The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023527	Citrobacter koseri strain FDAARGOS_393 chromosome, complete genome	4875257	1483614	1571667	4875257	holin,plate,terminase,protease,portal,tRNA,tail	Enterobacteria_phage(18.87%)	92	NA	NA
WP_024130493.1|1483614_1484343_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.1e-27
WP_012133088.1|1484735_1485251_-	lipoprotein	NA	NA	NA	NA	NA
WP_081093757.1|1485346_1486672_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	64.2	3.3e-166
WP_058667573.1|1486697_1486937_-	excisionase family protein	NA	S4TND0	Salmonella_phage	70.8	1.7e-25
WP_058667566.1|1487154_1487529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668876.1|1487812_1488391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160880202.1|1488403_1488982_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	74.7	6.6e-79
WP_058667570.1|1488962_1489397_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	68.5	3.8e-47
WP_058668878.1|1489583_1489856_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	41.8	2.8e-08
WP_058668880.1|1489848_1490196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668882.1|1490311_1490581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668883.1|1490643_1490829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668885.1|1490828_1491029_-	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	50.8	4.6e-08
WP_125337035.1|1491012_1491246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668888.1|1491458_1492157_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	61.3	2.6e-77
WP_072274353.1|1492266_1492494_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	56.3	7.4e-18
WP_058668890.1|1492526_1493351_+	transporter	NA	Q8W644	Enterobacteria_phage	72.3	3.9e-117
WP_058668893.1|1493347_1494271_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	79.1	5.3e-115
WP_058668894.1|1494272_1495157_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	65.3	8.8e-83
WP_058668896.1|1495153_1496509_+	helicase	NA	Q8W640	Enterobacteria_phage	69.0	1.8e-172
WP_058668899.1|1496519_1496831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668901.1|1496827_1497016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668903.1|1497012_1497828_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	69.7	1.7e-109
WP_058668906.1|1498982_1499450_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_008784467.1|1499769_1500156_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
WP_000250463.1|1500142_1500424_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.0	3.1e-18
WP_058668908.1|1500423_1501041_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.4	1.3e-93
WP_058668910.1|1501037_1501595_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	38.4	1.4e-06
WP_058668911.1|1501648_1501990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058669162.1|1502214_1502721_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	65.2	3.1e-48
WP_058668913.1|1502724_1504842_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.5	5.4e-304
WP_047463010.1|1504838_1505054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668915.1|1505062_1506577_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	55.6	2.8e-153
WP_160880219.1|1506569_1508639_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	53.7	2.2e-201
WP_058668917.1|1508709_1509045_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	42.7	7.6e-11
WP_058668920.1|1509044_1509401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668923.1|1509402_1510059_+	hypothetical protein	NA	D5LGZ7	Escherichia_phage	36.3	3.6e-17
WP_058668926.1|1510070_1510625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668928.1|1510617_1511235_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	38.7	4.6e-14
WP_058668931.1|1511273_1512743_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	46.2	3.5e-76
WP_058668933.1|1512739_1513246_+|tail	phage major tail tube protein	tail	Q75QK9	Wolbachia_phage	28.1	3.0e-11
WP_058668935.1|1513297_1513597_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_058668936.1|1513699_1515547_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	30.2	6.9e-29
WP_058668937.1|1515543_1516014_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	36.4	1.2e-17
WP_058668938.1|1515988_1516204_+|tail	tail protein X	tail	NA	NA	NA	NA
WP_060937432.1|1516205_1517321_+	late control protein D	NA	R9TNM7	Vibrio_phage	34.0	4.6e-36
WP_058667554.1|1517360_1517714_+	GPW/gp25 family protein	NA	E5FFH4	Burkholderia_phage	49.1	9.4e-20
WP_060937433.1|1517697_1518615_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	50.3	8.6e-65
WP_058668939.1|1518607_1519171_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.0	1.1e-27
WP_096753839.1|1519163_1520717_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	36.9	9.8e-61
WP_096753840.1|1520716_1521295_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	58.6	5.2e-60
WP_058667560.1|1521387_1522371_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	30.4	6.3e-05
WP_047463070.1|1522428_1522839_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	54.9	2.9e-36
WP_012906750.1|1522861_1523041_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_058667562.1|1523363_1523603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058667564.1|1523599_1523839_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	90.9	2.5e-32
WP_012133087.1|1524164_1524488_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058668941.1|1524484_1525315_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012133064.1|1525311_1526325_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058668942.1|1526423_1527854_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_058668943.1|1527864_1528866_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_058668944.1|1528904_1530623_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	6.8e-31
WP_024130489.1|1530776_1531211_+	DoxX family protein	NA	NA	NA	NA	NA
WP_024130488.1|1531300_1532269_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_024130487.1|1532280_1533933_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_012133055.1|1534078_1534978_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_024130486.1|1535152_1535848_-	aquaporin Z	NA	NA	NA	NA	NA
WP_024130485.1|1536138_1537797_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_058668945.1|1537945_1539061_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_047457825.1|1539057_1541004_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	4.1e-40
WP_000447499.1|1541139_1541361_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_012133050.1|1541684_1542005_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	1.6e-13
WP_012133049.1|1542035_1544312_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	7.4e-166
WP_049009757.1|1545474_1546452_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	34.7	3.4e-43
WP_058668946.1|1546448_1549679_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.4	6.5e-83
WP_058668947.1|1549696_1551019_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_058668948.1|1551006_1551942_+	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_058668949.1|1551952_1552954_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	38.7	4.2e-49
WP_058668950.1|1552963_1553518_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_012133047.1|1554013_1554691_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_058668951.1|1554712_1555579_-	pirin family protein	NA	NA	NA	NA	NA
WP_058668952.1|1555687_1556599_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001040187.1|1557272_1557491_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012133041.1|1557775_1558480_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_058668953.1|1558524_1560246_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.2e-14
WP_058668954.1|1560246_1562013_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	4.9e-24
WP_058668955.1|1562126_1563095_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	7.2e-62
WP_000228469.1|1563642_1564137_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_081091655.1|1564271_1568195_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.8e-88
WP_024130482.1|1568317_1568929_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_024130481.1|1568939_1570283_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.6	6.6e-82
WP_058668956.1|1570374_1571667_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	9.5e-94
>prophage 2
NZ_CP023527	Citrobacter koseri strain FDAARGOS_393 chromosome, complete genome	4875257	2448150	2500022	4875257	integrase,tail,terminase	Enterobacteria_phage(24.53%)	72	2443182:2443209	2497786:2497813
2443182:2443209	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_060937472.1|2448150_2450712_-	hypothetical protein	NA	A0A0U4B0B2	Pseudomonas_phage	38.5	9.9e-18
WP_060816056.1|2450767_2453485_-	kinase	NA	A0A286S259	Klebsiella_phage	59.0	0.0e+00
WP_060816055.1|2453481_2453862_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	78.6	7.2e-58
WP_060816054.1|2454214_2454703_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	70.7	2.9e-59
WP_060816053.1|2454699_2455164_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	55.7	2.2e-48
WP_060816052.1|2455163_2458322_-|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	37.6	9.4e-95
WP_071258613.1|2458361_2458592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816051.1|2458627_2459182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816050.1|2459244_2460408_-	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	42.1	1.6e-60
WP_060816049.1|2460432_2460825_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_060816048.1|2460821_2461202_-	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	50.8	1.1e-29
WP_060816047.1|2461203_2461587_-	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	48.0	4.4e-23
WP_060937471.1|2461775_2462171_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	44.5	1.6e-15
WP_060816044.1|2462167_2462749_-	hypothetical protein	NA	S4TR53	Salmonella_phage	77.5	1.2e-80
WP_077956913.1|2462742_2463378_-	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.8	2.1e-14
WP_060816042.1|2463441_2463618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816041.1|2463709_2465170_-	glycosyltransferase family 2 protein	NA	A0A220NRM5	Escherichia_phage	79.6	8.4e-240
WP_060816040.1|2465173_2465377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816039.1|2465530_2466478_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	8.4e-132
WP_060816038.1|2466487_2467276_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.4	3.0e-66
WP_060816037.1|2467390_2467867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172960688.1|2467958_2468210_-	hypothetical protein	NA	A0A1Q1PVR6	Bacillus_phage	60.5	2.1e-21
WP_060816035.1|2468362_2469475_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.2	2.7e-113
WP_060816034.1|2469461_2470865_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.0	3.1e-130
WP_060816033.1|2470866_2472180_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.1	8.5e-183
WP_060816032.1|2472163_2473159_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.6	6.3e-37
WP_070518256.1|2473535_2474099_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_060816030.1|2474077_2474608_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	81.7	1.3e-78
WP_012132741.1|2474604_2474910_-	hypothetical protein	NA	O64361	Escherichia_phage	84.2	4.4e-42
WP_060816029.1|2475767_2476565_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	93.6	1.1e-143
WP_060816028.1|2476554_2476701_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	75.0	3.5e-13
WP_060816027.1|2476697_2477054_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	86.3	2.0e-57
WP_060816026.1|2477050_2477341_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	4.3e-47
WP_060816025.1|2477343_2477550_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	70.6	2.0e-22
WP_060816024.1|2477549_2478149_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	88.8	4.5e-99
WP_012132752.1|2478186_2478435_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	98.8	8.0e-42
WP_060816023.1|2478552_2478786_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	90.9	2.6e-34
WP_060816022.1|2478983_2479532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816021.1|2479534_2479873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816019.1|2480112_2480340_-	hypothetical protein	NA	A0A193GYL4	Enterobacter_phage	93.3	1.1e-29
WP_060816018.1|2480339_2480942_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	43.8	5.1e-34
WP_060816017.1|2480934_2481801_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	39.1	9.7e-18
WP_060816016.1|2481797_2482310_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	76.0	1.4e-72
WP_060816015.1|2482312_2482534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077956857.1|2482533_2483130_-	ead/Ea22-like family protein	NA	K7PLZ3	Enterobacterial_phage	67.1	5.1e-18
WP_060816014.1|2483126_2483738_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	50.3	3.5e-38
WP_060816013.1|2483734_2484046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816012.1|2484062_2484758_-	phage replication protein	NA	G8C7U6	Escherichia_phage	48.3	3.1e-59
WP_072271882.1|2484754_2485753_-	replication protein	NA	A5VW95	Enterobacteria_phage	72.9	2.8e-53
WP_060816092.1|2485867_2486362_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	60.1	1.6e-41
WP_024130423.1|2486412_2486646_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	62.3	9.5e-21
WP_060816011.1|2486717_2487137_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	70.4	9.1e-46
WP_000555155.1|2487356_2487764_+	hypothetical protein	NA	K7P7N9	Enterobacteria_phage	100.0	4.5e-50
WP_015980176.1|2487751_2488402_+	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	100.0	1.3e-107
WP_060816091.1|2488437_2488647_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	88.4	1.8e-26
WP_060816010.1|2489021_2489333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816090.1|2489425_2489698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816009.1|2489818_2490004_+	YebW family protein	NA	NA	NA	NA	NA
WP_060816008.1|2490013_2490172_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	88.5	4.2e-20
WP_077956858.1|2490193_2490547_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	76.9	2.0e-46
WP_060816007.1|2490692_2493659_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	79.0	0.0e+00
WP_060816006.1|2493671_2494781_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	87.8	2.9e-184
WP_060816005.1|2494815_2495160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816004.1|2495152_2495761_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	45.4	2.0e-41
WP_060816003.1|2495750_2496023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816002.1|2496030_2496270_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	73.1	3.8e-25
WP_060816001.1|2496331_2496604_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.8	3.6e-11
WP_060816000.1|2496578_2497658_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.1	8.7e-101
WP_012132024.1|2498046_2498385_-	YebY family protein	NA	NA	NA	NA	NA
2497786:2497813	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_077956859.1|2498401_2499277_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_012132022.1|2499276_2499651_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_024130259.1|2499791_2500022_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.0e-14
>prophage 3
NZ_CP023527	Citrobacter koseri strain FDAARGOS_393 chromosome, complete genome	4875257	3013342	3066982	4875257	holin,terminase,portal,capsid,protease,tail,head	Enterobacteria_phage(51.28%)	66	NA	NA
WP_058667634.1|3013342_3016810_-	host specificity protein J	NA	M9P0D8	Enterobacteria_phage	85.9	0.0e+00
WP_058667636.1|3016864_3017482_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	83.4	6.1e-91
WP_058669107.1|3017459_3018194_-	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	82.1	5.7e-120
WP_058667638.1|3018196_3018934_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	92.2	2.3e-137
WP_058667640.1|3018989_3019328_-|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	88.4	9.5e-54
WP_058667642.1|3019330_3021889_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	58.8	1.7e-259
WP_058667644.1|3021854_3022187_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	79.2	2.0e-43
WP_058667646.1|3022195_3022609_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	66.4	2.8e-31
WP_058667648.1|3022646_3023384_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	79.6	1.4e-105
WP_058667650.1|3023391_3023790_-|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	73.5	9.5e-53
WP_058667652.1|3023786_3024341_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	87.5	5.7e-72
WP_058667653.1|3024353_3024707_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	70.1	1.4e-44
WP_058667655.1|3024717_3025110_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	47.3	2.0e-18
WP_058667657.1|3025152_3026178_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	90.9	2.9e-178
WP_058667659.1|3026245_3026578_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	76.4	1.8e-41
WP_058667660.1|3026587_3027916_-	S49 family peptidase	NA	O64320	Escherichia_phage	75.6	1.1e-180
WP_058667662.1|3027896_3029489_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	90.6	1.4e-285
WP_058667664.1|3029485_3029692_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	92.6	4.6e-27
WP_060815839.1|3029691_3031614_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	94.4	0.0e+00
WP_058667666.1|3031588_3032134_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	94.5	1.2e-90
WP_125336880.1|3032384_3032894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058667670.1|3032978_3033188_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	86.6	2.9e-29
WP_058667672.1|3033247_3033493_-	hypothetical protein	NA	K7PKT0	Enterobacteria_phage	64.2	2.8e-23
WP_058667674.1|3033558_3033789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271854.1|3033929_3034199_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.3	4.5e-22
WP_058667676.1|3034205_3034835_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	80.9	3.9e-93
WP_058667678.1|3034991_3035270_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	71.9	1.9e-31
WP_047462987.1|3035259_3035652_-|holin	phage holin family protein	holin	G8C7V8	Escherichia_phage	79.7	7.4e-50
WP_058667680.1|3035759_3036356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667682.1|3036495_3037305_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	63.8	1.6e-83
WP_058667684.1|3037323_3038319_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.5	5.5e-142
WP_058667686.1|3038315_3039002_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	53.3	4.9e-57
WP_058667690.1|3039347_3040340_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	77.6	4.5e-136
WP_058667692.1|3040336_3040516_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_058669109.1|3040517_3041162_-	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	50.7	5.7e-47
WP_058667694.1|3041400_3041952_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	53.5	7.0e-46
WP_058667696.1|3041980_3042223_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058667698.1|3042361_3043048_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	40.3	2.7e-39
WP_058667700.1|3043039_3043921_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	29.0	1.9e-29
WP_058667702.1|3045196_3045568_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	91.9	5.3e-58
WP_058667704.1|3045624_3046452_+	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	74.2	1.0e-112
WP_058667706.1|3046580_3047120_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	68.7	1.7e-65
WP_058667707.1|3047280_3047535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667709.1|3047531_3048023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667712.1|3048019_3048793_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_153257544.1|3048789_3048942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667715.1|3049415_3049625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667717.1|3051331_3051541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667719.1|3051543_3052722_+	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.4	1.2e-29
WP_012131563.1|3053110_3053758_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_058667721.1|3053837_3054887_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_012131561.1|3054883_3055441_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_047462438.1|3055437_3057381_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_047462435.1|3057377_3057857_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_012131557.1|3057853_3058066_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_012131556.1|3058062_3058800_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_012131555.1|3058944_3059604_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_012131554.1|3059600_3060221_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	24.5	8.2e-11
WP_012131552.1|3060233_3060836_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_047462429.1|3060845_3061295_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_047462425.1|3061291_3062155_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_058667724.1|3062141_3062837_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_012131548.1|3062843_3065330_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_012131547.1|3065326_3065593_-	chaperone NapD	NA	NA	NA	NA	NA
WP_024130164.1|3065579_3066074_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_024130163.1|3066484_3066982_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 4
NZ_CP023527	Citrobacter koseri strain FDAARGOS_393 chromosome, complete genome	4875257	3406292	3451549	4875257	plate,terminase,protease,tRNA,tail,head,integrase	Salmonella_phage(51.16%)	55	3400485:3400500	3452068:3452083
3400485:3400500	attL	GCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_012131222.1|3406292_3406835_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_012131221.1|3406852_3407488_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_058667928.1|3407594_3408488_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_012131219.1|3408603_3409452_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096753866.1|3409755_3410028_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	92.0	2.0e-38
WP_096753867.1|3410194_3411316_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	2.8e-17
WP_096753868.1|3411351_3411804_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	47.1	2.0e-22
WP_096753869.1|3413043_3413724_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	79.2	2.5e-109
WP_096753870.1|3413720_3414920_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	90.5	6.5e-198
WP_096753871.1|3414920_3415277_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	94.1	3.7e-56
WP_096753872.1|3415279_3415933_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.2	1.7e-83
WP_096753873.1|3415998_3416358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138089228.1|3416471_3416936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096753875.1|3416939_3418004_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	84.2	4.8e-160
WP_096753876.1|3418006_3418309_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	95.0	3.3e-50
WP_096753877.1|3418308_3418896_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	90.8	3.5e-88
WP_096753878.1|3418895_3420878_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	75.6	3.8e-275
WP_045269847.1|3421055_3421508_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	80.0	1.1e-62
WP_000257260.1|3421511_3421952_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_060816151.1|3421963_3423109_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.9	5.9e-164
WP_060816152.1|3423112_3423676_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001142474.1|3423650_3424040_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	97.7	6.0e-68
WP_096753879.1|3424026_3424575_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.0	2.8e-79
WP_039265776.1|3424571_3424982_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	87.5	2.5e-64
WP_096753880.1|3424947_3425307_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	43.9	8.9e-18
WP_096753931.1|3425350_3426292_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	2.6e-157
WP_039265773.1|3426310_3426808_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.0	3.5e-73
WP_096753881.1|3426814_3428035_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	80.6	8.2e-188
WP_138089229.1|3428038_3428785_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.0	7.4e-91
WP_096753882.1|3428672_3430139_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	86.9	1.0e-248
WP_070518184.1|3430138_3431761_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	83.7	3.2e-280
WP_039265766.1|3431763_3432336_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	67.9	1.8e-60
WP_096753883.1|3432394_3432940_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	73.7	3.7e-55
WP_096753884.1|3432936_3433473_-	lysozyme	NA	Q71TF3	Escherichia_phage	51.4	4.0e-46
WP_039265763.1|3433450_3433771_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	79.8	4.8e-39
WP_096753885.1|3433842_3434457_-	methyltransferase domain-containing protein	NA	H2BDB7	Pseudomonas_virus	51.0	2.3e-50
WP_096753886.1|3434407_3435304_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	50.9	4.4e-74
WP_096753887.1|3435297_3435849_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	50.6	1.2e-42
WP_058667961.1|3436132_3436567_-	antitermination protein Q	NA	B6SD39	Bacteriophage	60.3	2.6e-40
WP_096753888.1|3436855_3439042_-	replication protein	NA	B6SCY1	Bacteriophage	71.7	1.3e-172
WP_096753889.1|3439045_3439258_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	44.4	1.6e-06
WP_096753890.1|3439378_3440002_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	45.8	3.0e-37
WP_169811558.1|3440798_3440948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753891.1|3440944_3441865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753892.1|3441867_3443169_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	57.8	1.8e-140
WP_096753893.1|3443183_3443732_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	66.5	6.5e-68
WP_052895624.1|3443777_3443969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753894.1|3443965_3444802_+|protease	serine protease	protease	V5KSK5	Escherichia_phage	73.3	4.7e-94
WP_096753895.1|3444877_3446944_+	DNA polymerase	NA	Q775A3	Bordetella_phage	68.1	6.1e-276
WP_096753896.1|3446948_3447170_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096753897.1|3447159_3447453_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	1.1e-26
WP_175402960.1|3447425_3448571_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	49.2	2.2e-102
WP_096753899.1|3448557_3449958_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.1	1.3e-213
WP_024154042.1|3449954_3450155_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096753900.1|3450151_3451549_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3452068:3452083	attR	GCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 5
NZ_CP023527	Citrobacter koseri strain FDAARGOS_393 chromosome, complete genome	4875257	3819676	3860767	4875257	tRNA,plate,transposase,protease	Erwinia_phage(33.33%)	41	NA	NA
WP_058668076.1|3819676_3820174_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_012135060.1|3820268_3820976_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_049010798.1|3821053_3821785_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_012135062.1|3821797_3822745_+	glutathione synthase	NA	NA	NA	NA	NA
WP_012135063.1|3822921_3823485_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_058668077.1|3823484_3823901_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_058668078.1|3824011_3824992_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_058668079.1|3825009_3825714_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012135068.1|3825732_3826299_+	YggT family protein	NA	NA	NA	NA	NA
WP_012135069.1|3826295_3826586_+	YggU family protein	NA	NA	NA	NA	NA
WP_058668080.1|3826593_3827187_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_060815921.1|3827179_3828316_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_049010789.1|3828434_3829481_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012135073.1|3829663_3830383_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_012135074.1|3830435_3830762_-	YggL family protein	NA	NA	NA	NA	NA
WP_024130937.1|3830761_3831481_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_024130938.1|3831642_3832695_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_012135077.1|3832723_3832999_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_065422798.1|3833096_3834179_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_049010794.1|3834390_3835647_+	nucleoside permease	NA	NA	NA	NA	NA
WP_058668081.1|3835719_3837855_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_012135082.1|3838282_3838990_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_024130940.1|3839323_3839662_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	39.4	5.3e-12
WP_072271836.1|3839720_3839876_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158660923.1|3840163_3840529_+	hypothetical protein	NA	Q716C2	Shigella_phage	49.1	1.8e-21
WP_125336793.1|3840728_3841043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271835.1|3841108_3841267_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_060815920.1|3841423_3842185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668084.1|3843205_3843685_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_058668085.1|3843708_3845049_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_125337104.1|3845059_3848494_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_058668087.1|3848599_3850015_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_058668088.1|3850019_3850751_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_058668089.1|3850747_3853498_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	31.5	7.2e-83
WP_058669119.1|3853509_3854286_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_058668090.1|3854323_3855664_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_058668091.1|3855666_3856200_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_172960684.1|3856196_3857495_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_058668092.1|3857499_3858543_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_058668093.1|3858509_3860342_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_125337101.1|3860341_3860767_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
