The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	13818	56914	1482279	tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(20.0%)	41	NA	NA
WP_006014241.1|13818_14820_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_129827230.1|15108_15768_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.6	2.2e-46
WP_129827231.1|15962_16262_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_129827232.1|16291_17164_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827233.1|17750_19022_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096560668.1|19474_20695_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.2	1.7e-47
WP_006014255.1|20694_21876_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_006014258.1|21923_22370_+	heme biosynthesis protein HemY	NA	A0A2H4N7M3	Lake_Baikal_phage	36.9	9.7e-14
WP_006014261.1|22396_23071_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	8.0e-28
WP_006014264.1|23100_23325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014267.1|23317_24016_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_006014270.1|24150_25338_+	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	32.1	5.4e-27
WP_006014273.1|25540_26263_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_039950656.1|26263_26800_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_096560667.1|26846_27314_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006014286.1|27662_28640_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_096560603.1|29075_30347_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|30933_31806_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013045.1|31955_33002_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_006013084.1|33143_33842_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_006013081.1|33971_34280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096560649.1|34338_35265_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_006014305.1|35514_36975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014307.1|36979_37588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014310.1|37584_38373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014313.1|38527_39010_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	60.3	2.0e-36
WP_006014316.1|39019_39898_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_096560648.1|39890_40475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|40776_41649_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827234.1|42235_43507_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_063630856.1|44316_45642_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_096560644.1|45777_46602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014358.1|46726_48253_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_136122016.1|48925_49360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014364.1|49361_50153_+	peptidase M61	NA	NA	NA	NA	NA
WP_006014367.1|50218_50473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|50514_51387_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096616077.1|52685_53774_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827235.1|53784_54327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|54363_55452_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006014381.1|55651_56914_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	34.5	4.1e-65
>prophage 3
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	147909	194341	1482279	tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(20.0%)	44	NA	NA
WP_006014650.1|147909_150414_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	37.9	1.3e-163
WP_006014654.1|150418_151009_-	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	33.6	1.2e-08
WP_006014656.1|151061_151388_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006014658.1|151387_151684_-	integration host factor subunit alpha	NA	NA	NA	NA	NA
WP_006014663.1|151722_152919_-	MFS transporter	NA	NA	NA	NA	NA
WP_129827232.1|153651_154524_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827238.1|154791_155013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013179.1|155082_155385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145510622.1|155521_155749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827239.1|156034_157354_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_096616077.1|157533_158622_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_096641400.1|158648_159197_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006014667.1|159324_160329_-	PRANC domain-containing protein	NA	NA	NA	NA	NA
WP_145510623.1|161132_162005_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013222.1|163021_163378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827241.1|163509_164781_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|165367_166240_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006015237.1|166521_167568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015235.1|167820_168438_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_006015234.1|168437_169406_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_096560718.1|169588_170515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015230.1|170715_174036_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	34.1	4.5e-164
WP_006015228.1|174084_174858_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_039950823.1|174857_175136_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_006015225.1|175139_175664_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_006015222.1|175776_177069_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.6	2.7e-16
WP_129827309.1|177374_177506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827230.1|177591_178251_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.6	2.2e-46
WP_129827231.1|178445_178745_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_006013981.1|178859_180134_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_006013980.1|180176_181373_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129827239.1|181633_182953_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_006015211.1|183246_183537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587954.1|183533_184079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827310.1|184754_184916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950817.1|185420_185999_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_145510624.1|186270_186741_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	33.9	4.6e-14
WP_145510625.1|186737_187991_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	26.9	2.8e-26
WP_039950813.1|187987_188374_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_096560656.1|188396_189056_-	CADD family putative folate metabolism protein	NA	NA	NA	NA	NA
WP_129827242.1|189237_189600_+	type IV secretion protein Dot	NA	NA	NA	NA	NA
WP_096616077.1|189808_190897_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827311.1|191724_192099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|193468_194341_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	205069	280599	1482279	tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(28.57%)	52	NA	NA
WP_096676677.1|205069_205942_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006015142.1|205971_207471_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006015139.1|207602_208829_+	cytochrome b/b6	NA	NA	NA	NA	NA
WP_096560735.1|208828_209590_+	cytochrome c1	NA	NA	NA	NA	NA
WP_006015133.1|209676_211611_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_096616077.1|212162_213251_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006015122.1|213301_214393_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_129827243.1|214653_215880_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_080589545.1|215908_216268_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_006015115.1|216329_216902_+	NifU family protein	NA	A0A218MN08	uncultured_virus	31.5	4.3e-06
WP_006015112.1|216898_218122_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.8	6.1e-26
WP_006015109.1|218118_218889_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	28.7	3.5e-27
WP_006015105.1|219100_220510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015102.1|220635_221910_+	amino acid permease	NA	NA	NA	NA	NA
WP_006015099.1|221980_223267_+	amino acid permease	NA	NA	NA	NA	NA
WP_096560665.1|223295_223721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015092.1|223859_224882_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_039950789.1|224883_225960_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_039950787.1|226066_226471_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_006015083.1|226673_228272_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006015082.1|228402_229248_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_006015080.1|229244_229658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|229867_230740_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827312.1|231048_231915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|232522_233395_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827245.1|234823_235360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|235406_236279_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006015057.1|236907_238485_-|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_006015054.1|238549_238846_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_006015049.1|238855_241261_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_006015045.1|241253_243827_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_006015043.1|243844_246235_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_039950782.1|246231_249105_+	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_096560625.1|249186_252420_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_006015036.1|252403_253033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827246.1|253356_254400_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_096676677.1|255725_256598_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|257184_258456_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006015015.1|258723_260463_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.2	2.7e-67
WP_006015006.1|261128_262451_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_006015001.1|262887_266136_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	34.0	4.3e-175
WP_006014998.1|266177_268949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014995.1|268945_271285_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_006014992.1|271397_271667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014988.1|271867_272593_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_006014985.1|272652_272880_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_006014971.1|272883_273363_+	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
WP_006014968.1|273370_273847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014959.1|275423_276419_+	heme A synthase	NA	NA	NA	NA	NA
WP_145510626.1|276401_278381_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_006014954.1|278442_279093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014952.1|279246_280599_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	287406	352229	1482279	protease,tRNA,transposase	Bacillus_virus(18.18%)	53	NA	NA
WP_096676677.1|287406_288279_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014920.1|289140_289641_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_006014918.1|289641_290853_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.1e-79
WP_006014915.1|290956_291274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014912.1|291270_292545_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	33.1	3.0e-52
WP_006014910.1|292546_293155_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.0	1.6e-35
WP_096560749.1|293291_293828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|295391_296264_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014897.1|296509_299008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014896.1|299004_299391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950762.1|299383_300880_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_006014888.1|301226_301787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014886.1|301876_303925_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_006014883.1|303933_305589_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	35.0	1.6e-85
WP_006014880.1|305684_306050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014877.1|306139_306784_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_006014874.1|306789_307569_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006014871.1|307659_308733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827248.1|308966_310286_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_039950755.1|310422_313251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014858.1|313231_315586_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_039950758.1|315637_316003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014852.1|316107_317553_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_006014849.1|317657_318698_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
WP_006014846.1|318703_319225_-	cytochrome b	NA	NA	NA	NA	NA
WP_006014843.1|319490_320663_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_129827232.1|320798_321671_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|321896_323168_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|323861_324950_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827313.1|325450_326497_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.7	5.8e-166
WP_006014834.1|328005_328776_-	response regulator transcription factor	NA	A0A0K0PVG9	Roseobacter_phage	41.3	6.0e-11
WP_006014776.1|329098_330076_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_096560653.1|330095_330578_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_006014768.1|330567_331359_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006014755.1|331394_332531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014752.1|332534_333323_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_007302008.1|333377_333836_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_006014745.1|333829_334228_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_006014742.1|334227_335412_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_006014739.1|335650_336124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|336571_337444_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014725.1|338364_339135_+	polysaccharide deacetylase family protein	NA	A0A2I2L4G0	Orpheovirus	26.2	2.9e-05
WP_006014723.1|339155_340712_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_006014721.1|340811_343268_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.6	1.2e-193
WP_145510627.1|343283_344561_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.1	9.0e-105
WP_096560730.1|344560_345187_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.4	1.9e-60
WP_006014712.1|345198_346542_-	trigger factor	NA	NA	NA	NA	NA
WP_006014710.1|347034_347634_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_006014706.1|347800_348007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145510667.1|348066_348207_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_006014702.1|348344_349196_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_096560603.1|349498_350770_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|351356_352229_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	368446	426624	1482279	tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(40.0%)	47	NA	NA
WP_006014688.1|368446_369397_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_006014685.1|372139_373411_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_039950729.1|373641_374112_-	transporter	NA	NA	NA	NA	NA
WP_006014682.1|374246_375674_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_129827231.1|376409_376709_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_096676677.1|376815_377688_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014667.1|378227_379232_+	PRANC domain-containing protein	NA	NA	NA	NA	NA
WP_096641400.1|379359_379908_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096676677.1|380753_381626_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|382212_383484_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006013634.1|383790_385131_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096676677.1|385799_386672_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827249.1|387858_388731_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827250.1|388757_389504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|389530_390619_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006013625.1|391244_392258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013621.1|392353_392725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013619.1|392725_392998_+	DUF2610 domain-containing protein	NA	NA	NA	NA	NA
WP_006013616.1|393008_393851_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_006013614.1|393889_394300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013610.1|394496_396296_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_006013606.1|396267_398592_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013603.1|398842_399451_-	guanylate kinase	NA	E7DUI8	Liberibacter_phage	32.4	3.4e-17
WP_039950511.1|399486_401253_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_006013597.1|401236_402220_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013595.1|402873_403779_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.5	1.6e-26
WP_006013592.1|403859_404876_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_129827246.1|405772_406816_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_129827252.1|406865_407999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013579.1|408082_408868_-	NAD kinase	NA	NA	NA	NA	NA
WP_006013575.1|408889_409102_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006013569.1|409226_410195_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_039950503.1|410246_411002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013563.1|411016_412513_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_006013560.1|412709_413444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145510631.1|413812_416452_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.6	6.3e-76
WP_006013553.1|416670_417627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013551.1|417916_418678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013549.1|418889_419333_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_006013548.1|419431_419638_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006013542.1|419659_420025_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_039950500.1|420044_420944_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.2	1.6e-10
WP_145510668.1|420983_421277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013536.1|421314_422835_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.2	3.1e-67
WP_096616077.1|423015_424104_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827253.1|424169_425450_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_096616077.1|425535_426624_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 7
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	430959	492510	1482279	tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(13.33%)	57	NA	NA
WP_129827246.1|430959_432003_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_006013510.1|432823_433744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950492.1|433731_435030_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_006013506.1|435026_435521_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006013504.1|435907_436369_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_006013501.1|436383_437115_+	DsbA family protein	NA	NA	NA	NA	NA
WP_017532317.1|437143_437422_-	DUF2671 domain-containing protein	NA	NA	NA	NA	NA
WP_006013497.1|437672_438350_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	32.1	1.7e-17
WP_006013494.1|438321_438975_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_006013492.1|438971_439181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013489.1|439354_440938_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.5	8.8e-41
WP_015588155.1|440941_441274_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_006013486.1|441610_442297_+	P44/Msp2 family outer membrane protein	NA	NA	NA	NA	NA
WP_006013484.1|442567_443461_+	sigma-70 family RNA polymerase sigma factor	NA	A0A248SJA5	Salicola_phage	29.0	1.0e-25
WP_006013483.1|443453_443951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096560624.1|444062_445214_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	36.6	4.7e-52
WP_006013481.1|445215_445953_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_006012936.1|446066_447134_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.2	8.6e-117
WP_129827239.1|447394_448714_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_006013480.1|448945_449500_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_006013479.1|449499_450111_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_145510632.1|450253_450553_+	ETC complex I subunit	NA	NA	NA	NA	NA
WP_129827249.1|451093_451966_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013473.1|452126_453011_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_006013471.1|453208_454411_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.2	1.8e-46
WP_006013469.1|454435_455218_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_006013467.1|455334_456573_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_006013465.1|456704_457244_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.4	1.2e-21
WP_006013463.1|457233_458007_+	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	30.2	1.9e-12
WP_006013459.1|458518_459046_+	demethoxyubiquinone hydroxylase family protein	NA	NA	NA	NA	NA
WP_006013456.1|459173_460406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013453.1|460656_462042_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.9	7.4e-52
WP_006013441.1|462764_463052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013437.1|463072_463393_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_039950484.1|463521_464337_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_006013430.1|464323_465088_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	2.9e-10
WP_145510633.1|465204_468408_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_096676677.1|468833_469706_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013351.1|469794_470748_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.8	4.8e-10
WP_039950469.1|472600_474625_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_129827232.1|474829_475702_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013335.1|476139_476820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013332.1|476845_477439_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.2	1.3e-29
WP_006013329.1|477541_478114_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_006013327.1|478119_479838_+	potassium transporter	NA	NA	NA	NA	NA
WP_006013324.1|479927_481088_+	aspartate kinase	NA	NA	NA	NA	NA
WP_006013321.1|481105_482185_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_006013317.1|482193_482661_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_006013315.1|482724_483651_+	glutathione synthase	NA	NA	NA	NA	NA
WP_006013311.1|483635_484658_-	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_039950466.1|484731_485097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013306.1|485098_486484_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.6	2.5e-44
WP_006013300.1|487172_487652_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_006013294.1|487731_488346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|488445_489318_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|489904_491176_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|491421_492510_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 8
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	497476	582267	1482279	protease,tRNA,transposase	Wolbachia_phage(18.75%)	56	NA	NA
WP_006013270.1|497476_498589_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_145510634.1|498801_499869_-	MreB/Mrl family cell shape determining protein	NA	NA	NA	NA	NA
WP_039950459.1|499889_501308_-	carboxypeptidase	NA	NA	NA	NA	NA
WP_006013262.1|501579_502059_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006013259.1|502194_503487_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	29.5	1.9e-09
WP_006013256.1|503499_503982_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	47.1	6.4e-11
WP_080589540.1|504141_504627_+	AAA family ATPase	NA	E4WLN5	Ostreococcus_tauri_virus	52.1	8.1e-22
WP_145510635.1|504846_506676_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	42.5	1.2e-115
WP_096641557.1|506799_507801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013244.1|508037_508532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|508820_509693_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013192.1|510102_511359_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_129827239.1|511871_513191_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_129827232.1|513506_514379_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827232.1|514573_515446_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013106.1|515674_517420_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.6	1.1e-15
WP_006013103.1|517701_521307_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013099.1|521417_522428_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.9	9.8e-62
WP_006013098.1|522499_523237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950406.1|523413_524841_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	32.4	1.7e-27
WP_006013093.1|524905_526075_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	31.0	1.5e-34
WP_096676677.1|527574_528447_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|529033_530305_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827256.1|530355_530541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051008230.1|530539_531109_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006013026.1|531158_532232_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006013023.1|532335_532971_+	chromosomal DNA replication initiator DnaA	NA	NA	NA	NA	NA
WP_006013018.1|533342_534329_+	tyrosine recombinase XerD	NA	Q83VS6	Escherichia_phage	26.6	3.4e-11
WP_039950381.1|534385_535111_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_006013011.1|535154_535424_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_006013009.1|535504_536746_+	citrate synthase	NA	NA	NA	NA	NA
WP_006013005.1|536790_538233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013002.1|538262_538445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|539319_540192_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_039950357.1|540238_540526_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_039950355.1|540820_542032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012928.1|542298_543288_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	3.0e-07
WP_006012927.1|543284_543857_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_006012925.1|544156_544681_+	cytochrome c family protein	NA	NA	NA	NA	NA
WP_006012924.1|544682_545438_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006012922.1|545480_547394_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	38.2	3.6e-113
WP_006012920.1|547522_547945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012918.1|548137_548725_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_006012916.1|548715_549024_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_006012909.1|550875_552318_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_096560722.1|552314_553679_+	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_006012905.1|553696_554419_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_006012899.1|554536_554938_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_096616077.1|555081_556170_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827257.1|556626_558567_-	hypothetical protein	NA	Q9JML0	Wolbachia_phage	84.6	1.2e-289
WP_006012795.1|559224_561423_-	hypothetical protein	NA	Q9JMK9	Wolbachia_phage	99.2	1.0e-127
WP_006012794.1|561430_562768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012791.1|563741_569672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827246.1|574506_575550_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_006012424.1|580016_580928_+	helix-turn-helix domain-containing protein	NA	A0A1B2LRS2	Wolbachia_phage	37.8	6.8e-46
WP_096676677.1|581394_582267_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	585743	660208	1482279	protease,tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(31.25%)	56	NA	NA
WP_129827248.1|585743_587063_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_129827258.1|587049_587289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145510636.1|588348_590910_+	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	35.3	5.2e-128
WP_006012006.1|590937_595599_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006012003.1|595604_595895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012001.1|595866_597243_+	PleD family two-component system response regulator	NA	G3MA91	Bacillus_virus	35.8	2.1e-22
WP_006011997.1|597265_597994_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006011994.1|598190_598739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006011989.1|599218_600286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006011986.1|600381_600600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|600786_601875_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827259.1|601940_602948_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.6	1.1e-161
WP_145510637.1|602997_603348_-	hypothetical protein	NA	A0A0U4B0A1	Bacillus_phage	53.6	5.1e-18
WP_129827261.1|604698_605571_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827263.1|606251_607124_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_039950809.1|607486_608374_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_006015187.1|608377_608728_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_006015184.1|608737_611059_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.7	7.1e-23
WP_096560606.1|611066_612620_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_096616077.1|615291_616380_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006014820.1|617146_617851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014818.1|617854_618592_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_006014815.1|618918_620301_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_006014812.1|620458_621331_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.9	3.0e-43
WP_006014805.1|621744_622086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014802.1|622126_622651_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_006014799.1|622764_624474_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_006014796.1|624451_624880_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	36.8	4.2e-14
WP_006014794.1|624879_625362_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_096560728.1|625462_626107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014782.1|626174_626636_-	dUTP diphosphatase	NA	A0A1Q1PNN8	Noumeavirus	54.8	2.5e-36
WP_129827232.1|627354_628227_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|628813_630085_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006014342.1|630351_631536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014335.1|631693_632293_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_006014332.1|632279_633227_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	46.5	1.3e-68
WP_096616077.1|633320_634409_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827264.1|634474_635737_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|636323_637196_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_145510638.1|637475_639689_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006013682.1|640888_641374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|641856_642729_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827241.1|643315_644587_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827266.1|644705_645461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827246.1|645873_646917_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_006013418.1|647325_648747_-	2-polyprenylphenol 6-hydroxylase	NA	A0A0R6PHP6	Moraxella_phage	24.9	1.0e-19
WP_006013415.1|648743_649475_-	metal ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	22.5	1.2e-05
WP_039950476.1|649466_650342_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_006013410.1|650701_650998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012481745.1|651707_651908_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_096560696.1|652057_653806_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_145510639.1|653879_655802_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.2	1.6e-150
WP_039950480.1|655874_656159_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006013396.1|656166_657399_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_039950474.1|657367_658957_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_006013385.1|659323_660208_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	668489	895453	1482279	head,protease,integrase,tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(30.77%)	173	762498:762557	821503:822433
WP_096616077.1|668489_669578_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006011971.1|669927_671253_+	dihydroorotase	NA	NA	NA	NA	NA
WP_096560695.1|671337_672522_+	ribonuclease D	NA	A0A0M5KJQ5	Mollivirus	28.9	6.8e-06
WP_006013234.1|672511_673090_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_096676677.1|673135_674008_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827234.1|674594_675866_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827233.1|676463_677735_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827267.1|678132_678333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|678670_679543_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827268.1|680129_681392_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|681713_682802_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006013953.1|683244_683472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080589543.1|683576_683885_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013958.1|683881_684871_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1B1IW95	uncultured_Mediterranean_phage	56.1	2.7e-104
WP_006013961.1|685002_685341_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006013963.1|685512_685869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013965.1|685986_687516_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	40.1	2.3e-94
WP_129827231.1|687784_688084_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_129827269.1|688080_688938_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	2.7e-52
WP_006013948.1|689384_690788_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
WP_129827270.1|691004_692276_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827271.1|692862_693735_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096616077.1|694621_695710_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006013657.1|698366_699125_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	43.9	9.9e-51
WP_006013653.1|699128_700100_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006013649.1|700251_700611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013646.1|700854_701703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827271.1|702267_703140_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827270.1|703726_704998_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006013670.1|705290_705824_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	45.2	5.6e-32
WP_096560733.1|705925_708088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|708114_709203_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_096560729.1|709277_710495_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A2L0UZ92	Agrobacterium_phage	36.0	3.2e-51
WP_007302691.1|710828_712658_-	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	40.8	8.0e-22
WP_006013690.1|712879_714214_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	34.9	1.3e-13
WP_006013692.1|714332_715352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013694.1|715357_715540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013696.1|715654_716464_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_006013698.1|716457_716805_-	membrane protein	NA	NA	NA	NA	NA
WP_006013700.1|716808_717675_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_006013703.1|717749_721019_+	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	25.3	3.2e-13
WP_096676677.1|723573_724446_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827232.1|725034_725907_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013710.1|726301_727315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013713.1|727322_727670_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_006013719.1|729803_731102_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_006013721.1|731200_732934_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.4	7.5e-62
WP_006013724.1|733079_734246_+	multifunctional ribose 5-phosphate isomerase B/3-demethylubiquinone-9 3-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	A0A2K9L4K8	Tupanvirus	33.9	3.6e-07
WP_006013725.1|734353_735484_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_039950529.1|735483_736089_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_129827314.1|736100_736595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|736853_737942_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_039950534.1|738596_739244_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006013738.1|739352_739736_+	molecular chaperone DnaK	NA	NA	NA	NA	NA
WP_006013741.1|740165_741380_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_129827272.1|741494_742367_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827268.1|742953_744216_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|744281_745370_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_096560683.1|746443_747466_-	UDP-N-acetylmuramate--alanine ligase	NA	NA	NA	NA	NA
WP_039950541.1|747492_748161_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.8	8.0e-20
WP_006013753.1|748385_749021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013756.1|749182_750340_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006013759.1|750571_751492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013763.1|751699_752206_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.9	6.4e-30
WP_006013766.1|752277_752487_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_006013769.1|752501_753128_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_006013773.1|753117_753813_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	46.5	1.2e-21
WP_096560682.1|755873_757046_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_096560603.1|757735_759007_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|759593_760466_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013790.1|761485_762271_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
762498:762557	attL	AAACCCCAGTTGCGGATTAATCAATACAGTAAAATCTAGAAATAGAGGGCTTTTTAGGCT	NA	NA	NA	NA
WP_129827232.1|762513_763386_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013808.1|764947_766042_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_145510640.1|767625_768549_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_006013819.1|768667_770467_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013822.1|770741_771479_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.4	8.2e-26
WP_006013840.1|771619_771787_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_006013842.1|771913_772570_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_006013843.1|772665_773322_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_145510641.1|773314_774709_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9V966	Bandra_megavirus	30.4	5.9e-49
WP_080589542.1|774677_775091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950557.1|775121_778058_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_006013851.1|778050_778488_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	44.8	3.2e-33
WP_006013853.1|778663_779551_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_006013855.1|779552_781103_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.0	3.5e-10
WP_006013857.1|781118_781883_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_006013859.1|782439_783951_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006013861.1|784105_784534_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_006013863.1|784599_785580_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_006013868.1|785779_787210_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_096641426.1|787202_787880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013881.1|788937_789858_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.6	1.4e-14
WP_006013883.1|789860_791240_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	8.2e-35
WP_039950562.1|791232_792342_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_039950565.1|792665_793958_+	membrane protein	NA	NA	NA	NA	NA
WP_006013892.1|794075_794723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013894.1|794869_797443_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	50.7	7.1e-250
WP_006013896.1|797484_799560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013899.1|799697_800864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013901.1|800907_801588_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_096616077.1|803477_804566_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827268.1|805539_806802_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|807388_808261_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013906.1|808846_809608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950580.1|809843_810638_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_006013910.1|810634_811393_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	5.9e-19
WP_129827273.1|811461_812166_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_129827315.1|812257_813304_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.7	1.3e-165
WP_006013920.1|813803_814982_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_006013922.1|815009_815504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827274.1|815823_817125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827231.1|817159_817459_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_096616077.1|817695_818784_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827275.1|818794_820087_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|820673_821546_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827277.1|821538_822405_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.7	6.0e-52
WP_006013933.1|822851_824111_+|tRNA	proline--tRNA ligase	tRNA	A0A1V0SEQ8	Hokovirus	22.2	1.8e-12
821503:822433	attR	AGCCTAAAAAGCCCTCTATTTCTAGATTTTACTGTATTGATTAATCCGCAACTGGGGTTTATAAAAGAGCATGAAAACTGCTGTAAAATAAGAGAGCTATGCAGGTTTTTGAACGTATCTGCTTGTAGTTATTATAAATGGATTTCTAAGGAAAAAAGTAATAAAAAATCAACAAGAGAAGAGCTCATAAAAGATATTCAAAAGATATATCAAGCGTCACAATGCAGATACGGAGCTCCCAAAATCCACGCTGAATTAAAGGTTTTAGGTAAAAATTATAAAATCAAAACAGTGCAAAATGTTATGCAGGAAAATGGCATTCAAGCCCAACTTAGAAGAAGGTTTAAGACTAAGAAACTTCAAACAGACAATAGAGTTATAACTCCTAACATATTGGATCAGAATTTCACCACTGATCAGCCAAACAAGATATGGGTAACTGATATTACATACATAAACACCAACGAAGGATGGCTATATTTGGCAGCAATAATAGATTTATATTCACGCATGGTAGTTGGTTGGTCAATGAGTAATTCAATAAATAAGCAATTAGTTATAGATGCTTTATTGATGGCTGTTGATAGGTGCAAACCCGTTAAAAATCTAGTATTTCATAGCGATCAAGGATCACAGTACACCTCTAAAAATTATCAATTTTTACTGAATACAAAAAGTATTATTTCTAGCGTGAGTCACAAAGGTTGTTGTTACGATAATGCTGTTTCGGAGAGCTTTTTTAGTTCACTAAAGAGGGAATTACTCATTGATACCTCACAACACTCCGCACAACAAGCTAGAACCGCAATATTTGAATACATAGAAATTTTTTATAACAAACAACGTAGACATTCTACTATTAACTATTGCATTCCTGAAAAATTTGATTCATCATTTTCATGAAAAAAACGTCTTAACTACCTGTCTACTT	NA	NA	NA	NA
WP_006013935.1|824107_824482_+	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_006013937.1|824534_825269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013939.1|825334_825724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013941.1|825698_826100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096560603.1|826779_828051_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|828637_829510_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_108784648.1|830367_830871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827278.1|831030_832236_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_129827279.1|832246_833335_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.9	3.3e-172
WP_006012843.1|833653_834544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950321.1|835182_836508_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_129827280.1|836900_839141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|839151_840240_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_017531625.1|840315_840906_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_006012837.1|840902_841139_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_006012835.1|841241_843179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012833.1|843337_844615_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	31.6	1.4e-52
WP_129827281.1|844795_846313_+	hypothetical protein	NA	A0A1B2LRR2	Wolbachia_phage	50.7	5.2e-83
WP_096616077.1|846367_847456_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006012827.1|847850_848759_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_006012825.1|848763_849357_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_096560709.1|849470_850562_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_129827248.1|851397_852717_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_006012815.1|852928_853858_-	permease	NA	NA	NA	NA	NA
WP_129827313.1|854521_855568_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.7	5.8e-166
WP_129827282.1|855659_855860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012806.1|855876_857037_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_096676677.1|857804_858677_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827283.1|859263_860535_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006012786.1|860821_861448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012784.1|861464_862745_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_096560603.1|863026_864298_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|865592_866681_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827284.1|866759_866900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007302667.1|866987_867545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950302.1|867726_869838_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	41.6	4.7e-74
WP_006012772.1|869838_870117_-	YggT family protein	NA	NA	NA	NA	NA
WP_129827231.1|870605_870905_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_129827269.1|870901_871759_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	2.7e-52
WP_006012948.1|871857_872286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827269.1|873206_874064_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	2.7e-52
WP_129827285.1|874060_874360_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	31.2	2.5e-05
WP_006012758.1|874635_875649_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_006012755.1|875636_876905_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.5	2.7e-133
WP_006012750.1|877237_878236_-	murC	NA	NA	NA	NA	NA
WP_039950297.1|878245_878857_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_006012742.1|878858_879335_-	bacterioferritin	NA	NA	NA	NA	NA
WP_006012739.1|879388_879862_-	RDD family protein	NA	NA	NA	NA	NA
WP_006012737.1|879861_880500_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_145510642.1|880642_881998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|883295_884384_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_145510643.1|885090_886479_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_006012720.1|886670_888077_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006012717.1|888290_891101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012714.1|891197_894248_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.5	2.3e-58
WP_129827279.1|894364_895453_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.9	3.3e-172
>prophage 11
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	911841	989126	1482279	tRNA,transposase	uncultured_virus(15.79%)	60	NA	NA
WP_129827276.1|911841_912654_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|913240_914512_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006012658.1|915512_916322_-	hypothetical protein	NA	A0A1B2LRR2	Wolbachia_phage	41.2	5.0e-24
WP_006012656.1|916441_917632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012653.1|918272_919610_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	36.8	3.9e-18
WP_006012651.1|919915_921073_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006012648.1|921573_922278_-	ComF family protein	NA	NA	NA	NA	NA
WP_006012645.1|925467_926793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012643.1|926853_927852_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	29.5	9.2e-12
WP_006012640.1|927857_928211_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_006012627.1|928410_929193_+	signal peptidase I	NA	NA	NA	NA	NA
WP_006012624.1|929196_930969_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	35.2	2.9e-85
WP_006012616.1|930946_931405_-	molecular chaperone Hsc20	NA	NA	NA	NA	NA
WP_006012614.1|931397_931784_-	iron-sulfur cluster assembly accessory protein	NA	A0A0P0CQC4	Ostreococcus_lucimarinus_virus	40.2	2.2e-14
WP_006012607.1|931789_932173_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	3.1e-53
WP_006012604.1|932350_933262_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	38.3	2.5e-16
WP_129827232.1|934133_935006_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560750.1|935667_936051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012580.1|936179_936977_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_006012576.1|937089_937380_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	35.1	1.1e-10
WP_006012568.1|937459_939118_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	49.3	1.8e-129
WP_129827316.1|939927_940974_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.5	3.7e-165
WP_129827287.1|941081_942344_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|942930_943803_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012557.1|944115_945459_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_006012555.1|945525_946797_-	MFS transporter	NA	NA	NA	NA	NA
WP_129827288.1|946871_947111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012553.1|947531_949982_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	32.3	4.7e-102
WP_096616077.1|950415_951504_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006012545.1|952272_954291_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_006012542.1|954421_955408_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_006012537.1|955409_956921_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_006012534.1|956937_957723_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_006012531.1|957715_958396_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_039950245.1|958468_959554_-	GTP cyclohydrolase II RibA	NA	A0A2I2L4Y7	Orpheovirus	38.1	5.1e-24
WP_006012524.1|959853_961089_+	phosphoesterase	NA	NA	NA	NA	NA
WP_006012513.1|962722_963280_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	62.1	1.5e-56
WP_006012510.1|963351_964809_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_096560662.1|964933_965902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012504.1|966004_967021_-	phosphate ABC transporter substrate-binding protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	40.7	9.2e-60
WP_006012501.1|967214_967772_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_006012495.1|968507_969353_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_006012492.1|969349_970165_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_006012489.1|970553_970967_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	2.9e-12
WP_006012485.1|970975_972787_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1GV45	Paramecium_bursaria_Chlorella_virus	36.7	8.1e-91
WP_006012482.1|973411_974158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012476.1|975425_975950_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_007302593.1|976066_976387_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_145510645.1|976386_977994_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.4	1.9e-147
WP_006012464.1|978344_978752_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_006012461.1|978987_979419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012458.1|979422_980046_+	heme ABC exporter ATP-binding protein CcmA	NA	NA	NA	NA	NA
WP_006012455.1|980108_981809_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_006012452.1|981943_982507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012449.1|982592_982841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012446.1|983062_984760_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.3	6.9e-52
WP_006012444.1|984919_985618_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_051008229.1|985767_986940_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_129827289.1|987796_988261_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_096676677.1|988253_989126_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	1007384	1028451	1482279	protease,transposase	Wolbachia_phage(70.59%)	21	NA	NA
WP_006012370.1|1007384_1007714_+	helix-turn-helix transcriptional regulator	NA	A0A1B2LRS2	Wolbachia_phage	41.7	3.9e-12
WP_006012367.1|1007736_1008099_+	helix-turn-helix transcriptional regulator	NA	A0A1B2LRR8	Wolbachia_phage	37.9	3.4e-09
WP_129827290.1|1008461_1009082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|1009502_1010375_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012357.1|1010670_1012161_-	ankyrin repeat domain-containing protein	NA	F8QZT5	Wolbachia_phage	89.5	2.0e-196
WP_039950216.1|1012185_1012650_-	hypothetical protein	NA	A0A1B2LRT3	Wolbachia_phage	87.2	1.1e-63
WP_006012353.1|1012794_1013265_-	hypothetical protein	NA	E9P621	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	74.8	3.1e-63
WP_006012344.1|1014144_1014636_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1B2LRS7	Wolbachia_phage	50.7	1.6e-30
WP_006012341.1|1014687_1015485_+	ATP-binding protein	NA	E9P631	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.5	1.7e-125
WP_006012339.1|1015508_1015997_+	hypothetical protein	NA	A0A1B2LRU0	Wolbachia_phage	66.9	5.0e-56
WP_006012334.1|1015993_1017220_+	AAA family ATPase	NA	A0A1B2LRQ9	Wolbachia_phage	63.0	1.3e-140
WP_006012332.1|1017243_1019298_+	AAA family ATPase	NA	A0A1B2LRQ1	Wolbachia_phage	76.9	0.0e+00
WP_039950207.1|1019545_1020658_-	hypothetical protein	NA	Q9JMN2	Wolbachia_phage	61.2	2.4e-130
WP_096560645.1|1020623_1021820_-	hypothetical protein	NA	Q9JMN1	Wolbachia_phage	62.3	3.1e-147
WP_006012324.1|1022015_1022234_+	hypothetical protein	NA	A0A1B2LRU8	Wolbachia_phage	52.9	4.0e-13
WP_129827292.1|1022133_1023816_+	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	50.3	1.3e-140
WP_096616077.1|1023865_1024954_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006012309.1|1025269_1026004_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.5	2.6e-11
WP_006012302.1|1026099_1026435_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_096560629.1|1026436_1027726_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_006012296.1|1027797_1028451_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	4.1e-37
>prophage 13
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	1054862	1122812	1482279	tRNA,transposase	Staphylococcus_phage(25.0%)	48	NA	NA
WP_129827232.1|1054862_1055735_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012187.1|1056225_1056528_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_006012184.1|1056538_1056808_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_145510646.1|1056932_1058096_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	48.7	1.0e-91
WP_096560655.1|1058198_1058864_+	TenA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006012167.1|1058903_1059563_+	TenA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006012165.1|1059610_1060438_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_006012163.1|1060438_1060927_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_006012162.1|1060952_1061420_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006012160.1|1061485_1063270_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	58.9	6.1e-200
WP_039950199.1|1063318_1064389_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129827232.1|1068369_1069242_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827234.1|1069828_1071100_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006012150.1|1071911_1072121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080589533.1|1072194_1072572_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_006012144.1|1072555_1072690_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_006012141.1|1072797_1073886_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_145510647.1|1073973_1075419_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_006012135.1|1075424_1075766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|1076550_1077423_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1078009_1079281_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006012123.1|1079844_1080315_-	P44/Msp2 family outer membrane protein	NA	NA	NA	NA	NA
WP_006012113.1|1081171_1082407_-	NTP transferase domain-containing protein	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	29.8	1.4e-17
WP_006012109.1|1082407_1083451_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.4	4.9e-32
WP_039950189.1|1084321_1086289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012104.1|1086329_1086926_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.6	6.0e-27
WP_006012102.1|1086983_1087571_+	CvpA family protein	NA	NA	NA	NA	NA
WP_039950186.1|1087702_1089061_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.6	7.5e-41
WP_096560605.1|1089157_1091167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012089.1|1091357_1092950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012088.1|1093178_1093886_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_006012085.1|1093885_1094713_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_006012082.1|1094705_1095662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827294.1|1096612_1097884_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|1098470_1099343_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012066.1|1099375_1101904_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	36.5	6.9e-56
WP_006012063.1|1102007_1103474_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_129827295.1|1106399_1107272_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012047.1|1108557_1109424_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006012044.1|1109658_1110342_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006012041.1|1110338_1111124_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_006012038.1|1111132_1112467_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006012035.1|1112469_1113936_+	amino acid carrier protein	NA	NA	NA	NA	NA
WP_006012032.1|1114173_1114749_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_006012029.1|1114743_1116555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096560705.1|1116610_1117507_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_096641494.1|1118162_1121648_+	peptidase M2	NA	NA	NA	NA	NA
WP_096616077.1|1121723_1122812_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 14
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	1126260	1271219	1482279	tail,protease,tRNA,transposase	Wolbachia_phage(27.03%)	115	NA	NA
WP_006015767.1|1126260_1128369_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_006015765.1|1128372_1129212_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_006015763.1|1129256_1130015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|1130154_1131027_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827231.1|1131706_1132006_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_129827296.1|1132002_1132860_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	4.6e-52
WP_096560711.1|1132882_1133902_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_039950909.1|1133894_1134920_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_006015761.1|1134903_1136952_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_006015760.1|1136957_1137170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051008240.1|1137387_1138884_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.7e-54
WP_039950913.1|1138980_1139622_-	dioxygenase	NA	NA	NA	NA	NA
WP_145510648.1|1139788_1142929_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_145510649.1|1143056_1145660_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_006015752.1|1145666_1146170_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_006015750.1|1146333_1146993_+	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_006015748.1|1147007_1147712_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.7	3.6e-39
WP_006015746.1|1147747_1148347_+	SCO family protein	NA	NA	NA	NA	NA
WP_129827234.1|1149253_1150525_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|1151111_1151984_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_039950902.1|1152400_1153093_-	ribonuclease III	NA	A0A0P0YNG1	Yellowstone_lake_phycodnavirus	35.2	1.7e-28
WP_006015737.1|1153185_1154253_-	quinone-dependent dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	25.2	8.6e-16
WP_006015735.1|1154324_1155122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015733.1|1155307_1156198_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_006015731.1|1156256_1157255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015729.1|1157311_1159591_-	AAA domain-containing protein	NA	A0A223W0B1	Agrobacterium_phage	39.5	9.4e-145
WP_006015727.1|1159888_1161115_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	8.5e-52
WP_006015726.1|1161149_1161401_-	cold-shock protein	NA	NA	NA	NA	NA
WP_006015725.1|1161576_1162911_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_006015724.1|1162929_1163802_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_006015723.1|1163968_1165189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015721.1|1165185_1165917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096560694.1|1165909_1167139_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_129827232.1|1167540_1168413_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006015704.1|1169328_1170567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015702.1|1170643_1171009_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_006015700.1|1171005_1171383_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_039950891.1|1173141_1173759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015696.1|1174236_1174437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096560652.1|1176221_1178105_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	37.2	3.0e-32
WP_039950889.1|1178244_1178547_-	cation:proton antiporter subunit C	NA	NA	NA	NA	NA
WP_006015683.1|1178546_1178963_-	Na(+)/H(+) antiporter subunit B	NA	NA	NA	NA	NA
WP_006015680.1|1178955_1179483_-	DUF4040 domain-containing protein	NA	NA	NA	NA	NA
WP_006015677.1|1179494_1179767_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_039950888.1|1179773_1180019_-	multiple resistance and pH regulation protein F (MrpF / PhaF) superfamily	NA	NA	NA	NA	NA
WP_006015671.1|1180047_1180440_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_006015668.1|1180500_1180797_-	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	36.2	2.4e-08
WP_006015665.1|1181655_1182156_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	3.5e-20
WP_096560651.1|1182155_1183985_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	75.3	1.9e-252
WP_039950896.1|1183989_1184259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015657.1|1184391_1185417_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_006015654.1|1185419_1186292_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_096560650.1|1186295_1187759_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.2	7.1e-21
WP_006015648.1|1188080_1192265_+	collagen-like protein	NA	NA	NA	NA	NA
WP_006015645.1|1192269_1193595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|1193739_1194828_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_096616077.1|1195786_1196875_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_145510650.1|1197249_1197747_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145510651.1|1197799_1198744_-|tail	phage tail protein	tail	A0A1B2LRT8	Wolbachia_phage	77.0	1.0e-137
WP_006015620.1|1198744_1198954_-|tail	tail protein	tail	A0A1B2LRT9	Wolbachia_phage	72.5	1.1e-23
WP_039950887.1|1198950_1199298_-|tail	phage tail protein	tail	A0A1B2LRV9	Wolbachia_phage	74.6	1.4e-44
WP_145510652.1|1199297_1201562_-|tail	phage tail tape measure protein	tail	E9P5Y8	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	62.4	2.3e-220
WP_145510653.1|1201671_1201929_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	94.1	8.0e-37
WP_145510654.1|1202060_1202984_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	94.8	6.2e-148
WP_145510655.1|1203079_1203586_-|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	97.6	1.5e-90
WP_145510656.1|1207660_1207846_-	hypothetical protein	NA	A0A1B2LRW5	Wolbachia_phage	70.3	1.3e-17
WP_145510657.1|1207848_1209030_-	hypothetical protein	NA	A0A1B2LRR4	Wolbachia_phage	87.2	2.0e-199
WP_096616077.1|1210734_1211823_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827297.1|1211872_1212604_-	triosephosphate isomerase	NA	NA	NA	NA	NA
WP_006015557.1|1212778_1213573_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_006015555.1|1213696_1215184_+	IMP dehydrogenase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	40.2	1.3e-41
WP_145510658.1|1215449_1216868_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_006015546.1|1217062_1217665_-	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_006015543.1|1217898_1219698_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_006015540.1|1219832_1220147_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_006015537.1|1220157_1221144_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_006015534.1|1221206_1221767_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_096560685.1|1221782_1222781_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096616077.1|1222945_1224034_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827285.1|1226131_1226431_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	31.2	2.5e-05
WP_129827296.1|1226427_1227285_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	4.6e-52
WP_006015517.1|1227616_1230319_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_096616077.1|1231213_1232302_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006015498.1|1232383_1232749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015496.1|1232882_1233110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015493.1|1233137_1233572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015490.1|1233782_1234523_-	DsbA family protein	NA	NA	NA	NA	NA
WP_006015487.1|1234862_1236746_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_006015485.1|1236793_1238281_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_006015482.1|1238321_1238849_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	60.3	2.3e-46
WP_129827317.1|1240093_1241140_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.0	7.5e-166
WP_129827298.1|1241723_1242917_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_006015468.1|1243152_1243944_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_006015465.1|1243950_1244400_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.1	3.5e-27
WP_006015458.1|1245503_1246025_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_006015456.1|1246017_1246434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015454.1|1246700_1247267_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	42.9	8.8e-36
WP_039950872.1|1247260_1248583_-	insulinase family protein	NA	NA	NA	NA	NA
WP_006015450.1|1248569_1249901_-	insulinase family protein	NA	NA	NA	NA	NA
WP_006015448.1|1249905_1250382_-	signal peptidase II	NA	NA	NA	NA	NA
WP_006015446.1|1250378_1251311_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_006015443.1|1251381_1251753_+	glutaredoxin	NA	NA	NA	NA	NA
WP_006015439.1|1251848_1252721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015434.1|1252961_1254758_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	40.7	8.2e-19
WP_006015428.1|1255946_1257323_-	malonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_006015425.1|1257605_1258298_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	33.8	2.7e-26
WP_006015419.1|1258518_1260081_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	25.5	1.3e-07
WP_006015416.1|1260308_1261769_-	secretion system protein	NA	NA	NA	NA	NA
WP_129827248.1|1262462_1263782_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_096676677.1|1264128_1265001_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1265587_1266859_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006015382.1|1268081_1268792_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_006015380.1|1268934_1269753_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_006015378.1|1269822_1269951_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_096676677.1|1270346_1271219_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	1274898	1355954	1482279	tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(40.0%)	59	NA	NA
WP_145510659.1|1274898_1275987_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.5	5.1e-173
WP_006013054.1|1276349_1276598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|1277230_1278103_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1278689_1279961_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_039950853.1|1280432_1280594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015355.1|1280668_1281895_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_006015353.1|1281954_1282914_+	P44/Msp2 family outer membrane protein	NA	NA	NA	NA	NA
WP_129827233.1|1283180_1284452_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|1285796_1286885_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827300.1|1287091_1287286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015341.1|1287428_1288934_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_006015339.1|1289006_1289381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015337.1|1289499_1290378_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_096560746.1|1290368_1291253_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_006015333.1|1291320_1292505_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_006015331.1|1292501_1293092_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_096616077.1|1294096_1295185_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006015319.1|1295811_1297767_+	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	37.6	6.4e-102
WP_129827301.1|1298023_1298965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|1298985_1300074_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_145510660.1|1300804_1301800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|1301849_1302938_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_039950839.1|1303220_1303979_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_006015304.1|1303959_1304913_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_006015300.1|1305476_1305743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950835.1|1305772_1306150_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_006015295.1|1306211_1307297_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.2	3.6e-30
WP_096616077.1|1308455_1309544_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_145510661.1|1309521_1309824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015279.1|1309954_1312606_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006015276.1|1312831_1313905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015273.1|1314074_1314878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950829.1|1314978_1316139_+	porin	NA	NA	NA	NA	NA
WP_006015267.1|1316402_1317743_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_096560716.1|1317775_1318882_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.4	7.0e-45
WP_096560717.1|1319533_1320226_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	41.8	4.4e-45
WP_006015253.1|1321412_1322654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015251.1|1322800_1324891_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_006015248.1|1324941_1327275_-	ankyrin repeat domain-containing protein	NA	Q9JML0	Wolbachia_phage	36.2	2.8e-67
WP_006015245.1|1327388_1329872_+	DNA mismatch repair protein MutS	NA	A0A2H4UUR2	Bodo_saltans_virus	21.6	8.6e-35
WP_129827233.1|1330383_1331655_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|1332449_1333322_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827234.1|1333908_1335180_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827304.1|1335230_1335509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012858.1|1335989_1337360_-	magnesium transporter	NA	NA	NA	NA	NA
WP_096560601.1|1337514_1338615_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_039950324.1|1338790_1340044_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_006012864.1|1340239_1342537_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006012865.1|1342656_1343580_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_006012867.1|1343587_1344850_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.1	1.7e-34
WP_096560736.1|1345027_1345162_+	hypothetical protein	NA	A0A1U9WQS3	Geobacillus_phage	64.7	9.3e-05
WP_129827263.1|1345158_1346031_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1346377_1347649_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|1348235_1349108_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096641534.1|1349100_1349625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145510662.1|1349689_1351498_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	23.8	4.2e-07
WP_096676677.1|1352004_1352877_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1353463_1354735_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827263.1|1355081_1355954_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP041923	Wolbachia pipientis strain wAlbB-FL2016 chromosome, complete genome	1482279	1367790	1446401	1482279	tRNA,transposase	Wolbachia_phage(50.0%)	58	NA	NA
WP_096676677.1|1367790_1368663_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012884.1|1369458_1369764_+	hypothetical protein	NA	Q9JMM1	Wolbachia_phage	76.2	9.2e-40
WP_129827249.1|1369864_1370737_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_136122018.1|1370952_1372896_-	hypothetical protein	NA	Q9JML0	Wolbachia_phage	84.8	7.2e-287
WP_129827246.1|1386496_1387540_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_145510663.1|1387760_1388660_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	61.6	8.1e-84
WP_006014015.1|1388788_1389718_+	helix-turn-helix domain-containing protein	NA	A0A1B2LRR8	Wolbachia_phage	57.3	6.2e-79
WP_006014017.1|1389889_1390546_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	60.5	7.0e-69
WP_006014019.1|1390644_1391832_+	hypothetical protein	NA	A0A1B2LRQ6	Wolbachia_phage	82.7	1.0e-171
WP_006014021.1|1391928_1392843_+	helix-turn-helix transcriptional regulator	NA	E9P5Z7	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	58.9	1.3e-84
WP_006014023.1|1392868_1393780_+	helix-turn-helix transcriptional regulator	NA	A0A1B2LRR7	Wolbachia_phage	58.4	1.5e-85
WP_129827306.1|1393875_1394790_-	patatin	NA	A0A1B2LRS3	Wolbachia_phage	77.9	1.5e-133
WP_006013123.1|1394735_1395302_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	94.7	4.6e-85
WP_096616077.1|1395390_1396479_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827307.1|1396494_1397457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014035.1|1398125_1399379_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_006014037.1|1399401_1399920_-	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	34.4	1.4e-11
WP_006014039.1|1399932_1401834_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.9	9.9e-132
WP_006014041.1|1401830_1402013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950622.1|1402019_1402502_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_006014044.1|1402693_1404022_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_006014046.1|1404325_1405336_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	29.0	3.0e-18
WP_096676677.1|1406112_1406985_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014054.1|1407550_1408531_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_006014056.1|1408536_1409130_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.5	1.1e-25
WP_006014058.1|1409137_1409923_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_125855783.1|1410461_1410827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012481935.1|1410811_1411087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014063.1|1411224_1412262_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	2.1e-59
WP_006014065.1|1412258_1412981_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	38.5	7.0e-38
WP_006014067.1|1413055_1413754_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_006014069.1|1413750_1414128_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_006014071.1|1414381_1415632_+	DUF3333 domain-containing protein	NA	NA	NA	NA	NA
WP_006014073.1|1415628_1416426_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	A9YX36	Burkholderia_phage	32.0	1.2e-22
WP_096616077.1|1416495_1417584_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006014087.1|1417742_1418336_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_006014085.1|1418351_1419167_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	34.5	1.1e-28
WP_039950626.1|1419184_1419412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|1419879_1420752_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096676677.1|1421938_1422811_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_039950628.1|1422850_1423402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014095.1|1423793_1424813_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_129827318.1|1425100_1425202_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_129827234.1|1426175_1427447_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|1428426_1429515_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006014110.1|1430586_1431042_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_006014112.1|1431044_1431350_-	NADH:ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_006014114.1|1431414_1432863_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_006014116.1|1432908_1434012_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_145510664.1|1434060_1435308_-	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.3	2.5e-35
WP_129827246.1|1436149_1437193_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_006013990.1|1437509_1438496_-	helix-turn-helix transcriptional regulator	NA	A0A1B2LRR7	Wolbachia_phage	97.0	1.1e-174
WP_006013992.1|1438542_1439451_-	helix-turn-helix domain-containing protein	NA	A0A1B2LRS2	Wolbachia_phage	97.0	3.2e-157
WP_129827233.1|1439568_1440840_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_051008237.1|1441412_1442540_-	hypothetical protein	NA	A0A1B2LRQ6	Wolbachia_phage	93.1	4.9e-179
WP_006014130.1|1442770_1443436_-	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	99.1	4.8e-118
WP_006014132.1|1443606_1444545_-	helix-turn-helix domain-containing protein	NA	A0A1B2LRR8	Wolbachia_phage	99.7	4.1e-163
WP_006014134.1|1444613_1446401_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	99.2	0.0e+00
