The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023483	Brochothrix thermosphacta strain BI chromosome, complete genome	2647794	184475	206571	2647794	portal,holin,head,protease,terminase,tail,capsid	Staphylococcus_phage(30.77%)	23	NA	NA
WP_096699175.1|184475_184874_-|holin	phage holin family protein	holin	D7RWK5	Brochothrix_phage	37.0	3.0e-14
WP_096699177.1|184904_185747_-	glycoside hydrolase family protein	NA	A0A1X9SGL2	Bacillus_phage	50.9	7.7e-36
WP_096699179.1|185736_186189_-	DUF1617 family protein	NA	D7RWK3	Brochothrix_phage	94.5	7.4e-70
WP_096699181.1|186188_188402_-	hypothetical protein	NA	D7RWK2	Brochothrix_phage	64.9	3.8e-191
WP_096699183.1|188416_190870_-	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	34.5	9.0e-69
WP_096699185.1|190884_192912_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096699187.1|192913_196870_-	tape measure protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	38.4	5.9e-46
WP_096699189.1|197154_197466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157759354.1|197558_198155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096699193.1|198156_198549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157759355.1|198545_198926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069127912.1|198925_199261_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_096699197.1|199236_199557_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8T8	uncultured_Caudovirales_phage	35.6	1.0e-12
WP_096699199.1|199608_200787_-|capsid	phage major capsid protein	capsid	U3PBL1	Staphylococcus_phage	44.7	7.9e-63
WP_096699201.1|200843_201413_-|head,protease	HK97 family phage prohead protease	head,protease	D2JLE7	Staphylococcus_phage	48.6	6.5e-39
WP_096699203.1|201414_202575_-|portal	phage portal protein	portal	A0A1D6Z2A2	Staphylococcus_phage	40.5	3.3e-61
WP_157759356.1|202587_204309_-|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	39.0	3.3e-110
WP_096699207.1|204283_204751_-|terminase	phage terminase small subunit P27 family	terminase	D2JLE3	Staphylococcus_phage	45.3	1.8e-26
WP_096699209.1|205038_205368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069128546.1|205364_205595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096699211.1|205721_205982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157759357.1|205997_206174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096699213.1|206199_206571_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	45.5	1.3e-19
>prophage 2
NZ_CP023483	Brochothrix thermosphacta strain BI chromosome, complete genome	2647794	217328	227397	2647794	transposase	Bacillus_virus(28.57%)	8	NA	NA
WP_069126547.1|217328_218153_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.9	3.8e-72
WP_069126548.1|218168_219662_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.8	8.9e-112
WP_069126550.1|219935_220319_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_069141940.1|220573_221956_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	42.4	9.7e-20
WP_096699230.1|222239_223541_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	1.2e-11
WP_096699233.1|223772_224648_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	2.3e-06
WP_029092153.1|224671_226402_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	46.5	1.9e-145
WP_069120269.1|226431_227397_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	42.5	6.3e-66
>prophage 3
NZ_CP023483	Brochothrix thermosphacta strain BI chromosome, complete genome	2647794	270698	318205	2647794	transposase,bacteriocin,plate,holin,protease,tRNA,tail	Brochothrix_phage(54.17%)	52	NA	NA
WP_069120071.1|270698_271040_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_029092189.1|271068_271377_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_069125239.1|271531_271912_-	RidA family protein	NA	NA	NA	NA	NA
WP_096699235.1|272266_273568_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	1.6e-11
WP_029092191.1|273801_274596_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_069120080.1|274598_275282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069120082.1|275314_275866_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_036027602.1|275883_276735_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_029092192.1|276813_277830_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_069120084.1|278149_278824_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_069126064.1|278802_279483_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_069126065.1|279683_280991_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_096699469.1|281009_283649_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	6.3e-153
WP_029092197.1|283936_285250_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_029092198.1|285261_285843_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_069120097.1|285943_287197_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.2	8.5e-140
WP_029092200.1|287454_288735_-	trigger factor	NA	NA	NA	NA	NA
WP_069126066.1|288869_289730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069126068.1|289813_290113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069126070.1|291099_291399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069126629.1|291504_292323_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_069126630.1|292324_293797_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	24.4	4.9e-30
WP_069134798.1|295367_296291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141691204.1|296460_297066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069133585.1|297175_297847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069126683.1|297858_298293_-	hypothetical protein	NA	A0A2I7SC40	Paenibacillus_phage	31.0	1.6e-13
WP_069126681.1|298308_298761_-	RusA family crossover junction endodeoxyribonuclease	NA	D7RWN7	Brochothrix_phage	44.8	2.0e-22
WP_069126680.1|298757_298955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069126678.1|298955_299390_-	DnaD domain protein	NA	A8ASN4	Listeria_phage	29.5	1.4e-12
WP_069120909.1|300141_300426_+	DUF2089 family protein	NA	NA	NA	NA	NA
WP_069126046.1|300409_300700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141691144.1|301063_301249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069126048.1|301311_301599_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_029092205.1|301785_302262_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
WP_069126051.1|302387_303227_-	glycoside hydrolase family protein	NA	B7SSN6	Bacillus_phage	57.3	3.3e-39
WP_069126052.1|303407_304220_-	hypothetical protein	NA	D7RWK6	Brochothrix_phage	61.3	1.5e-89
WP_029092207.1|304223_304499_-|holin	phage holin	holin	D7RWE6	Brochothrix_phage	79.8	2.2e-32
WP_029092208.1|304511_304733_-|holin	holin	holin	Q77MU0	Lactococcus_phage	38.4	3.0e-08
WP_081312083.1|304732_304897_-	XkdX family protein	NA	NA	NA	NA	NA
WP_069126053.1|304899_305205_-	DUF2977 domain-containing protein	NA	A0EWU4	Staphylococcus_virus	33.8	6.0e-07
WP_069126055.1|305204_306902_-|plate	phage baseplate upper protein	plate	D7RWE2	Brochothrix_phage	47.3	1.0e-42
WP_069126057.1|306926_309320_-|plate	phage baseplate upper protein	plate	D7RWE1	Brochothrix_phage	38.6	6.5e-88
WP_069126058.1|309332_312083_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	74.8	0.0e+00
WP_069126060.1|312079_312847_-	hypothetical protein	NA	D7RWD9	Brochothrix_phage	56.1	9.6e-78
WP_069126061.1|312862_314248_-	hypothetical protein	NA	D7RWD8	Brochothrix_phage	50.9	8.6e-85
WP_069120357.1|314262_314550_-	hypothetical protein	NA	D7RWD7	Brochothrix_phage	60.9	6.0e-25
WP_029092213.1|314609_314957_-	hypothetical protein	NA	D7RWD6	Brochothrix_phage	88.7	5.9e-51
WP_069126063.1|315038_315563_-|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	75.0	3.2e-64
WP_069120353.1|316112_316604_-	hypothetical protein	NA	D7RWH7	Brochothrix_phage	50.3	1.8e-37
WP_036027683.1|316651_316873_-	hypothetical protein	NA	D7RWH2	Brochothrix_phage	65.7	5.5e-18
WP_029092217.1|317157_317355_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	50.0	7.1e-09
WP_036027603.1|317539_318205_+	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	36.6	9.7e-26
>prophage 4
NZ_CP023483	Brochothrix thermosphacta strain BI chromosome, complete genome	2647794	489528	532526	2647794	integrase,portal,holin,head,protease,terminase,tail,capsid	Listeria_phage(41.67%)	54	486136:486157	531119:531140
486136:486157	attL	TTTATTACATGTGGATTGGCAT	NA	NA	NA	NA
WP_096699250.1|489528_490350_-	hypothetical protein	NA	D7RWK6	Brochothrix_phage	95.2	3.9e-141
WP_016037788.1|490351_490627_-|holin	phage holin	holin	D7RWE6	Brochothrix_phage	100.0	6.8e-42
WP_069133593.1|490623_490956_-	hypothetical protein	NA	D7RWE5	Brochothrix_phage	95.5	1.5e-51
WP_069137564.1|491022_491256_-	hypothetical protein	NA	D7RWK4	Brochothrix_phage	94.8	5.6e-29
WP_069133595.1|491257_491698_-	DUF1617 family protein	NA	D7RWK3	Brochothrix_phage	93.2	8.5e-71
WP_096699252.1|491697_493911_-	hypothetical protein	NA	D7RWK2	Brochothrix_phage	63.8	7.1e-190
WP_069133597.1|493926_496380_-	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	34.2	3.4e-68
WP_096699254.1|496394_498419_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096699256.1|498418_503983_-|tail	phage tail tape measure protein	tail	A0A1Q1PW35	Staphylococcus_phage	45.1	1.4e-72
WP_069133600.1|504188_504533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069133601.1|504603_505032_-	Ig domain-containing protein	NA	A0A1X9I9L0	Staphylococcus_phage	46.4	7.4e-19
WP_069133602.1|505091_505673_-	hypothetical protein	NA	A0A059T7Y4	Listeria_phage	38.9	2.9e-26
WP_069133603.1|505720_506113_-	DUF3168 domain-containing protein	NA	A8ATA3	Listeria_phage	50.0	2.2e-30
WP_069133604.1|506109_506511_-	hypothetical protein	NA	A0A059T5F3	Listeria_phage	50.4	2.9e-33
WP_069135243.1|506507_506870_-|head,tail	head-tail adaptor protein	head,tail	A8ATA1	Listeria_phage	66.1	2.3e-37
WP_069135245.1|506853_507141_-	hypothetical protein	NA	A0A059T7R0	Listeria_phage	50.5	2.2e-19
WP_096699258.1|507213_508356_-|capsid	phage major capsid protein	capsid	A8AT98	Listeria_phage	67.2	7.2e-146
WP_069119717.1|508381_509143_-|protease	Clp protease ClpP	protease	A8AT97	Listeria_phage	57.4	1.2e-59
WP_096699260.1|509142_510321_-|portal	phage portal protein	portal	A0A1W6JPQ9	Staphylococcus_phage	42.3	1.5e-85
WP_096699262.1|510341_511985_-|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	70.4	1.3e-236
WP_096699473.1|511981_512236_-	hypothetical protein	NA	A0A059T7Y1	Listeria_phage	50.6	8.2e-18
WP_096699264.1|512437_512743_-	HNH endonuclease	NA	A8ATF8	Listeria_phage	67.3	1.2e-34
WP_069135255.1|512732_513197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069135257.1|513211_513715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069135259.1|514330_514690_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C1	Bacillus_phage	37.7	1.2e-11
WP_096699268.1|514924_515482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157759364.1|515575_515719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096699475.1|515715_515991_-	DUF3310 domain-containing protein	NA	A0A0E3TA88	Enterococcus_phage	56.9	6.4e-16
WP_096699269.1|516473_516764_-	hypothetical protein	NA	A0A0U1UXU0	Staphylococcus_phage	70.2	2.6e-31
WP_096699271.1|516764_516947_-	hypothetical protein	NA	D7RWG7	Brochothrix_phage	100.0	6.5e-25
WP_096699273.1|516943_517225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096699275.1|517221_517626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096699277.1|517600_517945_-	VRR-NUC domain-containing protein	NA	A0A1X9I642	Streptococcus_phage	62.9	5.3e-28
WP_096699279.1|518214_520524_-	DNA primase	NA	Q8W5V7	Listeria_phage	54.8	1.2e-235
WP_096699477.1|520544_521051_-	DUF669 domain-containing protein	NA	A0A059T5G4	Listeria_phage	52.7	2.9e-46
WP_096699281.1|521095_521440_-	DUF1140 family protein	NA	NA	NA	NA	NA
WP_096699479.1|521453_522668_-	DEAD/DEAH box helicase	NA	R4IBK4	Listeria_phage	58.7	4.8e-124
WP_096699303.1|522781_523468_-	AAA family ATPase	NA	R4IDY8	Listeria_phage	68.3	1.2e-90
WP_096699305.1|523480_523960_-	siphovirus Gp157 family protein	NA	W8CYU7	Bacillus_phage	42.8	3.1e-26
WP_069118578.1|523975_524176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069118576.1|524225_524438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157759365.1|524438_524612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081313992.1|524616_524886_-	excisionase	NA	NA	NA	NA	NA
WP_096699481.1|524951_525632_-	Rha family transcriptional regulator	NA	D2IZW4	Enterococcus_phage	43.8	4.0e-35
WP_096699307.1|525728_525920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096699309.1|525903_526173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157759366.1|526224_526602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096699312.1|526634_526865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069118572.1|526928_527141_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096699314.1|527311_528016_+	LexA family transcriptional regulator	NA	O64370	Lactobacillus_phage	33.5	5.8e-21
WP_096699316.1|528038_529001_+	tetratricopeptide repeat protein	NA	D7RWC7	Brochothrix_phage	83.0	2.3e-12
WP_157759367.1|528993_529758_+	SHOCT domain-containing protein	NA	X5JB37	Clostridium_phage	42.1	6.3e-29
WP_069118569.1|529874_531023_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	41.1	2.0e-66
WP_029092370.1|531122_532526_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.4e-45
531119:531140	attR	TTTATTACATGTGGATTGGCAT	NA	NA	NA	NA
>prophage 5
NZ_CP023483	Brochothrix thermosphacta strain BI chromosome, complete genome	2647794	1270603	1280394	2647794		Bacillus_phage(50.0%)	10	NA	NA
WP_069125023.1|1270603_1272358_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	23.5	7.0e-23
WP_069125024.1|1272829_1273450_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	48.1	6.1e-06
WP_069119803.1|1273641_1274076_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	42.4	1.6e-05
WP_029091306.1|1274540_1276325_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.4	1.0e-53
WP_029091305.1|1276341_1276662_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_029091304.1|1276753_1277350_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_029091303.1|1277371_1277614_+	YaaL family protein	NA	NA	NA	NA	NA
WP_029091302.1|1277847_1278510_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	1.9e-53
WP_029091301.1|1278511_1278841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069125026.1|1278903_1280394_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	36.0	3.2e-77
>prophage 6
NZ_CP023483	Brochothrix thermosphacta strain BI chromosome, complete genome	2647794	1862159	1875654	2647794		Synechococcus_phage(40.0%)	13	NA	NA
WP_029090604.1|1862159_1863347_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.3	4.3e-32
WP_029090603.1|1863367_1863724_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_069119305.1|1864100_1864589_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.1	1.7e-19
WP_069125098.1|1864581_1865703_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_029090600.1|1865719_1867021_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.8	7.5e-22
WP_069125099.1|1867189_1867912_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	39.0	4.9e-39
WP_029090598.1|1867914_1868169_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A1D8KKU6	Synechococcus_phage	36.1	9.4e-06
WP_069119297.1|1868165_1868846_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_069125100.1|1868835_1871055_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	4.4e-155
WP_029090595.1|1871039_1872473_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	9.6e-55
WP_069125102.1|1872486_1873527_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.8	6.1e-59
WP_069125103.1|1873531_1874119_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	31.9	1.1e-17
WP_069129255.1|1874115_1875654_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.2	1.5e-74
>prophage 7
NZ_CP023483	Brochothrix thermosphacta strain BI chromosome, complete genome	2647794	2351909	2360397	2647794		Staphylococcus_phage(42.86%)	9	NA	NA
WP_069125142.1|2351909_2352527_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.6	3.5e-22
WP_080712972.1|2352844_2353117_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.2	1.1e-20
WP_069126469.1|2353219_2353714_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_069120683.1|2354043_2355240_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	70.4	8.6e-150
WP_069126471.1|2355326_2356013_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	43.4	2.1e-47
WP_029092481.1|2356109_2358011_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	29.3	6.6e-27
WP_036042322.1|2358136_2358526_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_029092479.1|2358607_2359618_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	26.4	9.2e-28
WP_069126472.1|2359821_2360397_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	43.9	2.0e-35
>prophage 8
NZ_CP023483	Brochothrix thermosphacta strain BI chromosome, complete genome	2647794	2508260	2518767	2647794		Bacillus_phage(33.33%)	6	NA	NA
WP_069125542.1|2508260_2510909_+	DNA mismatch repair protein MutS	NA	A0A2P0VN50	Tetraselmis_virus	23.5	1.8e-38
WP_069125544.1|2511039_2512896_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.5	5.8e-68
WP_029090970.1|2513090_2513780_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	5.3e-27
WP_069125545.1|2513772_2514951_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.3	1.4e-27
WP_069125546.1|2515027_2516971_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.9	1.8e-19
WP_069125548.1|2516970_2518767_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	35.8	5.5e-31
