_001567091.1|584095_586657_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.2	0.0e+00
WP_000847401.1|586653_586983_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001518412.1|586982_587681_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	9.9e-130
WP_024177847.1|587685_588429_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_000090882.1|588365_588968_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_061092795.1|589028_592508_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001228252.1|592575_593175_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_061092796.1|593239_595612_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	68.8	7.9e-163
WP_061092797.1|595611_595893_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_000235975.1|595902_596607_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_016245272.1|596617_596911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|597103_597772_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|598310_599795_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_061092798.1|599981_600935_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
601358:601404	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
NZ_AP017617	Escherichia coli strain MRY15-117	5117319	954968	964410	5117319		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569365.1|954968_955895_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783133.1|955899_956631_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|956611_956719_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|956778_957510_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|957731_959417_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001308766.1|959413_960133_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001361590.1|960179_960650_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
WP_001296231.1|960690_961152_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001361589.1|961276_963277_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	94.9	0.0e+00
WP_001292746.1|963273_964410_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
>prophage 3
NZ_AP017617	Escherichia coli strain MRY15-117	5117319	1076554	1087812	5117319		Acanthocystis_turfacea_Chlorella_virus(25.0%)	10	NA	NA
WP_000026026.1|1076554_1077571_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.3	6.3e-77
WP_000699784.1|1077639_1078647_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000335121.1|1078657_1079779_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	2.2e-131
WP_000163129.1|1079782_1080748_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	9.9e-88
WP_001042472.1|1080750_1081206_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001361571.1|1081217_1082603_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	1.9e-47
WP_000868618.1|1082686_1083433_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	2.1e-08
WP_000736848.1|1083457_1084828_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	6.4e-32
WP_000043484.1|1084991_1086398_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704860.1|1086645_1087812_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
>prophage 4
NZ_AP017617	Escherichia coli strain MRY15-117	5117319	1132854	1244517	5117319	transposase,plate,integrase	uncultured_Caudovirales_phage(33.33%)	89	1128453:1128512	1246334:1246349
1128453:1128512	attL	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCT	NA	NA	NA	NA
WP_061092887.1|1132854_1133739_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
1128453:1128512	attL	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCT	NA	NA	NA	NA
WP_161971438.1|1133808_1134162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072275302.1|1134522_1134879_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_061092889.1|1134944_1135199_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	61.2	1.7e-15
WP_061092890.1|1135195_1135657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092891.1|1136269_1136605_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_085949836.1|1136608_1137822_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_077249117.1|1137794_1138340_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_063117468.1|1138336_1138771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117471.1|1140272_1140788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117478.1|1140961_1141357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117472.1|1142730_1146789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063117473.1|1146803_1147211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063117474.1|1147207_1148125_-	radical SAM protein	NA	NA	NA	NA	NA
WP_000532923.1|1148840_1149557_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060216.1|1149898_1151353_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378562.1|1151454_1152771_-	shikimate transporter	NA	NA	NA	NA	NA
WP_063117475.1|1153085_1154138_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_130090963.1|1154398_1162378_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_063117477.1|1162904_1163171_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_063117479.1|1163195_1163762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949836.1|1164377_1165591_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_077252459.1|1165738_1169827_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.6	1.5e-23
WP_061093069.1|1169837_1170179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077249107.1|1170223_1170937_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.5	8.2e-23
WP_052895708.1|1170939_1171233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016248851.1|1171355_1171664_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_021550960.1|1171667_1171985_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	41.9	9.3e-11
WP_072693178.1|1172108_1173371_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.8	2.5e-70
WP_061093028.1|1173937_1174855_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
1173534:1173615	attR	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAAT	NA	NA	NA	NA
WP_001011018.1|1174956_1175907_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
1173534:1173615	attR	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAAT	NA	NA	NA	NA
WP_061093029.1|1179974_1180808_-	DUF4225 domain-containing protein	NA	A0A140XBD0	Dickeya_phage	43.3	3.0e-24
WP_061093030.1|1180977_1182114_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_115314324.1|1182220_1182595_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_164726265.1|1182571_1182715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093031.1|1182740_1183298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096427308.1|1183310_1184843_-	AHH domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.0	4.0e-22
WP_061093078.1|1185066_1185594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093033.1|1187346_1187640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249119.1|1187659_1192078_-	DUF4150 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.7	6.0e-23
WP_061093034.1|1192080_1193262_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_061093035.1|1193272_1195261_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016159310.1|1195474_1195993_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_061093036.1|1196675_1197182_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_061093037.1|1197201_1198686_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_061093038.1|1198688_1199111_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_061093039.1|1199115_1200939_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_061093053.1|1200905_1201949_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_061093052.1|1201965_1203252_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_061093040.1|1203248_1203782_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_061093041.1|1203784_1205128_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_061093042.1|1205961_1208700_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.1	2.9e-84
WP_061093043.1|1208696_1209440_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_061093044.1|1209444_1210872_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_123056338.1|1210980_1214412_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_061093046.1|1214422_1215778_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_061093047.1|1215799_1216279_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_061093048.1|1216331_1216631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093049.1|1216839_1217631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093050.1|1217910_1218639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096427310.1|1218659_1219872_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	1.1e-102
WP_072652861.1|1220173_1221436_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.3	3.8e-71
WP_001302302.1|1221778_1222576_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_021524272.1|1223037_1223874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021580845.1|1224089_1224308_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_059256365.1|1224389_1224680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032283297.1|1224724_1225021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519860.1|1225094_1225337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000505227.1|1225441_1225792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093068.1|1225855_1226260_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_061093067.1|1226417_1226897_-	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001519857.1|1227051_1227597_-	replication/maintenance protein RepL	NA	NA	NA	NA	NA
WP_021513673.1|1228863_1229250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519853.1|1230553_1231990_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_001519852.1|1232006_1232618_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001519851.1|1232667_1233045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093011.1|1233076_1233550_-	DUF4755 domain-containing protein	NA	NA	NA	NA	NA
WP_021513669.1|1233984_1234515_+	membrane lipoprotein lipid attachment site-containing protein	NA	NA	NA	NA	NA
WP_000177655.1|1234608_1235181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142313.1|1235239_1235722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093010.1|1235800_1237282_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_001608347.1|1237931_1238240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001608346.1|1238243_1239122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093009.1|1239426_1239792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093008.1|1239788_1240094_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_000243502.1|1240489_1241047_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_061093007.1|1241099_1242563_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_061093006.1|1242705_1243095_-	VOC family protein	NA	NA	NA	NA	NA
WP_061093005.1|1243296_1244517_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	6.2e-79
1246334:1246349	attR	TTATACCGTAAGGCTA	NA	NA	NA	NA
>prophage 5
NZ_AP017617	Escherichia coli strain MRY15-117	5117319	2540261	2553189	5117319	integrase	Escherichia_phage(83.33%)	6	2545764:2545777	2554234:2554247
WP_000368135.1|2540261_2541194_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
WP_001361863.1|2541781_2542300_-	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	1.4e-83
WP_001361862.1|2542359_2550279_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	97.9	0.0e+00
2545764:2545777	attL	TATCAAAAATCAGG	NA	NA	NA	NA
WP_000243052.1|2550303_2550924_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
WP_001181154.1|2551241_2551871_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_001224627.1|2552619_2553189_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	9.1e-49
2554234:2554247	attR	CCTGATTTTTGATA	NA	NA	NA	NA
>prophage 6
NZ_AP017617	Escherichia coli strain MRY15-117	5117319	3196880	3205806	5117319	transposase	Stx2-converting_phage(66.67%)	6	NA	NA
WP_039267758.1|3196880_3200378_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
WP_000422741.1|3202590_3203016_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3203012_3203363_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_001593684.1|3203393_3204986_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
WP_000612556.1|3205081_3205429_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001171523.1|3205425_3205806_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 7
NZ_AP017617	Escherichia coli strain MRY15-117	5117319	3273695	3332975	5117319	transposase,protease,integrase	Pseudomonas_phage(45.45%)	55	3272883:3272898	3345100:3345115
3272883:3272898	attL	CAAAACTGTTCTTCCA	NA	NA	NA	NA
WP_024177929.1|3273695_3274772_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189123.1|3275313_3276822_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000166950.1|3278985_3279330_+	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_001167424.1|3279348_3279897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021513224.1|3280354_3280813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000406622.1|3280912_3281599_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071526565.1|3281773_3282052_-	microcin McmA	NA	NA	NA	NA	NA
WP_000958500.1|3282883_3283117_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991592.1|3283185_3283758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126816.1|3284004_3284571_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001067608.1|3286134_3287739_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_096485664.1|3288921_3289653_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000147746.1|3291171_3292302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001116802.1|3292486_3293371_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_001282919.1|3293573_3294254_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001097305.1|3294401_3295079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278287.1|3295084_3295318_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001175169.1|3295407_3296226_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.2e-47
WP_000206658.1|3296317_3296803_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	6.9e-13
WP_001367707.1|3296818_3297295_+	RadC family protein	NA	NA	NA	NA	NA
WP_000691819.1|3297381_3297603_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_096485666.1|3297682_3298051_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094442.1|3298140_3298515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000777553.1|3298511_3299000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839281.1|3299011_3299209_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001290247.1|3299305_3299875_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_031250069.1|3300722_3301310_+	hypothetical protein	NA	O21975	Escherichia_phage	57.0	1.0e-58
WP_023892874.1|3301655_3302840_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.7	3.6e-31
WP_032165636.1|3302894_3303251_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_053266158.1|3303300_3305214_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	26.1	1.1e-16
WP_049038177.1|3305299_3306478_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1P3	Pseudomonas_phage	31.1	1.3e-20
WP_049038181.1|3306925_3307279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053088710.1|3307271_3307703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098181.1|3307749_3308178_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_049038183.1|3308236_3308701_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_000113424.1|3308679_3308919_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023337780.1|3308996_3309380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049038185.1|3309523_3310273_+	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
WP_049038187.1|3310375_3311089_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_049038189.1|3311147_3311459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049038201.1|3311532_3313398_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_049038191.1|3313601_3315158_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	3.4e-106
WP_049038193.1|3315154_3316351_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_049038195.1|3316467_3319584_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_000117288.1|3319804_3320143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021544648.1|3320327_3321305_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_001033549.1|3321361_3322339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049038998.1|3323117_3324383_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.1	3.5e-77
WP_049039000.1|3324638_3325682_+	tetratricopeptide repeat family protein	NA	NA	NA	NA	NA
WP_061093062.1|3326040_3327543_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001045028.1|3327724_3328465_-	porin family protein	NA	NA	NA	NA	NA
WP_049038853.1|3328682_3329051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330348.1|3330359_3330662_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001049879.1|3330959_3331301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164523141.1|3331762_3332975_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	7.9e-167
3345100:3345115	attR	TGGAAGAACAGTTTTG	NA	NA	NA	NA
>prophage 8
NZ_AP017617	Escherichia coli strain MRY15-117	5117319	4140414	4145068	5117319	transposase	Escherichia_phage(50.0%)	6	NA	NA
WP_061092936.1|4140414_4141221_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.1	4.2e-47
WP_061092935.1|4141236_4141875_-	aldolase	NA	A0A077SK32	Escherichia_phage	52.7	6.6e-56
WP_061092934.1|4141871_4143134_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	45.8	6.0e-93
WP_096427327.1|4143790_4143994_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	2.5e-33
WP_001339397.1|4144043_4144721_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4144720_4145068_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
>prophage 9
NZ_AP017617	Escherichia coli strain MRY15-117	5117319	4646525	4663017	5117319	plate,tail	Burkholderia_phage(33.33%)	22	NA	NA
WP_061092773.1|4646525_4647317_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
WP_061092772.1|4647331_4647787_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	2.3e-26
WP_061092771.1|4647783_4648491_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
WP_000135569.1|4648487_4650068_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
WP_000359520.1|4650070_4650787_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.8e-22
WP_000951744.1|4650779_4651895_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.4	6.9e-101
WP_001093498.1|4651885_4652245_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000679401.1|4652343_4653045_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	4.9e-12
WP_001361462.1|4653054_4654095_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	44.8	4.4e-73
WP_001269711.1|4654082_4654292_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_000271436.1|4654291_4655245_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001262479.1|4655244_4657620_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	26.1	5.9e-57
WP_015674804.1|4657721_4657850_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000658214.1|4657809_4658127_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907502.1|4658177_4658702_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_000729835.1|4658701_4660126_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.4	3.2e-191
WP_000875310.1|4660115_4660313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404767.1|4660309_4660765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777272.1|4660909_4661224_-	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_000266448.1|4661236_4661842_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000758131.1|4661844_4662132_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	1.5e-15
WP_000619864.1|4662669_4663017_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
>prophage 1
NZ_AP017618	Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence	116529	6769	43165	116529	integrase,transposase	Escherichia_phage(36.36%)	43	6718:6777	19193:20012
6718:6777	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|6769_7474_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001774155.1|7524_8010_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.5e-49
WP_001138064.1|8012_10979_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000427619.1|11057_12062_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_061093065.1|12280_12919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343103.1|12918_13173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774874.1|13524_14526_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_000793307.1|14701_15046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|15631_16336_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000845048.1|16783_17797_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|17952_18426_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|18495_19200_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|19321_20227_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
19193:20012	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGGATTGAATATAACCGACGTGACTGTTATATTTAGGTGGCTAAACCCGTCAAGCCCTCAGGAGTGAATCATGACCGTAGTCACGACCGCCGATACCTCCCAACTGTACGCACTTGCAGCCCGACATGGGCTCAAGCTCCATGGCCCGCTGACTGTCAATGAGCTTGGGCTCGACTATAGGATCGTGATCGCCACCGTCGACGATGGACGTCGGTGGGTGCTGCGCATCCCGCGCCGAGCCGAGGTAAGCGCGAAGGTCGAACCAGAGGCGCGGGTGCTGGCAATGCTCAAGAATCGCCTGCCGTTCGCGGTGCCGGACTGGCGCGTGGCCAACGCCGAGCTCGTTGCCTATCCCATGCTCGAAGACTCGACTGCGATGGTCATCCAGCCTGGTTCGTCCACGCCCGACTGGGTCGTGCCGCAGGACTCGGAGGTCTTCGCGGAGAGCTTCGCGACCGCGCTCGCCGCCCTGCATGCCGTCCCCATTTCCGCCGCCGTGGATGCGGGGATGCTCATCCGTACACCGACGCAGGCCCGTCAGAAGGTGGCCGACGACGTTGACCGCGTCCGACGCGAGTTCGTGGTGAACGACAAGCGCCTCCACCGGTGGCAGCGCTGGCTCGACGACGATTCGTCGTGGCCAGATTTCTCCGTGGTGGTGCATGGCGATCTCTACGTGGGCCATGTGCTCATCGACAACACGGAGCGCGTCAGCGGGATGATCGACTGGAGCGAGGCCCGCGTTGATGACCCTGCCATCG	NA	NA	NA	NA
WP_000004159.1|20223_21462_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|21461_22046_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096427337.1|23099_23804_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.2e-138
WP_001104248.1|24720_25359_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000069427.1|25386_25839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000277845.1|25868_26330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830839.1|26355_27348_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203745.1|27344_27977_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000214084.1|27973_28360_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001064268.1|28356_30984_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001278689.1|31143_31365_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
WP_000809906.1|31499_32015_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001038341.1|32011_32263_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_001057292.1|32259_32577_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000002780.1|32573_33146_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_000146685.1|33135_34563_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_072095570.1|34562_35267_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399792.1|35277_35844_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|35865_36177_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000340272.1|36191_36551_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254386.1|36584_36812_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000332484.1|36905_37592_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|37782_38166_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000614936.1|38442_39090_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234469.1|39386_40208_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000107535.1|40328_40616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547939.1|40640_40847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042808424.1|40848_41037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|41537_41696_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_087522250.1|41795_43165_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
