The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023168	Bacillus paralicheniformis strain 14DA11 chromosome, complete genome	4535069	677835	734155	4535069	integrase,holin,protease,tRNA,terminase,portal,capsid,tail,plate	Bacillus_phage(25.0%)	78	688061:688076	740305:740320
WP_043054090.1|677835_678312_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_020450324.1|678292_678982_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_023855532.1|678994_679453_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_026578976.1|679442_680468_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.2	3.5e-67
WP_096747896.1|680706_682632_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.1	7.1e-61
WP_048350303.1|682778_683285_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_020450329.1|683288_683933_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_020450330.1|683971_684145_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_095293002.1|684151_684928_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.6	1.4e-15
WP_020450332.1|684972_685167_-	YdiK family protein	NA	NA	NA	NA	NA
WP_020450333.1|685163_685898_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003179248.1|686123_686408_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.9e-19
WP_096747897.1|686452_688078_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.4	2.8e-159
688061:688076	attL	ATGGGCGGCATGATGT	NA	NA	NA	NA
WP_059231566.1|688155_689367_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	44.6	1.9e-88
WP_043927786.1|689381_689885_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	59.5	2.7e-52
WP_096747898.1|689974_690640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043927782.1|691020_691383_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	36.3	7.4e-12
WP_043927783.1|691573_691804_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003179259.1|691854_692160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043927784.1|692156_692846_+	antirepressor	NA	A0A0F6N3N8	Staphylococcus_phage	51.3	9.7e-37
WP_096747899.1|693474_693732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016886653.1|693932_694124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747900.1|694120_695032_+	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.1	2.1e-87
WP_073358662.1|695051_695789_+	hypothetical protein	NA	A0A0A7RVR3	Clostridium_phage	46.9	6.2e-58
WP_128472329.1|695965_696685_+	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	49.3	2.6e-08
WP_096747902.1|696551_697505_+	ATP-binding protein	NA	A0A0K2CPA5	Brevibacillus_phage	51.1	2.4e-57
WP_096747903.1|697955_698222_+	hypothetical protein	NA	A0A1P8CWX5	Bacillus_phage	53.3	6.6e-18
WP_096747904.1|698234_698693_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	70.0	1.9e-52
WP_043929226.1|698899_699106_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	65.5	9.0e-15
WP_096747905.1|699140_699605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043929229.1|699641_699956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747906.1|700130_700505_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	36.6	1.8e-13
WP_096747907.1|700501_700870_+	hypothetical protein	NA	A0A2H4JDM0	uncultured_Caudovirales_phage	77.8	3.1e-26
WP_096747908.1|700866_701079_+	hypothetical protein	NA	R4JF30	Bacillus_phage	92.1	3.3e-28
WP_096747909.1|701057_701471_+	hypothetical protein	NA	O64129	Bacillus_phage	78.4	2.5e-56
WP_059231593.1|701467_701719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016886634.1|701966_702239_+	DUF5052 family protein	NA	F8WQ63	Bacillus_phage	70.3	9.4e-28
WP_043929357.1|702253_702520_+	hypothetical protein	NA	A0A0H3UYW6	Geobacillus_virus	61.1	2.7e-11
WP_043929417.1|702780_703218_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	74.3	6.5e-55
WP_043929419.1|703516_703795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043929420.1|704070_704526_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	80.1	7.2e-65
WP_043929421.1|704699_704912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043929422.1|705290_706019_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	56.2	7.0e-62
WP_096747910.1|706018_707311_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	71.7	2.1e-162
WP_096747911.1|707314_708853_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.1	1.4e-144
WP_096747912.1|708845_709763_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	6.4e-52
WP_157765907.1|709837_710014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747913.1|710066_711242_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	52.6	2.6e-82
WP_075178039.1|711254_712190_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	63.8	8.6e-105
WP_096747914.1|712200_712605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747915.1|712611_713007_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	39.5	4.9e-17
WP_096747916.1|713003_713360_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_096747917.1|713356_713854_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.2	4.4e-39
WP_096747918.1|713843_714308_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_096747919.1|714308_714536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747920.1|714536_715937_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	41.8	4.3e-84
WP_059231625.1|715938_716382_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.6	1.2e-27
WP_016886607.1|716731_716815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096747921.1|716954_717404_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	31.2	1.5e-09
WP_085959894.1|717433_717583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747922.1|717754_722848_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	41.2	7.4e-49
WP_096747923.1|723520_724504_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	31.9	1.3e-37
WP_096747924.1|724500_724794_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_043929392.1|724820_725246_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	37.8	1.3e-12
WP_016886599.1|725238_726282_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.6	5.7e-73
WP_016886598.1|726268_726847_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	29.6	2.3e-15
WP_096747925.1|726843_727119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747926.1|727119_728223_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	65.9	1.5e-18
WP_044822060.1|728234_728564_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.4	1.8e-12
WP_043929126.1|728560_728743_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	57.4	3.7e-12
WP_096747927.1|728844_729678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474918.1|729759_730029_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	1.6e-24
WP_017474919.1|730044_730308_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	1.4e-31
WP_096747928.1|730359_731439_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM6	uncultured_phage	40.8	2.6e-44
WP_157765908.1|731446_731593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747929.1|731717_732692_-	Abi family protein	NA	NA	NA	NA	NA
WP_096747930.1|733124_733298_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	90.9	3.1e-24
WP_096747931.1|733345_734155_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.8	4.0e-98
740305:740320	attR	ATGGGCGGCATGATGT	NA	NA	NA	NA
>prophage 2
NZ_CP023168	Bacillus paralicheniformis strain 14DA11 chromosome, complete genome	4535069	809362	817752	4535069		Synechococcus_phage(57.14%)	8	NA	NA
WP_043054145.1|809362_810658_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_075213470.1|810732_811449_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.7	3.3e-48
WP_003179532.1|811450_811705_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_043054147.1|811701_812385_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_043054148.1|812368_814597_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.8	3.8e-159
WP_023855588.1|814572_816003_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_035337048.1|816127_817168_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_035337045.1|817164_817752_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.9	7.0e-28
>prophage 3
NZ_CP023168	Bacillus paralicheniformis strain 14DA11 chromosome, complete genome	4535069	1055440	1119725	4535069	head,integrase,holin,protease,tRNA,terminase,portal,coat,capsid,tail,plate,transposase	Bacillus_phage(42.86%)	79	1055402:1055424	1097541:1097563
1055402:1055424	attL	TTTTTTGCACAAATTTTGCACAA	NA	NA	NA	NA
WP_043054197.1|1055440_1056559_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	60.8	7.6e-124
WP_043054198.1|1056573_1057020_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	54.1	2.5e-41
WP_043054199.1|1057023_1057365_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC14	Paenibacillus_phage	62.8	1.6e-32
WP_052500258.1|1057533_1057785_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SC17	Paenibacillus_phage	72.2	1.3e-26
WP_043054201.1|1058140_1058842_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	70.4	9.4e-88
WP_043054202.1|1059037_1059589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054203.1|1059646_1059865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054204.1|1059857_1060700_+	replication protein	NA	V9QKF6	Oenococcus_phage	43.9	4.5e-52
WP_043054205.1|1060659_1061508_+	ATP-binding protein	NA	Q9MBR8	Staphylococcus_prophage	32.3	5.2e-24
WP_155392279.1|1061497_1061656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054564.1|1061813_1062356_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.3	3.9e-09
WP_113742868.1|1062460_1062610_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_043054206.1|1062681_1062882_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	3.6e-08
WP_043054207.1|1062917_1063151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155392280.1|1063362_1063500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054209.1|1063540_1063855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054210.1|1063851_1064100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054211.1|1064139_1064451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054212.1|1064482_1064695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054213.1|1064691_1064874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054214.1|1065055_1065322_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	39.1	3.5e-11
WP_043054215.1|1065607_1066048_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	1.4e-36
WP_043054216.1|1066047_1066590_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	4.3e-56
WP_043054217.1|1066823_1067015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075213432.1|1067420_1067645_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_043054218.1|1067898_1068567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624192.1|1068642_1068951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054219.1|1068977_1069352_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	6.9e-29
WP_043054220.1|1069582_1070098_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.2	9.8e-34
WP_043054221.1|1070094_1071804_+|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	64.1	2.5e-211
WP_035316082.1|1071816_1072008_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_043054222.1|1072008_1073319_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.1	2.4e-105
WP_035338281.1|1073263_1073995_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	56.9	2.4e-57
WP_043054223.1|1074034_1075315_+|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	43.5	6.3e-74
WP_052500260.1|1075338_1075782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054224.1|1075796_1076099_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	7.3e-13
WP_043054225.1|1076088_1076397_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	38.6	9.7e-13
WP_043054226.1|1076396_1076795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054227.1|1076791_1077175_+	phage protein	NA	NA	NA	NA	NA
WP_043054228.1|1077189_1077807_+|tail	tail protein	tail	NA	NA	NA	NA
WP_043054229.1|1077860_1078226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747970.1|1078434_1082904_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.1	1.1e-69
WP_075213433.1|1082903_1083740_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	67.9	2.0e-108
WP_075213434.1|1083752_1085465_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	65.7	5.3e-217
WP_075213875.1|1085501_1088147_+	peptidase G2	NA	D6R401	Bacillus_phage	56.8	2.0e-292
WP_075213436.1|1088160_1089477_+|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	43.3	9.1e-68
WP_075213437.1|1089489_1089813_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	46.4	1.7e-12
WP_075213438.1|1089809_1089992_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.4e-06
WP_075213459.1|1090054_1090324_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	2.1e-24
WP_003185319.1|1090339_1090603_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	2.0e-30
WP_065644215.1|1090650_1091604_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	41.7	3.9e-60
WP_016886588.1|1091704_1092040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583950.1|1092057_1093581_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	36.6	1.2e-07
WP_071583847.1|1093836_1094958_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_080618531.1|1095180_1095549_-	YolD-like family protein	NA	O64030	Bacillus_phage	40.4	2.0e-17
WP_031305060.1|1096670_1096889_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_075213783.1|1096913_1097228_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_025811885.1|1098012_1099338_+	TGS domain-containing protein	NA	NA	NA	NA	NA
1097541:1097563	attR	TTTTTTGCACAAATTTTGCACAA	NA	NA	NA	NA
WP_043054245.1|1099559_1102367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080131295.1|1102588_1103104_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_023856463.1|1103213_1103783_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031305076.1|1103910_1104675_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_096748451.1|1105026_1106802_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_025811874.1|1107003_1107771_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	5.7e-30
WP_096747971.1|1107767_1108781_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020450657.1|1108777_1109614_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020450658.1|1109627_1110758_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_020450659.1|1110788_1111247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450660.1|1111243_1111450_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020450662.1|1111999_1112212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450663.1|1112317_1113064_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.3	5.4e-09
WP_031305077.1|1113029_1114499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450665.1|1114488_1115397_+	PqqD family protein	NA	NA	NA	NA	NA
WP_011197680.1|1115393_1115678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856470.1|1115784_1116054_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_020450667.1|1116379_1117009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450668.1|1117089_1118238_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_025811863.1|1118301_1119204_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_020450670.1|1119251_1119725_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP023168	Bacillus paralicheniformis strain 14DA11 chromosome, complete genome	4535069	1449749	1525245	4535069	holin,terminase,portal,coat,capsid,tail,plate	uncultured_Caudovirales_phage(25.64%)	93	NA	NA
WP_023856676.1|1449749_1450199_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180694.1|1450349_1450832_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180696.1|1450964_1451471_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180698.1|1451538_1451892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180700.1|1451940_1452327_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180704.1|1452474_1452831_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003180706.1|1453117_1453327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450965.1|1453406_1453538_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003180710.1|1453664_1453922_+	sporulation protein	NA	NA	NA	NA	NA
WP_059261123.1|1453960_1456240_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.5	6.6e-90
WP_003180714.1|1456361_1456619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180716.1|1456658_1457246_-	DedA family protein	NA	NA	NA	NA	NA
WP_003180718.1|1457341_1458328_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	3.6e-53
WP_080131327.1|1458324_1459215_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	56.7	1.5e-85
WP_020450971.1|1459237_1459633_-	GtrA family protein	NA	NA	NA	NA	NA
WP_096748011.1|1459798_1460218_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003180728.1|1460227_1460737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180731.1|1460801_1461524_-	esterase family protein	NA	NA	NA	NA	NA
WP_003180732.1|1461635_1462091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180734.1|1462102_1462591_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_003180735.1|1462671_1463619_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180736.1|1463928_1465053_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	9.0e-16
WP_035338954.1|1465042_1466218_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	28.0	4.8e-20
WP_035338952.1|1466262_1467453_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_035338950.1|1467624_1468194_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180743.1|1468183_1468468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065643372.1|1468645_1470019_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	24.6	7.7e-09
WP_065643371.1|1470620_1471571_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_020450980.1|1472600_1472933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450981.1|1472944_1474387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080131328.1|1474497_1474779_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_044805482.1|1474856_1475033_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020450984.1|1475376_1475646_+	phage-like protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.7e-24
WP_020450985.1|1475661_1475925_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	1.5e-30
WP_020450986.1|1475976_1477056_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM6	uncultured_phage	40.4	2.9e-43
WP_026579880.1|1477090_1477279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026579879.1|1477297_1478113_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_020450988.1|1478221_1478404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197793.1|1478844_1479024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450989.1|1479061_1479640_+	maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
WP_020450990.1|1479722_1480010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450991.1|1480218_1481109_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096748012.1|1481426_1483256_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_020450993.1|1483283_1485002_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_023856699.1|1485057_1485945_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856700.1|1486036_1486909_+	DMT family transporter	NA	NA	NA	NA	NA
WP_023856701.1|1486957_1487335_+	glyoxalase	NA	NA	NA	NA	NA
WP_023856702.1|1487379_1487928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450998.1|1488367_1489108_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	57.6	2.7e-29
WP_051143313.1|1489165_1490590_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_020451000.1|1490606_1491185_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856707.1|1491560_1491974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035338945.1|1492346_1492829_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_020451003.1|1493317_1493965_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.5	2.6e-44
WP_020451004.1|1493977_1494634_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	6.8e-40
WP_020451005.1|1494822_1495176_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	3.6e-19
WP_023856709.1|1495348_1495609_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	43.8	3.0e-07
WP_033155144.1|1495598_1495895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856711.1|1495895_1496720_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	29.6	2.1e-25
WP_025811606.1|1496619_1497420_+	ATP-binding protein	NA	Q0H276	Geobacillus_phage	47.7	8.0e-59
WP_023856714.1|1497689_1498031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451011.1|1498027_1498231_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.2	6.4e-13
WP_080131330.1|1498348_1498852_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	39.3	4.9e-22
WP_026579866.1|1498996_1499797_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	2.6e-65
WP_080131331.1|1499793_1501092_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	61.5	1.1e-150
WP_020451015.1|1501095_1502610_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.3	6.4e-142
WP_020451016.1|1502617_1503466_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	60.6	8.8e-56
WP_020451017.1|1503483_1504419_+|capsid	phage capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.1	3.6e-103
WP_020451018.1|1504528_1504909_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_026579862.1|1504905_1505262_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_080131332.1|1505258_1505747_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	43.3	1.1e-34
WP_035338940.1|1505759_1506200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451022.1|1506200_1506425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080131333.1|1506424_1507771_+|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	40.2	5.3e-79
WP_003180830.1|1507772_1508216_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_023856720.1|1508380_1508830_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_095290311.1|1508871_1509009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095290092.1|1512770_1513427_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_095290094.1|1513483_1514464_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	31.7	3.0e-39
WP_023856723.1|1514460_1514769_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.4e-06
WP_096748013.1|1514787_1515213_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	37.3	1.6e-13
WP_096748014.1|1515205_1516249_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	5.3e-71
WP_096748015.1|1516235_1517156_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	31.7	1.4e-14
WP_020451034.1|1517169_1517556_+	phage protein	NA	NA	NA	NA	NA
WP_096748016.1|1517571_1518780_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	42.9	1.2e-21
WP_096748017.1|1518821_1519781_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	26.0	1.8e-09
WP_035338928.1|1519824_1520094_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	65.2	9.6e-25
WP_026579849.1|1520108_1520372_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	3.1e-28
WP_096748018.1|1520424_1521489_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	52.0	5.1e-45
WP_023856728.1|1521587_1522274_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856729.1|1522286_1523303_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_025811596.1|1523323_1524421_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_023856787.1|1524396_1525245_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
>prophage 5
NZ_CP023168	Bacillus paralicheniformis strain 14DA11 chromosome, complete genome	4535069	1609389	1656026	4535069	tail,integrase,transposase,protease	Bacillus_phage(30.0%)	50	1639400:1639459	1656098:1656308
WP_020451127.1|1609389_1610283_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_020451128.1|1610431_1611781_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_149208594.1|1613913_1615344_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.7	9.4e-119
WP_023856450.1|1615487_1615703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451131.1|1615699_1615882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025810280.1|1616144_1617170_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_020451133.1|1617479_1619690_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_023857318.1|1620405_1621467_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_096748035.1|1621472_1622669_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_020451137.1|1622978_1623758_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_096748036.1|1623853_1625044_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_142368374.1|1625276_1626494_+	2,3-diketo-5-methylthiopentyl-1-phosphate enolase	NA	NA	NA	NA	NA
WP_096748038.1|1626490_1627189_+	2-hydroxy-3-keto-5-methylthiopentenyl-1- phosphate phosphatase	NA	NA	NA	NA	NA
WP_023857315.1|1627149_1627776_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_096748039.1|1627791_1628328_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_096748040.1|1628355_1628820_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	53.4	2.4e-31
WP_020451144.1|1628806_1629127_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_020451145.1|1629342_1629585_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_020451146.1|1629643_1631155_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_020451147.1|1631392_1631848_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020451148.1|1631871_1632651_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_020451149.1|1632643_1633447_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_096748041.1|1633645_1635742_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.8	6.2e-127
WP_020451151.1|1635962_1637000_+	transporter YkvI	NA	NA	NA	NA	NA
WP_020451152.1|1637264_1637924_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.9	3.9e-67
WP_023857309.1|1637926_1638367_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_096748042.1|1638359_1639091_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	47.2	8.1e-58
WP_009328607.1|1639112_1639610_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.1	6.1e-57
1639400:1639459	attL	TCACGAAGACTGCATGAACATCATCATGAACGATTTAATTGAGCTGATGGACCCGCGCTA	NA	NA	NA	NA
WP_096748043.1|1640071_1640623_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	44.1	2.3e-36
WP_096748044.1|1641035_1641398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031314606.1|1643111_1643297_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096748045.1|1643482_1643830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748046.1|1643826_1644165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748047.1|1644161_1644359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748048.1|1644355_1644694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748049.1|1644690_1645233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748454.1|1646860_1647094_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096748050.1|1647074_1648001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748051.1|1648073_1648292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748052.1|1648424_1648619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048350438.1|1648603_1648990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748053.1|1648986_1649337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748054.1|1649333_1649819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748055.1|1649831_1650458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748056.1|1650517_1650853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748057.1|1650852_1652514_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	48.8	8.2e-74
WP_096748058.1|1652555_1653983_+	hypothetical protein	NA	A0A2P1CIB8	Microbacterium_phage	43.5	8.0e-09
WP_096748059.1|1653982_1654189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748060.1|1654315_1654771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748061.1|1654877_1656026_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.1	9.8e-42
1656098:1656308	attR	TCACGAAGACTGCATGAACATCATCATGAACGATTTAATTGAGCTGATGGACCCGCGCTACATCGAAGTCTGGGGCAAATTCACCCCGAGAGGCGGAATCTCGATCGACCCGTACACAAACTACGGCAAGCCCGGTACAAAGTATGAAAAAATGGCCGAGTATCGGATGATGAATCATGATCTGTATCCGGAGACGATTGATAATCGGTAA	NA	NA	NA	NA
>prophage 6
NZ_CP023168	Bacillus paralicheniformis strain 14DA11 chromosome, complete genome	4535069	2333914	2373198	4535069	head,integrase,holin,protease,terminase,portal,capsid,tail,plate,transposase	Bacillus_phage(88.37%)	49	2322431:2322452	2380018:2380039
2322431:2322452	attL	AGGAAAAGCAACAGATAACAAC	NA	NA	NA	NA
WP_096748463.1|2333914_2334283_+	YolD-like family protein	NA	O64030	Bacillus_phage	39.5	5.9e-17
WP_096748140.1|2335129_2336647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096748141.1|2336663_2336999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748142.1|2337031_2338111_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	52.7	8.9e-45
WP_075753490.1|2338161_2338425_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	5.7e-30
WP_069500916.1|2338440_2338710_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_096748143.1|2338773_2338956_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_096748144.1|2338915_2339275_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	37.9	4.9e-08
WP_096748464.1|2339287_2340634_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	42.3	1.8e-66
WP_096748145.1|2340650_2343296_-	peptidase G2	NA	D6R401	Bacillus_phage	55.6	8.3e-286
WP_096748146.1|2343332_2345042_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	66.1	5.3e-217
WP_096748147.1|2345054_2345891_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	72.6	6.3e-115
WP_096748148.1|2345890_2349781_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	61.3	0.0e+00
WP_096748149.1|2349793_2349976_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	66.7	1.7e-12
WP_096748150.1|2349978_2350314_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	62.5	9.2e-33
WP_096748151.1|2350379_2350988_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	55.9	1.2e-54
WP_096748152.1|2350984_2351365_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	54.8	2.0e-31
WP_096748153.1|2351361_2351745_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	70.9	4.1e-45
WP_075213406.1|2351737_2352112_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	66.4	5.6e-39
WP_059231687.1|2352041_2352392_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	62.1	2.3e-34
WP_096748154.1|2352407_2352857_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	55.3	1.0e-15
WP_065643963.1|2352882_2353176_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	70.1	2.9e-27
WP_157765917.1|2353192_2354353_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	65.5	1.1e-136
WP_075213409.1|2354436_2355066_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	80.9	2.5e-92
WP_096748155.1|2355055_2356303_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	84.4	4.1e-211
WP_009330377.1|2358482_2359016_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_096748156.1|2359102_2359429_-	transglycosylase	NA	Q9T203	Bacillus_phage	58.3	2.6e-32
WP_096748157.1|2359397_2359772_-	HNH endonuclease	NA	Q38456	Bacillus_phage	81.5	1.2e-60
WP_157765910.1|2359932_2360382_-	hypothetical protein	NA	A0A090DC14	Clostridium_phage	39.0	5.4e-20
WP_096748159.1|2360509_2361424_-	DUF4868 domain-containing protein	NA	Q24LC1	Clostridium_phage	47.2	1.8e-67
WP_088272691.1|2361845_2362226_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_096748161.1|2362338_2362521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157765911.1|2362745_2362973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748164.1|2362941_2363232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748165.1|2363246_2363762_-	hypothetical protein	NA	D6R425	Bacillus_phage	82.5	6.3e-81
WP_096748166.1|2363764_2363935_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	62.8	5.1e-08
WP_096748167.1|2363927_2364470_-	nuclease	NA	Q9ZXC2	Bacillus_phage	89.8	9.5e-88
WP_096748168.1|2364466_2364904_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	74.5	2.1e-61
WP_096748169.1|2365172_2367611_-	DNA primase	NA	D6R422	Bacillus_phage	80.9	0.0e+00
WP_035338250.1|2367671_2368112_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.1	1.2e-72
WP_096748170.1|2368111_2369044_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	87.1	1.1e-149
WP_096748171.1|2369047_2369605_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.7e-69
WP_096748172.1|2369670_2369940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748173.1|2370033_2370300_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	53.5	6.0e-19
WP_061578517.1|2370423_2370693_-	group-specific protein	NA	A0A0S2SXU9	Bacillus_phage	56.2	1.1e-23
WP_026587143.1|2370698_2370884_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	70.5	1.5e-16
WP_026587142.1|2371152_2371581_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	66.7	3.2e-46
WP_026587141.1|2371589_2372012_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	62.6	1.8e-46
WP_071583919.1|2372052_2373198_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	41.0	1.4e-72
2380018:2380039	attR	AGGAAAAGCAACAGATAACAAC	NA	NA	NA	NA
>prophage 7
NZ_CP023168	Bacillus paralicheniformis strain 14DA11 chromosome, complete genome	4535069	2624112	2635755	4535069		Staphylococcus_phage(55.56%)	14	NA	NA
WP_023857488.1|2624112_2624706_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	2.6e-14
WP_023857489.1|2624695_2625451_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.7	6.1e-08
WP_003183108.1|2625633_2625729_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_096748206.1|2625848_2626370_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_020452011.1|2626380_2626755_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|2626856_2627321_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_020452012.1|2627355_2628552_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.2	1.6e-116
WP_020452013.1|2628573_2629221_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.4	5.2e-40
WP_023857492.1|2629232_2630321_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.2	6.2e-62
WP_020452015.1|2630682_2631027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748207.1|2631293_2633483_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.9	1.3e-154
WP_023857494.1|2633699_2633969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023857495.1|2633958_2635089_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.2	1.8e-72
WP_020452019.1|2635317_2635755_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	9.2e-17
>prophage 8
NZ_CP023168	Bacillus paralicheniformis strain 14DA11 chromosome, complete genome	4535069	2816595	2890808	4535069	integrase,holin,protease,terminase,portal,coat,capsid,tail,plate	Bacillus_phage(30.0%)	92	2847684:2847700	2884279:2884295
WP_048349970.1|2816595_2817390_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_065644169.1|2817462_2818047_-	signal peptidase I	NA	NA	NA	NA	NA
WP_020452169.1|2818043_2818772_-	amyloid fiber anchoring/assembly protein TapA	NA	NA	NA	NA	NA
WP_023855188.1|2819049_2819370_+	YqzG/YhdC family protein	NA	NA	NA	NA	NA
WP_025811164.1|2819399_2819582_-	YqzE family protein	NA	NA	NA	NA	NA
WP_025811163.1|2819670_2820036_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_025811162.1|2820047_2820428_-	ComGF family competence protein	NA	NA	NA	NA	NA
WP_025811161.1|2820444_2820792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026579312.1|2820775_2821213_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_096748222.1|2821218_2821482_-	competence protein ComG	NA	NA	NA	NA	NA
WP_080624021.1|2821607_2822297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624022.1|2822463_2823204_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080624023.1|2823303_2824368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748465.1|2824393_2824750_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	38.3	3.9e-13
WP_080624025.1|2824993_2825851_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_016886590.1|2825930_2826791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624027.1|2827954_2828218_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	2.0e-30
WP_020450984.1|2828233_2828503_-	phage-like protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.7e-24
WP_080624028.1|2828582_2829416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043929126.1|2829517_2829700_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	57.4	3.7e-12
WP_044822060.1|2829696_2830026_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.4	1.8e-12
WP_080624029.1|2830037_2831141_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	65.9	1.5e-18
WP_080624030.1|2831141_2831417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624031.1|2831413_2831992_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	29.6	3.0e-15
WP_080624032.1|2831978_2833022_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.9	7.5e-73
WP_076793407.1|2833014_2833440_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	37.8	1.3e-12
WP_016886601.1|2833452_2833761_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	34.3	2.6e-05
WP_080624033.1|2833757_2834741_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	31.3	3.6e-37
WP_080624034.1|2834762_2835422_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.8	3.7e-25
WP_080624035.1|2835414_2840679_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	40.9	5.0e-48
WP_096748223.1|2840682_2840832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624036.1|2840861_2841311_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	31.9	5.0e-10
WP_080624039.1|2842381_2842825_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.6	1.2e-27
WP_080624040.1|2842826_2844227_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	42.0	1.1e-84
WP_080624041.1|2844227_2844455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624042.1|2844455_2844920_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_080624043.1|2844909_2845407_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.5	1.5e-39
WP_080624044.1|2845403_2845760_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_080624045.1|2845756_2846152_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	39.5	6.4e-17
WP_080624046.1|2846158_2846572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624047.1|2846582_2847518_-|capsid	major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.4	7.8e-106
WP_080624048.1|2847530_2848706_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	51.0	1.9e-80
2847684:2847700	attL	TTTGATGACGGACTCTT	NA	NA	NA	NA
WP_080624049.1|2848711_2849584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624050.1|2849632_2850550_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	38.9	1.1e-51
WP_080624052.1|2852083_2853379_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.9	2.6e-160
WP_080624054.1|2854430_2854721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624055.1|2855011_2855215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157765913.1|2855268_2855442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624230.1|2855718_2856180_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_080624056.1|2856203_2858081_-|integrase	integrase	integrase	A0A1P8CWI7	Bacillus_phage	23.6	6.8e-16
WP_096748224.1|2858362_2859466_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	31.1	3.7e-46
WP_080624058.1|2859646_2860030_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	57.9	9.8e-31
WP_080624059.1|2860120_2860774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624060.1|2860770_2860971_-	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	63.6	2.8e-13
WP_080624061.1|2860989_2861223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624062.1|2861297_2861855_+	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	53.4	3.1e-49
WP_149208611.1|2861847_2862060_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	61.4	5.1e-13
WP_080624063.1|2862127_2862394_-	DUF3850 domain-containing protein	NA	A8E2L6	Enterococcus_phage	59.2	1.0e-18
WP_080624232.1|2862636_2863272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624064.1|2863283_2863742_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	69.8	2.2e-53
WP_080624065.1|2863878_2864139_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_080624233.1|2864246_2864423_-	Fur-regulated basic protein FbpA	NA	M4ZS77	Bacillus_phage	50.9	1.0e-06
WP_080624066.1|2864458_2865763_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	42.5	9.0e-92
WP_080624067.1|2865737_2866019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624069.1|2867000_2867951_-	recombination protein RecT	NA	S6AVW6	Thermus_phage	60.8	1.2e-88
WP_080624070.1|2867943_2868894_-	hypothetical protein	NA	S6C475	Thermus_phage	61.7	2.3e-105
WP_017474946.1|2868893_2869073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624071.1|2869193_2869406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624072.1|2869418_2869613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624073.1|2869740_2869929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624075.1|2870191_2870719_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080624077.1|2871016_2871220_-	helix-turn-helix transcriptional regulator	NA	B5LPU7	Bacillus_virus	50.8	1.1e-09
WP_080624234.1|2871418_2871766_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	50.0	3.1e-15
WP_080624078.1|2871961_2872462_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	37.7	1.2e-23
WP_080624079.1|2872454_2873627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624080.1|2873670_2875206_+	recombinase family protein	NA	A0A2H4J6X5	uncultured_Caudovirales_phage	21.7	1.0e-06
WP_025811158.1|2875270_2876305_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_025811157.1|2876294_2877359_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_035338373.1|2877516_2878356_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003183482.1|2878597_2878975_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_020452180.1|2879185_2879431_+	DUF2626 domain-containing protein	NA	NA	NA	NA	NA
WP_020452181.1|2879466_2880105_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	38.1	2.7e-33
WP_003183486.1|2880260_2880434_+	DUF2759 domain-containing protein	NA	NA	NA	NA	NA
WP_020452182.1|2880494_2880809_-	MTH1187 family thiamine-binding protein	NA	NA	NA	NA	NA
WP_035338374.1|2880824_2881934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035338375.1|2881988_2883113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033155114.1|2883245_2884187_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035338376.1|2884361_2886260_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.8	3.9e-96
2884279:2884295	attR	TTTGATGACGGACTCTT	NA	NA	NA	NA
WP_035338377.1|2886441_2887416_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_020452188.1|2887440_2887638_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_096748225.1|2887738_2889193_-	spore germination protein	NA	NA	NA	NA	NA
WP_035338378.1|2889269_2890808_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 9
NZ_CP023168	Bacillus paralicheniformis strain 14DA11 chromosome, complete genome	4535069	3142518	3199462	4535069	transposase,protease,tRNA,coat	Bacillus_phage(36.36%)	59	NA	NA
WP_020452419.1|3142518_3143664_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.2	2.1e-84
WP_020452420.1|3143692_3144721_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003183984.1|3144761_3144962_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_023855398.1|3144954_3145959_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.3	1.2e-06
WP_023855399.1|3145968_3146574_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_023855400.1|3146697_3147219_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_035338454.1|3147450_3148098_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_035338455.1|3148577_3148769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035338155.1|3149297_3150728_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.8	1.2e-121
WP_035338349.1|3150760_3152098_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_035338348.1|3152094_3152766_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.0	6.3e-25
WP_023855402.1|3152944_3153124_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_023855403.1|3153232_3153697_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_023855404.1|3153756_3154467_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	54.9	1.9e-48
WP_003183993.1|3154861_3155041_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	76.3	1.5e-21
WP_035338347.1|3155130_3155451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023855406.1|3155588_3156311_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023855407.1|3156435_3157071_-	spore cortex protein	NA	NA	NA	NA	NA
WP_023855408.1|3157243_3158296_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_035338345.1|3158411_3159521_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_025811047.1|3159542_3160382_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_025811046.1|3160362_3161937_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_020452436.1|3162037_3163216_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	26.0	1.1e-32
WP_020452437.1|3163184_3163727_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_020452438.1|3163768_3164638_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_023855415.1|3164647_3165091_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_020452440.1|3165208_3166495_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_020452441.1|3166527_3167106_-	sporulation initiation phosphotransferase Spo0B	NA	NA	NA	NA	NA
WP_003184023.1|3167332_3167614_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_020452442.1|3167626_3167968_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|3167980_3168289_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_096748261.1|3168449_3169316_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_023855419.1|3169308_3170100_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_025811043.1|3170245_3170674_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_023855421.1|3170673_3170997_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020452447.1|3171043_3171850_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_096748468.1|3171852_3172533_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_020452449.1|3172586_3173105_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_020452450.1|3173101_3174010_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|3174040_3175051_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_020452451.1|3175138_3175813_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_020452452.1|3175867_3176440_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_096748262.1|3176590_3177625_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_096748263.1|3178731_3180036_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_020452456.1|3180112_3182755_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	9.8e-162
WP_020452457.1|3183214_3183406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748264.1|3183424_3184447_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_096748265.1|3184474_3186106_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023855430.1|3186254_3187550_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_020452461.1|3187575_3188550_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_026579130.1|3188553_3189345_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_020452463.1|3189334_3190276_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_020452464.1|3190315_3191146_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_020452465.1|3191151_3192513_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_020452466.1|3192701_3193187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075752023.1|3193234_3193822_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_023855433.1|3193818_3196143_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.0	1.7e-186
WP_096748266.1|3196359_3198015_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	34.7	1.4e-17
WP_003184083.1|3198196_3199462_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
