The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010588	Phaeobacter gallaeciensis strain P11 chromosome, complete genome	3776904	1033313	1096003	3776904	protease,transposase,integrase	uncultured_Mediterranean_phage(20.0%)	53	1085641:1085669	1089074:1089102
WP_024096488.1|1033313_1034471_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_024096489.1|1034470_1035361_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_024096491.1|1035631_1037146_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	7.1e-24
WP_040103920.1|1037695_1038352_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096493.1|1038502_1039087_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_014875267.1|1039410_1039734_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_024096494.1|1039733_1040597_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_024096495.1|1040816_1042592_+	DUF1217 domain-containing protein	NA	NA	NA	NA	NA
WP_024096496.1|1043409_1044042_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_024096497.1|1044189_1045071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096498.1|1045380_1046646_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_024096499.1|1046790_1048356_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.5	7.8e-34
WP_024096500.1|1048431_1048845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096501.1|1049073_1049751_+	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_024096502.1|1049862_1051146_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	34.1	1.1e-12
WP_040103907.1|1051242_1052145_+	EamA family transporter	NA	NA	NA	NA	NA
WP_024096504.1|1052268_1052883_+	septation protein IspZ	NA	NA	NA	NA	NA
WP_024096505.1|1053186_1054377_+	O-succinylhomoserine sulfhydrylase	NA	NA	NA	NA	NA
WP_024096506.1|1054587_1055691_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_024096507.1|1055915_1056677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096508.1|1056741_1058190_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_024096509.1|1058347_1059586_+	aspartate kinase	NA	NA	NA	NA	NA
WP_024096510.1|1059632_1061873_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_145957941.1|1061847_1062141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096511.1|1062544_1064839_+	bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase	NA	NA	NA	NA	NA
WP_024096512.1|1064835_1065594_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024096513.1|1065593_1066052_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096514.1|1066048_1066852_+	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024096515.1|1066957_1068118_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_024096516.1|1068119_1069736_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	32.0	3.0e-44
WP_024096517.1|1069768_1070893_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_040103909.1|1070896_1074244_-	glycosyltransferase family 92 protein	NA	NA	NA	NA	NA
WP_024096519.1|1074585_1075368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096596711.1|1075932_1076796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096522.1|1076936_1077188_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024096523.1|1077189_1078491_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_024096524.1|1078761_1078959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096525.1|1079226_1080129_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096526.1|1080225_1080831_+	putative protein-disulfide isomerase	NA	NA	NA	NA	NA
WP_024096527.1|1080848_1081712_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_040103922.1|1081973_1082363_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_024096530.1|1082861_1083485_+	protocatechuate 3,4-dioxygenase beta subunit	NA	NA	NA	NA	NA
WP_024096531.1|1083517_1084342_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
1085641:1085669	attL	CATAATGCCGATGTTCAGATTATGCCGCG	NA	NA	NA	NA
WP_024096534.1|1085725_1086724_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.9	2.7e-27
WP_024096535.1|1086720_1087665_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_036563100.1|1087661_1088573_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024096539.1|1089405_1089609_+	hypothetical protein	NA	NA	NA	NA	NA
1089074:1089102	attR	CGCGGCATAATCTGAACATCGGCATTATG	NA	NA	NA	NA
WP_024096540.1|1089605_1089830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096541.1|1089816_1090098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096542.1|1090272_1090863_+	mobilization protein MobC	NA	NA	NA	NA	NA
WP_024096543.1|1090849_1092646_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_024096544.1|1092638_1094567_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_024096545.1|1094614_1096003_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010588	Phaeobacter gallaeciensis strain P11 chromosome, complete genome	3776904	1148606	1203212	3776904	lysis,integrase,transposase,tRNA	Acinetobacter_phage(14.29%)	52	1141431:1141447	1193517:1193533
1141431:1141447	attL	CTGACGCTGGTGGTTTT	NA	NA	NA	NA
WP_040103929.1|1148606_1148738_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024096611.1|1148795_1149377_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_096596796.1|1149386_1149497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096612.1|1149509_1150286_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	3.0e-42
WP_024096613.1|1151019_1151829_+	response regulator	NA	Q6JIH3	Burkholderia_virus	52.3	4.2e-07
WP_040103941.1|1151816_1154507_-	response regulator	NA	A0A1V0SGX0	Hokovirus	37.4	1.8e-33
WP_024096615.1|1154509_1155253_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024096616.1|1155422_1156256_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024096617.1|1156284_1157040_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_024096618.1|1157029_1157917_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_024096619.1|1157929_1158679_+	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	2.2e-10
WP_024096620.1|1158797_1159802_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096621.1|1159806_1160610_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024096622.1|1160666_1162757_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	2.1e-10
WP_024096623.1|1162851_1164057_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096624.1|1164069_1165155_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096625.1|1165228_1166899_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024096626.1|1167455_1168400_-	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	28.1	7.6e-08
WP_024096627.1|1168497_1169958_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.7	2.5e-106
WP_024096628.1|1170190_1170715_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_024096629.1|1170772_1171522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096630.1|1171626_1172169_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096631.1|1172169_1172868_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_024096632.1|1173274_1173571_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024096633.1|1173567_1174287_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.2	6.4e-31
WP_040103945.1|1174428_1174641_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024096634.1|1174799_1175441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040103946.1|1175443_1175758_-	Arc family DNA-binding protein	NA	A0A0U4B0M9	Pseudomonas_phage	56.1	3.1e-06
WP_024096636.1|1175842_1176037_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_024096637.1|1176061_1176253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096638.1|1176249_1177281_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	23.6	2.0e-06
WP_024096639.1|1177680_1178430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096640.1|1178605_1180876_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	28.9	9.1e-15
WP_040103947.1|1180872_1182126_-	GfdT protein	NA	NA	NA	NA	NA
WP_024096642.1|1182143_1182860_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024096643.1|1183230_1183779_+	carbon monoxide dehydrogenase subunit G	NA	NA	NA	NA	NA
WP_024096644.1|1184173_1185973_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	6.0e-62
WP_024096645.1|1186154_1188050_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	2.6e-23
WP_024096646.1|1188189_1189116_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024096647.1|1189118_1189682_-	DUF4453 domain-containing protein	NA	NA	NA	NA	NA
WP_024096648.1|1189738_1190575_-	protein of the AP superfamily	NA	NA	NA	NA	NA
WP_024096649.1|1190700_1192338_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.2e-22
WP_024096650.1|1192334_1193150_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096651.1|1193146_1194103_-	ABC transporter permease	NA	NA	NA	NA	NA
1193517:1193533	attR	AAAACCACCAGCGTCAG	NA	NA	NA	NA
WP_024096652.1|1194117_1195704_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024096654.1|1196160_1196607_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_024096655.1|1196635_1197307_-	nitroreductase	NA	NA	NA	NA	NA
WP_024096656.1|1197362_1198514_-	TFIIB-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_024096658.1|1198818_1200006_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_040103961.1|1200104_1200989_-	DUF2927 domain-containing protein	NA	NA	NA	NA	NA
WP_024096660.1|1201075_1202272_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_024096661.1|1202294_1203212_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
>prophage 3
NZ_CP010588	Phaeobacter gallaeciensis strain P11 chromosome, complete genome	3776904	1510659	1578267	3776904	tail,head,tRNA,capsid,portal,protease	uncultured_Mediterranean_phage(22.22%)	65	NA	NA
WP_024096945.1|1510659_1511952_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.9	8.6e-87
WP_024096946.1|1512061_1513558_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_024096947.1|1513737_1514022_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	53.8	2.0e-20
WP_024096948.1|1514056_1515718_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	24.0	1.6e-05
WP_024096949.1|1515720_1516689_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.7	4.7e-61
WP_024096950.1|1516855_1517209_+	membrane protein	NA	NA	NA	NA	NA
WP_024096951.1|1517306_1517933_+	heme ABC exporter ATP-binding protein CcmA	NA	G9BWD6	Planktothrix_phage	29.2	2.0e-09
WP_024096952.1|1517929_1518586_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_024096953.1|1518631_1519363_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_040104006.1|1519362_1519533_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_024096955.1|1519525_1520065_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_024096956.1|1520140_1520440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096957.1|1520715_1523403_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_024096958.1|1523648_1524380_+	DUF1223 domain-containing protein	NA	NA	NA	NA	NA
WP_024096959.1|1524394_1525330_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_024096960.1|1525700_1526897_-	flagellar motor switch protein	NA	NA	NA	NA	NA
WP_024096961.1|1526973_1527579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096962.1|1527768_1529073_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.2	1.1e-17
WP_024096963.1|1529352_1530609_-	OsmC family protein	NA	NA	NA	NA	NA
WP_024096964.1|1530704_1531265_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024096965.1|1531340_1532684_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_024096966.1|1532871_1533630_+	DUF3445 domain-containing protein	NA	NA	NA	NA	NA
WP_024096967.1|1533667_1534693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096968.1|1535234_1536641_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_014874894.1|1536734_1537073_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_024096969.1|1537265_1538957_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_024096970.1|1539331_1541536_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.1	1.3e-13
WP_024096971.1|1541945_1543076_+	porin	NA	NA	NA	NA	NA
WP_024096972.1|1543333_1544665_+	trigger factor	NA	NA	NA	NA	NA
WP_024096973.1|1544879_1546148_-	hemolysin-type calcium-binding protein	NA	M4SNJ8	Pseudoalteromonas_phage	25.9	2.8e-05
WP_024096974.1|1546446_1548405_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_024096975.1|1548553_1549024_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024096976.1|1549336_1549519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096977.1|1549751_1550366_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005982441.1|1550378_1550606_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_014874885.1|1550634_1550988_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_040103985.1|1551513_1552110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014874883.1|1552348_1552924_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024096979.1|1553048_1553348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096980.1|1553619_1554411_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_024096981.1|1554563_1555865_-	cytochrome b561	NA	NA	NA	NA	NA
WP_024096982.1|1556050_1556983_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024096983.1|1557067_1557805_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_005982462.1|1558439_1558673_+	acyl carrier protein	NA	A0A2C9CX86	Yersinia_phage	52.1	7.3e-05
WP_024096984.1|1558837_1559581_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
WP_024096985.1|1559764_1560778_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_024096986.1|1561037_1562303_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024096987.1|1562302_1563457_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_024096988.1|1563748_1564084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096989.1|1564061_1565354_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	41.4	3.9e-71
WP_024096990.1|1565557_1566751_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.9	3.1e-59
WP_024096991.1|1566743_1566962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096992.1|1566997_1567615_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	56.2	1.8e-34
WP_024096993.1|1567663_1568848_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.7	3.3e-61
WP_043939826.1|1569037_1569682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096995.1|1569678_1570050_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_024096996.1|1570046_1570460_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024096997.1|1570564_1570978_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_024096998.1|1570992_1571346_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_024096999.1|1571342_1571600_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_024097000.1|1571592_1572249_+|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	36.6	1.7e-14
WP_024097001.1|1572264_1572897_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.0	2.0e-57
WP_024097002.1|1572896_1573847_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	35.8	2.5e-51
WP_024097003.1|1573843_1574314_+	phage cell wall peptidase NlpC/P60 family	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.1	2.3e-29
WP_024097004.1|1574313_1578267_+|tail	phage tail protein	tail	A0A0B5A7K5	Paracoccus_phage	37.5	6.4e-226
>prophage 4
NZ_CP010588	Phaeobacter gallaeciensis strain P11 chromosome, complete genome	3776904	1779006	1806970	3776904	tail,head,capsid,integrase,terminase,portal,protease	Ruegeria_phage(23.53%)	42	1772200:1772214	1794160:1794174
1772200:1772214	attL	CCAGCAACTCAAAGC	NA	NA	NA	NA
WP_024097172.1|1779006_1780086_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A240F4W2	Ochrobactrum_phage	33.2	1.4e-50
WP_024097174.1|1780379_1781033_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	45.5	6.4e-30
WP_024097175.1|1781054_1781231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096596809.1|1781466_1782165_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	45.0	2.0e-29
WP_024097178.1|1782238_1782385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097179.1|1782441_1782831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052440150.1|1782860_1784948_-	hypothetical protein	NA	A0A1X9HVK8	Ruegeria_phage	59.7	4.6e-215
WP_024097179.1|1785004_1785394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052331592.1|1785418_1786165_-	site-specific DNA-methyltransferase	NA	O03956	Myxococcus_phage	52.9	1.1e-57
WP_024097181.1|1786195_1786969_-	hypothetical protein	NA	A0A068CE44	Rhizobium_phage	28.8	3.6e-08
WP_024097182.1|1787117_1787447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097183.1|1787446_1787686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097184.1|1787682_1787997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097185.1|1788193_1788679_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_024097186.1|1788688_1789618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040104019.1|1789690_1790341_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024097189.1|1790766_1791207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097190.1|1791203_1791371_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043939781.1|1791414_1791741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097192.1|1792019_1792613_+	SAM-dependent methyltransferase	NA	A0A218MLE3	uncultured_virus	48.3	1.3e-42
WP_024097193.1|1792609_1793521_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024097194.1|1793520_1793835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097195.1|1793827_1794490_+	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	60.5	4.4e-55
1794160:1794174	attR	CCAGCAACTCAAAGC	NA	NA	NA	NA
WP_024097196.1|1794499_1794916_+	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	42.9	2.6e-08
WP_024097197.1|1794984_1795365_+	hypothetical protein	NA	A0A1X9HVL1	Ruegeria_phage	35.1	1.5e-07
WP_024097198.1|1795364_1797053_+	DEAD/DEAH box helicase	NA	A0A1X9HX80	Ruegeria_phage	47.6	6.3e-138
WP_024097199.1|1797042_1797621_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_081731415.1|1797815_1798040_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_024097200.1|1798042_1798234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957933.1|1798230_1798557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097202.1|1798732_1799140_+|terminase	phage terminase small subunit	terminase	NA	NA	NA	NA
WP_024097203.1|1799117_1800896_+|terminase	phage terminase-like protein, large subunit	terminase	B0VK29	Azospirillum_phage	40.5	6.9e-119
WP_024097204.1|1800903_1802154_+|portal	phage portal protein	portal	A0A141GEV9	Brucella_phage	52.9	3.4e-104
WP_024097205.1|1802131_1802968_+|protease	Clp protease ClpP	protease	A0A141GEW1	Brucella_phage	73.9	8.5e-112
WP_024097206.1|1802984_1804223_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	55.6	2.1e-127
WP_024097207.1|1804283_1804424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097208.1|1804430_1805000_+	hypothetical protein	NA	A0A141GEW4	Brucella_phage	43.1	3.1e-33
WP_024097209.1|1804999_1805326_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_024097210.1|1805322_1805778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097211.1|1805777_1806131_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024097212.1|1806175_1806463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097213.1|1806523_1806970_+	hypothetical protein	NA	A0A2I7RB20	Vibrio_phage	32.0	5.9e-11
>prophage 5
NZ_CP010588	Phaeobacter gallaeciensis strain P11 chromosome, complete genome	3776904	2285871	2296719	3776904	coat,terminase	Vibrio_phage(33.33%)	14	NA	NA
WP_024097661.1|2285871_2287113_-|coat	phage coat protein	coat	I3PUX4	Vibrio_phage	34.3	5.4e-54
WP_024097662.1|2287125_2287968_-	hypothetical protein	NA	I3PUX5	Vibrio_phage	31.1	3.7e-14
WP_024097663.1|2287981_2289973_-	hypothetical protein	NA	I3PUX6	Vibrio_phage	39.6	3.6e-124
WP_024097664.1|2289969_2291307_-|terminase	phage terminase large subunit	terminase	F8TUR5	EBPR_podovirus	71.8	6.2e-181
WP_024097665.1|2291287_2291590_-	hypothetical protein	NA	A0A088FAU1	Sulfitobacter_phage	41.6	1.5e-05
WP_024097666.1|2292217_2292808_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_040104067.1|2293076_2293463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097669.1|2293474_2293828_-	HNH endonuclease	NA	A0A0B4N249	Escherichia_phage	49.0	5.5e-20
WP_024097670.1|2293896_2294367_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	81.7	4.4e-49
WP_024097671.1|2294366_2294735_-	ATPase involved in DNA replication initiation	NA	NA	NA	NA	NA
WP_024097672.1|2294731_2295100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097673.1|2295086_2295884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097674.1|2295880_2296414_-	T5domain protein	NA	A0A088F856	Sulfitobacter_phage	52.3	2.6e-45
WP_024097675.1|2296410_2296719_-	VRR-NUC domain protein	NA	E2GLY0	Acinetobacter_phage	55.7	1.6e-20
>prophage 6
NZ_CP010588	Phaeobacter gallaeciensis strain P11 chromosome, complete genome	3776904	2300458	2303745	3776904		Pseudoalteromonas_phage(16.67%)	7	NA	NA
WP_024097687.1|2300458_2301127_+	ERF family protein	NA	A0A0H4A6R9	Pseudoalteromonas_phage	48.9	9.1e-24
WP_024097688.1|2301116_2301821_+	3'-5' exonuclease	NA	X2CYL5	Brucella_phage	45.3	2.3e-41
WP_024097689.1|2301820_2302009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097690.1|2302008_2302299_+	hypothetical protein	NA	A0A0B5HDX4	Vibrio_phage	59.8	6.5e-27
WP_024097691.1|2302312_2302768_+	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	29.2	2.0e-06
WP_040104145.1|2302836_2303142_+	DUF1364 domain-containing protein	NA	A0A088F868	Sulfitobacter_phage	60.4	7.3e-29
WP_024097693.1|2303163_2303745_+	hypothetical protein	NA	K4NZ13	Pseudomonas_phage	55.2	2.7e-16
>prophage 1
NZ_CP010594	Phaeobacter gallaeciensis strain P11 plasmid pP11_f, complete sequence	40169	21785	34631	40169	head,portal,capsid,tail,terminase,protease	Emiliania_huxleyi_virus(20.0%)	14	NA	NA
WP_024099703.1|21785_22088_-|head,tail	head-tail adaptor protein	head,tail	A0A141GEW5	Brucella_phage	44.3	2.6e-10
WP_024099704.1|22087_22378_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_024099705.1|22374_22911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024099706.1|22984_24280_-|capsid	phage major capsid protein	capsid	C4ML06	Xanthomonas_virus	35.3	3.9e-55
WP_158524454.1|24293_25130_-|protease	Clp protease ClpP	protease	A0A0U4B0J0	Pseudomonas_phage	50.8	2.9e-59
WP_081731486.1|25141_26371_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	37.2	9.1e-62
WP_024099709.1|26370_28098_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	44.3	2.8e-133
WP_040104520.1|28097_28598_-	hypothetical protein	NA	I3ULZ5	Rhodobacter_phage	43.5	9.5e-26
WP_024099711.1|29186_29882_-	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	44.8	1.7e-36
WP_024099712.1|30209_32093_-	hypothetical protein	NA	A0A291LAR9	Bordetella_phage	29.1	9.5e-26
WP_024099713.1|32085_33261_-	DNA primase	NA	G8DGB8	Emiliania_huxleyi_virus	46.1	1.2e-84
WP_024099714.1|33257_33566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024099715.1|33562_33862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024099716.1|33851_34631_-	site-specific DNA-methyltransferase	NA	M4R187	Loktanella_phage	32.7	7.9e-19
