The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	33064	104030	4209407	protease,portal,head,capsid,tRNA,terminase,plate,integrase,tail	uncultured_Caudovirales_phage(24.32%)	73	68207:68233	110798:110824
WP_096748496.1|33064_34594_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.4	2.6e-82
WP_096748497.1|34772_35877_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	35.5	3.7e-06
WP_096748498.1|36121_37816_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	26.1	3.5e-27
WP_096748499.1|37825_38932_-	regulator	NA	NA	NA	NA	NA
WP_047837621.1|39252_40506_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017919667.1|40498_41251_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.6	3.4e-35
WP_096748500.1|41255_42041_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_096750546.1|42179_44672_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_046580858.1|44945_45755_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096748501.1|46024_47686_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.6	2.3e-153
WP_096748502.1|47682_48537_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.7	1.0e-48
WP_013698717.1|48634_49918_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.6	1.7e-151
WP_096748503.1|50000_50420_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_036032199.1|50535_50895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017919660.1|50946_51897_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_096748504.1|51935_52460_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_096748505.1|52653_53538_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_164467549.1|53682_54579_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_096750547.1|54666_55497_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_013698709.1|55576_56212_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_096748507.1|56294_56954_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013698707.1|56963_58166_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096748508.1|58224_58806_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025099054.1|58850_59753_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_096748509.1|59862_61008_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_060002348.1|61012_61789_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.2	6.4e-29
WP_172877198.1|62422_63649_-	AraC family ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_013698701.1|63681_64230_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_096748510.1|64313_65606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748511.1|65589_68298_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.9	5.7e-24
68207:68233	attL	AGGTACTGCTGCATCATGGGCGTGTGG	NA	NA	NA	NA
WP_036050065.1|68456_69758_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	57.2	5.7e-139
WP_013698698.1|69714_69951_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_096748512.1|69959_70352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748513.1|70453_71833_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	A0A2I7QW51	Vibrio_phage	25.7	1.8e-05
WP_096748514.1|71832_72195_-	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_096748515.1|72246_72465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124076448.1|72593_73055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164467548.1|72999_73521_-	helix-turn-helix domain-containing protein	NA	A0A193GYL7	Enterobacter_phage	38.3	1.1e-11
WP_096748517.1|73634_73871_+	hypothetical protein	NA	B5WZX6	Pseudomonas_phage	47.1	3.0e-06
WP_096748518.1|73948_74491_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	48.2	2.6e-29
WP_096750548.1|74477_74861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748519.1|75121_77629_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.2	1.8e-93
WP_096748520.1|77858_78632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138110599.1|78867_79446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175427735.1|80219_80789_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_175427736.1|80751_82755_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.0	8.4e-182
WP_013698685.1|82765_82972_+	hypothetical protein	NA	A0A219Y8X9	Aeromonas_phage	52.1	3.8e-05
WP_096748525.1|82968_84459_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	52.0	3.0e-136
WP_096748526.1|84455_85550_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.8	1.6e-49
WP_013698682.1|85579_85924_+|head	head decoration protein	head	NA	NA	NA	NA
WP_046579516.1|86000_86996_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	63.6	1.0e-119
WP_096748527.1|86997_87288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748528.1|87291_87822_+|tail	phage tail protein	tail	K7R9K2	Vibrio_phage	34.9	2.8e-20
WP_096748529.1|87811_88342_+	hypothetical protein	NA	A0A1B2LRU9	Wolbachia_phage	42.8	1.7e-25
WP_096748530.1|88338_89019_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	29.1	6.4e-17
WP_124076446.1|89125_89863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748532.1|89929_90121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698675.1|90123_90456_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.0	9.4e-22
WP_096748533.1|90452_91349_+|plate	baseplate J/gp47 family protein	plate	A0A1J0I2M3	Salmonella_phage	38.7	1.5e-45
WP_096748534.1|91338_91917_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.4	1.9e-33
WP_096748535.1|91904_93869_+|tail	tail fiber protein	tail	E5E3V2	Burkholderia_phage	59.5	8.1e-129
WP_096748536.1|93882_94599_+|tail	tail fiber assembly protein	tail	E5E3Q6	Burkholderia_phage	58.6	1.4e-59
WP_096748537.1|94669_95839_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.4	1.4e-160
WP_013698992.1|95848_96352_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.2	5.6e-42
WP_096748538.1|96433_96736_+|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	1.7e-06
WP_096748539.1|96817_99247_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	36.1	2.5e-55
WP_017918172.1|99256_100135_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.2	1.2e-34
WP_013698666.1|100109_100316_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	8.4e-13
WP_096748540.1|100325_101375_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.2	3.6e-83
WP_017918170.1|101445_101895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748541.1|101891_102458_+	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	54.3	1.1e-49
WP_096748542.1|102460_103084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748543.1|103244_104030_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	82.1	2.5e-129
110798:110824	attR	AGGTACTGCTGCATCATGGGCGTGTGG	NA	NA	NA	NA
>prophage 2
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	1044634	1087915	4209407	protease,head,portal,capsid,tRNA,terminase,plate,integrase,tail	uncultured_Caudovirales_phage(32.14%)	55	1047970:1047986	1079321:1079337
WP_096749021.1|1044634_1045420_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	82.1	1.6e-128
WP_096749022.1|1045580_1046204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046579493.1|1046206_1046773_-	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	53.7	1.1e-49
WP_017918170.1|1046769_1047219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749023.1|1047292_1048342_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.8	9.4e-84
1047970:1047986	attL	GGCGCGCGACGTCGCCG	NA	NA	NA	NA
WP_013698666.1|1048351_1048558_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	8.4e-13
WP_096749024.1|1048532_1049411_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	36.8	4.4e-34
WP_096749025.1|1049420_1051850_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	36.1	1.9e-55
WP_013697851.1|1051931_1052234_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	1.3e-06
WP_013697850.1|1052315_1052819_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.2	5.6e-42
WP_096749026.1|1052829_1053999_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.4	8.1e-161
WP_096749027.1|1054069_1054789_-|tail	tail fiber assembly protein	tail	E5E3Q6	Burkholderia_phage	58.6	1.5e-59
WP_096749028.1|1054802_1056767_-|tail	tail fiber protein	tail	E5E3V2	Burkholderia_phage	59.0	1.7e-126
WP_096749029.1|1056754_1057333_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.4	3.2e-33
WP_096749030.1|1057322_1058219_-|plate	baseplate J/gp47 family protein	plate	A0A1J0I2M3	Salmonella_phage	39.4	1.3e-46
WP_096749031.1|1058215_1058548_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	1.4e-20
WP_096750606.1|1058550_1058742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138110605.1|1058809_1059547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749033.1|1059653_1060334_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	28.5	4.2e-16
WP_096749034.1|1060330_1060861_-	hypothetical protein	NA	A0A1B2LRU9	Wolbachia_phage	42.8	5.0e-25
WP_013698679.1|1060850_1061381_-|tail	phage tail protein	tail	K7R9K2	Vibrio_phage	34.9	3.7e-20
WP_096749035.1|1061384_1061675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749036.1|1061676_1062672_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	63.3	8.6e-119
WP_013698682.1|1062748_1063093_-|head	head decoration protein	head	NA	NA	NA	NA
WP_096749037.1|1063122_1064241_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	35.4	2.1e-49
WP_096749038.1|1064237_1065728_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	52.0	4.0e-136
WP_013698685.1|1065724_1065931_-	hypothetical protein	NA	A0A219Y8X9	Aeromonas_phage	52.1	3.8e-05
WP_175427745.1|1065941_1067957_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	52.5	8.8e-179
WP_175427746.1|1067919_1068489_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096749041.1|1068601_1068796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749042.1|1069043_1069817_-	zinc finger-like domain-containing protein	NA	NA	NA	NA	NA
WP_096749043.1|1070057_1072559_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.7	1.9e-98
WP_096750607.1|1072717_1073101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749044.1|1073087_1073630_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.2	7.6e-29
WP_138110607.1|1074059_1074575_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138110609.1|1074516_1075050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749046.1|1075132_1075375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096750608.1|1075418_1075787_+	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_138110611.1|1075786_1076824_+	chromosome partitioning protein ParB	NA	A0A2I7QW51	Vibrio_phage	27.1	1.2e-06
WP_175427747.1|1076925_1077285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749048.1|1077277_1077727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697846.1|1077723_1077984_+	pyocin activator PrtN family protein	NA	I6NSR8	Burkholderia_phage	68.7	1.3e-26
WP_096749049.1|1077968_1079045_-|integrase	site-specific integrase	integrase	I6NSG1	Burkholderia_phage	53.3	6.7e-109
WP_096749050.1|1079162_1080200_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1079321:1079337	attR	CGGCGACGTCGCGCGCC	NA	NA	NA	NA
WP_013697843.1|1080447_1080705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013697842.1|1080740_1080938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013697841.1|1081092_1081308_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_096749051.1|1081350_1082319_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.6	7.2e-30
WP_025101273.1|1082315_1083149_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_096749052.1|1083160_1084318_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_036041198.1|1084696_1085125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697836.1|1085285_1085624_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_096749053.1|1085630_1086128_-	heme-degrading domain-containing protein	NA	NA	NA	NA	NA
WP_025101275.1|1086615_1087161_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_096749054.1|1087171_1087915_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	1136032	1225274	4209407	head,portal,capsid,tRNA,transposase,terminase,plate,integrase,tail	Burkholderia_virus(25.71%)	102	1182621:1182637	1223428:1223444
WP_096749084.1|1136032_1136476_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036041394.1|1136625_1137723_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_096749085.1|1137844_1139275_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	9.0e-45
WP_096749086.1|1139362_1140646_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_013697786.1|1140773_1143644_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_025101217.1|1143976_1145797_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_013697784.1|1146123_1146633_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096749088.1|1146684_1148247_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_036041280.1|1148318_1149551_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017919159.1|1149564_1151136_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_096749089.1|1151233_1152172_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_013697779.1|1152198_1152567_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_036041284.1|1152678_1155645_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.1	7.7e-22
WP_096749090.1|1155738_1157214_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_013697776.1|1157210_1157672_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_096749091.1|1157962_1159684_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_096749092.1|1159747_1160848_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.7	9.7e-23
WP_096749093.1|1161152_1162343_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_025098688.1|1162422_1163325_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013697771.1|1163740_1164142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_124076244.1|1164325_1164583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697770.1|1164727_1165045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749095.1|1165245_1165962_+	YdcF family protein	NA	NA	NA	NA	NA
WP_096749096.1|1166190_1166451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697767.1|1166608_1166863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749097.1|1166915_1167206_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_096749098.1|1167699_1168911_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_096749099.1|1169525_1170347_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_138110613.1|1170343_1170778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749101.1|1170796_1171129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749102.1|1171125_1171428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749103.1|1171466_1172036_-	lysozyme	NA	A0A059VA40	Pseudomonas_phage	44.5	3.3e-30
WP_124076240.1|1172032_1172518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750612.1|1172589_1174302_-	transporter	NA	Q6UIY0	Burkholderia_virus	32.4	7.8e-11
WP_096749105.1|1174557_1174785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749106.1|1175796_1176438_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_096749107.1|1176438_1177596_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	31.9	4.2e-32
WP_096749108.1|1177595_1178036_-	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	40.0	2.1e-21
WP_096749109.1|1178097_1178718_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	32.4	1.6e-06
WP_096749110.1|1178717_1179872_-	hypothetical protein	NA	U5P0H6	Shigella_phage	32.6	1.4e-35
WP_096749111.1|1179868_1181299_-	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096749112.1|1181313_1183206_-	hypothetical protein	NA	NA	NA	NA	NA
1182621:1182637	attL	CGCTGCGCTGGCCCGCG	NA	NA	NA	NA
WP_096749113.1|1183338_1183683_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_017918044.1|1183691_1184066_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_096749114.1|1184129_1185614_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	42.4	1.9e-90
WP_096749115.1|1185610_1185811_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_096749116.1|1185820_1186384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749117.1|1186380_1186704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749118.1|1186705_1186972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749119.1|1186971_1188039_-|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	34.1	3.1e-50
WP_096749120.1|1188120_1188798_-|head	head decoration protein	head	NA	NA	NA	NA
WP_096749121.1|1188833_1189445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749122.1|1189465_1190356_-	S49 family peptidase	NA	S4TQW3	Salmonella_phage	44.4	4.7e-44
WP_096749123.1|1190355_1191990_-|portal	phage portal protein	portal	A0A286MNI7	Klebsiella_phage	34.1	5.6e-75
WP_017918055.1|1191989_1192238_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_096749124.1|1192248_1194243_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	47.9	8.2e-145
WP_096749125.1|1194220_1194811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138110615.1|1194852_1195098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124076235.1|1195084_1195447_-	DUF2591 family protein	NA	F8TVJ2	EBPR_siphovirus	40.0	2.5e-12
WP_096749128.1|1195452_1196073_-	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	36.8	4.2e-07
WP_124076233.1|1196241_1196661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749130.1|1196684_1196918_-	hypothetical protein	NA	Q6JIF5	Burkholderia_virus	53.2	7.1e-16
WP_124076231.1|1196914_1197262_-	hypothetical protein	NA	Q8W6N6	Burkholderia_virus	38.5	3.5e-11
WP_096749132.1|1197249_1197669_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	73.5	6.5e-52
WP_096749133.1|1197940_1198270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164467530.1|1198266_1198743_-	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	54.8	6.9e-26
WP_096750613.1|1198969_1199440_-	hypothetical protein	NA	Q3HR00	Burkholderia_phage	69.9	1.2e-57
WP_096749136.1|1199439_1199985_-	DUF1064 domain-containing protein	NA	Q6JIF9	Burkholderia_virus	48.0	1.6e-34
WP_096749137.1|1200160_1201150_-	helix-turn-helix domain-containing protein	NA	Q8W6P0	Burkholderia_virus	58.8	1.6e-88
WP_096749138.1|1201146_1201848_-	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	40.6	8.1e-23
WP_096749139.1|1201860_1202718_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	48.0	5.2e-56
WP_096749140.1|1202727_1203084_-	hypothetical protein	NA	A1YZR1	Burkholderia_virus	70.5	9.4e-44
WP_096749141.1|1203353_1203542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749142.1|1204256_1204556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750614.1|1204879_1205281_+	hypothetical protein	NA	C7BGF7	Burkholderia_phage	68.2	1.8e-43
WP_096749144.1|1205640_1205889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749145.1|1205881_1206163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076229.1|1206226_1206589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749146.1|1207245_1207437_+	hypothetical protein	NA	Q3HQX5	Burkholderia_phage	64.3	4.1e-14
WP_138110617.1|1207519_1207747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076225.1|1207784_1207973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164467529.1|1207999_1208146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076223.1|1208188_1208449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749150.1|1208479_1208761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076221.1|1208768_1208972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749151.1|1209120_1209750_+	hypothetical protein	NA	A0A1B3AYH1	Gordonia_phage	37.4	1.4e-26
WP_096749152.1|1209805_1211545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749153.1|1211541_1211766_+	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	62.3	1.6e-17
WP_096750616.1|1211774_1212086_+	hypothetical protein	NA	A0A248SKZ7	Klebsiella_phage	40.0	7.7e-10
WP_124076219.1|1212082_1212565_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_096749155.1|1212561_1212822_+	hypothetical protein	NA	A0A0F7L7G7	uncultured_marine_virus	40.0	4.3e-06
WP_096749156.1|1212818_1213046_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_164467580.1|1213444_1214170_+|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	70.0	7.2e-83
WP_124076218.1|1214183_1214729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749158.1|1215023_1216268_-	MFS transporter	NA	NA	NA	NA	NA
WP_096749159.1|1216500_1217949_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_013697762.1|1218000_1218171_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_096749160.1|1218532_1220707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025098697.1|1220809_1221220_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013697759.1|1221276_1221678_-	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	41.1	2.8e-12
WP_096749161.1|1221751_1224181_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
1223428:1223444	attR	CGCTGCGCTGGCCCGCG	NA	NA	NA	NA
WP_013697757.1|1224260_1225274_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.0e-27
>prophage 4
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	1907210	1915539	4209407		Cowpox_virus(16.67%)	8	NA	NA
WP_096750650.1|1907210_1908050_+	alpha/beta hydrolase	NA	P87627	Cowpox_virus	31.2	2.7e-25
WP_036037647.1|1908156_1909080_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.6	2.9e-44
WP_096749530.1|1909260_1910493_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036053687.1|1910594_1911497_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.8e-51
WP_017918748.1|1911732_1912068_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096749531.1|1912143_1913136_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	3.1e-28
WP_013697004.1|1913192_1914170_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.2	3.3e-14
WP_096749532.1|1914138_1915539_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.3	1.8e-77
>prophage 5
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	1994247	2003629	4209407	tRNA	Bacillus_virus(33.33%)	7	NA	NA
WP_096749573.1|1994247_1995549_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.2e-93
WP_096749574.1|1995636_1996947_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	7.2e-81
WP_096749575.1|1997163_1997847_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_164467513.1|1997891_2000204_-	DNA translocase FtsK 4TM domain-containing protein	NA	G1FGP1	Mycobacterium_phage	50.8	3.4e-86
WP_096749576.1|2000498_2001461_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	43.7	1.1e-62
WP_096749577.1|2001601_2002393_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	31.6	1.8e-10
WP_013696917.1|2002510_2003629_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.5	2.0e-23
>prophage 6
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	2233209	2242176	4209407		Roseobacter_phage(16.67%)	7	NA	NA
WP_096749699.1|2233209_2234811_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B0V011	Roseobacter_phage	28.8	3.1e-17
WP_096749700.1|2234840_2235371_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_013696728.1|2235367_2236051_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	29.3	6.7e-06
WP_013696727.1|2236097_2236913_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	30.9	6.3e-35
WP_096749701.1|2237010_2238858_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.9	3.3e-55
WP_036029634.1|2238877_2240014_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.0e-22
WP_036029636.1|2240229_2242176_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.8	3.2e-146
>prophage 7
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	2508008	2559602	4209407	plate,tRNA,integrase,tail	Pseudomonas_phage(25.0%)	43	2554024:2554045	2559727:2559748
WP_036048432.1|2508008_2509295_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013696492.1|2509387_2510470_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	5.1e-08
WP_096749816.1|2510484_2511333_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_012734508.1|2511497_2511809_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_025100899.1|2511822_2512422_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_025100898.1|2512554_2513364_+	dioxygenase	NA	NA	NA	NA	NA
WP_036048435.1|2513494_2515093_-	APC family permease	NA	NA	NA	NA	NA
WP_012734504.1|2515527_2515731_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
WP_096749817.1|2516013_2517273_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_017921196.1|2517617_2518220_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_013696485.1|2518463_2519747_-	MFS transporter	NA	NA	NA	NA	NA
WP_013696484.1|2519925_2520543_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096749818.1|2520644_2521223_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_036029498.1|2521256_2522111_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096749819.1|2522222_2523356_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017921200.1|2523554_2524037_-	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_096749820.1|2524135_2525065_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096749821.1|2525207_2526185_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013696477.1|2526217_2526370_+	DUF1427 family protein	NA	NA	NA	NA	NA
WP_017921682.1|2526475_2527507_-	transporter	NA	NA	NA	NA	NA
WP_096749822.1|2527983_2529027_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096749823.1|2529150_2530002_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_096749824.1|2530284_2534157_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_013696472.1|2534153_2535140_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_042284858.1|2535144_2536182_+	OmpA family protein	NA	NA	NA	NA	NA
WP_096749825.1|2536275_2537430_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_096749826.1|2537567_2540243_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.9	1.6e-87
WP_017918328.1|2540319_2541417_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_013696467.1|2541380_2543219_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_013696466.1|2543296_2543779_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_013696465.1|2543867_2544371_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013696464.1|2544447_2545938_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013696463.1|2545953_2546472_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_096749827.1|2546508_2547159_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_046581236.1|2547532_2548150_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_036048467.1|2548250_2549597_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013696459.1|2549593_2550379_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_096749828.1|2550474_2551659_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	2.0e-18
WP_096749829.1|2552044_2552488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750673.1|2553560_2553845_+	hypothetical protein	NA	NA	NA	NA	NA
2554024:2554045	attL	CGGCTGCAGGACTCGAACCCGC	NA	NA	NA	NA
WP_124076054.1|2554285_2554867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749831.1|2555756_2557355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749832.1|2557910_2559602_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2559727:2559748	attR	CGGCTGCAGGACTCGAACCCGC	NA	NA	NA	NA
>prophage 8
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	2805769	2886239	4209407	tRNA,plate,holin,integrase,tail	Burkholderia_phage(58.62%)	70	2793918:2793937	2830968:2830987
2793918:2793937	attL	AGCCGAGCGCCTCCAGCGTG	NA	NA	NA	NA
WP_013696233.1|2805769_2805976_+|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	70.6	2.1e-19
WP_013696232.1|2805991_2806336_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	80.5	6.1e-40
WP_013696231.1|2806337_2806610_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	76.7	1.3e-29
WP_096749930.1|2806606_2807419_+	N-acetylmuramidase family protein	NA	A4JWU0	Burkholderia_virus	75.2	4.1e-111
WP_096749931.1|2807415_2807865_+	protein LYSB	NA	E5E3W1	Burkholderia_phage	64.1	6.1e-40
WP_096749932.1|2807842_2808019_+	LysC protein	NA	K4PAX1	Burkholderia_phage	80.0	3.1e-08
WP_013696227.1|2808011_2808428_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	46.7	2.6e-29
WP_096750684.1|2808661_2809360_+|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	74.1	1.0e-89
WP_096749933.1|2809356_2809719_+	GPW/gp25 family protein	NA	E5E3V5	Burkholderia_phage	74.2	6.6e-45
WP_036035314.1|2809715_2810621_+|plate	baseplate J/gp47 family protein	plate	E5E3V4	Burkholderia_phage	79.4	6.1e-132
WP_096749934.1|2810598_2811156_+|tail	phage tail protein I	tail	E5E3V3	Burkholderia_phage	78.9	9.1e-78
WP_096749935.1|2811158_2813753_+|tail	phage tail protein	tail	E5E3V2	Burkholderia_phage	55.3	4.7e-225
WP_096749936.1|2813771_2814611_+|tail	tail fiber assembly protein	tail	A4JWS8	Burkholderia_virus	71.6	1.1e-77
WP_025097759.1|2814660_2815833_+|tail	phage tail sheath protein	tail	E5E3V0	Burkholderia_phage	80.5	1.4e-181
WP_013696219.1|2815860_2816370_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	69.8	2.3e-67
WP_096749937.1|2816439_2816775_+|tail	phage tail assembly protein	tail	E5E3U8	Burkholderia_phage	79.4	2.4e-33
WP_013696217.1|2816783_2816903_+|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	83.8	1.6e-11
WP_096749938.1|2816899_2819845_+	hypothetical protein	NA	A4JWS3	Burkholderia_virus	30.1	6.3e-85
WP_096749939.1|2819859_2820342_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	71.0	4.0e-45
WP_096749940.1|2820341_2821439_+	phage late control D family protein	NA	A4JWS1	Burkholderia_virus	61.8	1.7e-120
WP_046580238.1|2821634_2821922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749941.1|2822111_2822585_-	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	56.4	6.6e-37
WP_013696212.1|2822676_2822880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025097752.1|2822989_2823238_+	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	86.6	3.6e-34
WP_124076050.1|2823322_2823805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749943.1|2823801_2824005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749944.1|2824007_2826800_+	toprim domain-containing protein	NA	E5E3N5	Burkholderia_phage	85.6	0.0e+00
WP_096749945.1|2827601_2828708_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	77.9	1.5e-159
WP_096749946.1|2829127_2830066_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_096749947.1|2830182_2832267_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.4	5.8e-101
2830968:2830987	attR	AGCCGAGCGCCTCCAGCGTG	NA	NA	NA	NA
WP_096749948.1|2832738_2833791_+	oxidoreductase	NA	NA	NA	NA	NA
WP_013696202.1|2833993_2834398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096749949.1|2835274_2836393_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_046580227.1|2836436_2836820_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_096749950.1|2836883_2839814_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.3	1.7e-255
WP_013696198.1|2839957_2841103_+	alginate lyase family protein	NA	NA	NA	NA	NA
WP_047836194.1|2841132_2842521_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_025097738.1|2842726_2844448_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_096749951.1|2844493_2845579_+	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
WP_096749952.1|2845640_2846807_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096749953.1|2847145_2848666_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013696192.1|2848755_2849550_-	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_096749954.1|2849546_2850944_-	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_096750685.1|2850981_2852391_-	ethanolamine permease	NA	NA	NA	NA	NA
WP_096749955.1|2852620_2853100_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_096749956.1|2853191_2853380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096749957.1|2853415_2856079_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.8	7.9e-135
WP_017919796.1|2856167_2856599_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_025097728.1|2856695_2857307_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096750686.1|2857365_2858112_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096749958.1|2858206_2859361_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_013696183.1|2859639_2860779_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046580211.1|2860865_2864789_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_096749959.1|2865281_2867534_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_013696180.1|2868062_2869190_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_096750687.1|2869355_2870189_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013696176.1|2872806_2873232_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_017917924.1|2873391_2874786_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_013696174.1|2874858_2875737_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_036048690.1|2875809_2877351_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_046580205.1|2877395_2877935_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_013696171.1|2877937_2878408_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_013696170.1|2878534_2878804_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_096749960.1|2878880_2879732_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_096749961.1|2879893_2880424_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_046580203.1|2880688_2881822_-	anion permease	NA	NA	NA	NA	NA
WP_013696166.1|2881829_2882717_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	37.3	3.8e-17
WP_013696165.1|2882755_2883526_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	31.4	1.7e-21
WP_096749962.1|2883582_2884272_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_096749963.1|2884268_2886239_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	3002260	3061225	4209407	protease,tRNA,integrase,transposase	Erysipelothrix_phage(13.33%)	50	2997435:2997452	3023239:3023256
2997435:2997452	attL	AGGCGGCCACCACCATCA	NA	NA	NA	NA
WP_096750009.1|3002260_3003498_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	87.3	6.2e-143
WP_096750010.1|3004568_3006125_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.9	9.0e-123
WP_133120770.1|3006182_3006530_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096750011.1|3006517_3006883_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096750012.1|3007376_3010142_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	28.6	6.8e-97
WP_096750013.1|3010125_3012153_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	32.5	7.0e-67
WP_096750014.1|3012321_3013299_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	39.1	1.6e-48
WP_013699758.1|3013590_3013995_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_096750015.1|3014049_3014928_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_013699756.1|3015000_3016020_-	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_025097238.1|3016418_3017471_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046575281.1|3017594_3020243_-	DNA topoisomerase III	NA	J3E777	Acanthamoeba_polyphaga_lentillevirus	24.4	1.6e-18
WP_013699753.1|3020453_3020834_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_096750695.1|3020833_3022216_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	3.6e-22
WP_096750016.1|3022434_3022938_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.3	6.4e-22
WP_096750017.1|3022961_3023945_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.3	1.0e-07
3023239:3023256	attR	TGATGGTGGTGGCCGCCT	NA	NA	NA	NA
WP_036048800.1|3024159_3024807_+	LysE family translocator	NA	NA	NA	NA	NA
WP_013699748.1|3024960_3025818_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_164467602.1|3026163_3026907_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_096750696.1|3027072_3028503_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_096750019.1|3028499_3029090_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_096750020.1|3029079_3031488_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_096750021.1|3031488_3032178_+	response regulator	NA	NA	NA	NA	NA
WP_096750022.1|3032674_3033409_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	43.5	3.1e-49
WP_013699739.1|3033577_3034210_+	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	32.9	1.1e-07
WP_013699738.1|3034229_3034682_+	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	5.8e-14
WP_096750023.1|3035079_3035952_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_096750024.1|3036007_3037156_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_105820159.1|3037167_3039474_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_096750025.1|3039604_3040117_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_096750026.1|3040113_3041211_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189550.1|3041388_3042432_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_096750027.1|3042823_3043123_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_096750028.1|3043193_3044684_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_036048820.1|3044687_3046163_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017920013.1|3046371_3047211_+	polyphosphate kinase	NA	NA	NA	NA	NA
WP_013699728.1|3047277_3048051_+	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	29.2	1.2e-24
WP_047836804.1|3048171_3049230_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	46.1	3.6e-83
WP_036039116.1|3049471_3050422_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096750029.1|3050494_3051460_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_096750030.1|3051449_3052766_-	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_013699723.1|3052775_3053390_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_013699722.1|3053386_3054532_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_096750031.1|3054803_3055553_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_096750032.1|3055519_3056233_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_013699719.1|3056369_3057269_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_096750033.1|3057517_3057889_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_036052934.1|3057891_3059178_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013699716.1|3059243_3059786_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013699715.1|3059881_3061225_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	27.9	5.7e-41
>prophage 10
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	3720544	3731435	4209407	tRNA,protease	Bacillus_thuringiensis_phage(14.29%)	9	NA	NA
WP_013699147.1|3720544_3720910_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	29.8	3.6e-06
WP_096750324.1|3721064_3722657_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|3722794_3722998_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_013699144.1|3723529_3723844_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	3.4e-13
WP_025098176.1|3723840_3726138_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.1e-169
WP_013699142.1|3726251_3726698_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.6	8.7e-47
WP_013699141.1|3726778_3727990_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.2	1.1e-38
WP_013699140.1|3728094_3728595_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_096750325.1|3728597_3731435_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.9	8.5e-79
>prophage 11
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	4090811	4099045	4209407		Erwinia_phage(16.67%)	13	NA	NA
WP_138110633.1|4090811_4092803_-	hypothetical protein	NA	H2DE37	Erwinia_phage	24.0	2.4e-35
WP_096750484.1|4092799_4094419_-	hypothetical protein	NA	X2CY37	Brucella_phage	24.2	4.4e-64
WP_175427770.1|4094415_4094880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750485.1|4094944_4095205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138110635.1|4095210_4095612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750487.1|4095625_4095859_-	hypothetical protein	NA	E5FFF4	Burkholderia_phage	53.4	3.9e-14
WP_096750488.1|4095935_4096430_-	hypothetical protein	NA	A0A1Y0SVT8	Sinorhizobium_phage	32.9	8.8e-08
WP_096750489.1|4096426_4096627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750490.1|4096623_4096977_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_138110637.1|4096973_4097201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750491.1|4097197_4097476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750492.1|4097475_4098231_-	hypothetical protein	NA	A0A0U1UNR3	Pseudomonas_phage	37.0	6.3e-21
WP_096750493.1|4098220_4099045_-	YdaU family protein	NA	A0A2I7QIW5	Vibrio_phage	41.7	1.9e-15
>prophage 12
NZ_CP023522	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 1, complete sequence	4209407	4102931	4111420	4209407		Burkholderia_virus(28.57%)	14	NA	NA
WP_138110643.1|4102931_4103153_+	hypothetical protein	NA	A1YZW1	Burkholderia_virus	41.4	1.2e-09
WP_096750501.1|4103176_4103482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096750502.1|4103581_4104484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175427772.1|4104480_4104645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096750503.1|4104644_4105460_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	G8CLD3	Synechococcus_phage	36.2	6.1e-38
WP_175427773.1|4105452_4105998_+	HNH endonuclease	NA	Q8SCL6	Pseudomonas_phage	51.0	9.1e-06
WP_096750505.1|4105994_4107044_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	51.2	6.0e-62
WP_096750506.1|4107068_4107584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096750507.1|4107781_4108177_+	hypothetical protein	NA	A0A1S6L2W9	Erwinia_phage	72.1	8.8e-43
WP_096750508.1|4108184_4109969_+	hypothetical protein	NA	A1YZU8	Burkholderia_virus	48.1	2.1e-14
WP_138110645.1|4109965_4110256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096750509.1|4110252_4110702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096750510.1|4110698_4111082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096750511.1|4111078_4111420_+	hypothetical protein	NA	A0A1L2C9A6	Pseudomonas_phage	43.2	6.3e-13
>prophage 1
NZ_CP023523	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 2, complete sequence	3925840	350880	358589	3925840	integrase	Burkholderia_virus(33.33%)	12	345596:345610	353791:353805
345596:345610	attL	GCGATCAGGTCGGCA	NA	NA	NA	NA
WP_096750959.1|350880_352002_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	38.1	1.1e-56
WP_175427798.1|351976_352201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750960.1|352197_352560_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	42.4	1.5e-09
WP_096750961.1|352556_352844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750509.1|352840_353290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138110645.1|353286_353577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750962.1|353573_355370_-	hypothetical protein	NA	A1YZU8	Burkholderia_virus	44.4	2.1e-14
353791:353805	attR	GCGATCAGGTCGGCA	NA	NA	NA	NA
WP_175427799.1|355573_356086_-	siphovirus Gp157 family protein	NA	H2BDF7	Pseudomonas_virus	31.8	1.2e-07
WP_096752837.1|356748_357411_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	48.0	1.1e-53
WP_138110662.1|357647_357938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096750501.1|358037_358343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138110643.1|358367_358589_-	hypothetical protein	NA	A1YZW1	Burkholderia_virus	41.4	1.2e-09
>prophage 2
NZ_CP023523	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 2, complete sequence	3925840	364544	373443	3925840	terminase	Escherichia_phage(37.5%)	12	NA	NA
WP_096750973.1|364544_365183_+	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	64.7	4.0e-77
WP_096750974.1|365179_365593_+	recombination protein NinB	NA	NA	NA	NA	NA
WP_096752838.1|365717_366326_+	recombination protein NinG	NA	A0A2H4JGI2	uncultured_Caudovirales_phage	48.7	5.4e-39
WP_138110666.1|366297_367080_+	hypothetical protein	NA	A0A173GFA2	Erwinia_phage	39.6	1.8e-39
WP_124076728.1|367164_367440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138110668.1|367624_368071_+	hypothetical protein	NA	A0A1I9KFE6	Aeromonas_phage	54.5	4.2e-09
WP_096750975.1|368067_368592_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096750976.1|368614_369034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096750977.1|369412_369877_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	52.3	3.3e-33
WP_096750978.1|369873_371148_+	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	40.2	5.9e-80
WP_096752839.1|371280_372603_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	39.2	3.1e-92
WP_096750979.1|372606_373443_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	43.5	3.4e-60
>prophage 3
NZ_CP023523	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 chromosome 2, complete sequence	3925840	769299	777838	3925840		Bacillus_phage(33.33%)	9	NA	NA
WP_096751208.1|769299_770628_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.4	2.0e-14
WP_017918264.1|770624_771371_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	4.4e-27
WP_017918263.1|771370_771535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036056147.1|771531_771903_-	GFA family protein	NA	NA	NA	NA	NA
WP_046581023.1|772208_772760_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_096751209.1|773147_774569_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.9	2.3e-80
WP_096751210.1|774573_775773_+	alginate O-acetyltransferase	NA	A0A125RNN9	Pseudomonas_phage	27.4	3.8e-20
WP_096751211.1|775895_777530_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	59.9	8.7e-169
WP_013690384.1|777547_777838_-	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	42.6	6.1e-17
>prophage 1
NZ_CP023524	Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence	151925	2543	61607	151925	integrase,transposase	Stx2-converting_phage(16.67%)	57	1126:1141	46593:46608
1126:1141	attL	GCGCCGCTGGATCTCG	NA	NA	NA	NA
WP_175427850.1|2543_3776_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_127840963.1|3768_5481_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_127840964.1|5789_7499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753017.1|7479_7899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096750011.1|8527_8893_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_133120770.1|8880_9228_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096750010.1|9285_10842_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.9	9.0e-123
WP_096753018.1|10838_11519_-	OmpW family protein	NA	NA	NA	NA	NA
WP_096753019.1|12011_12869_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096753020.1|12991_13861_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096753021.1|13847_14768_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	32.6	2.8e-23
WP_096753022.1|14863_15475_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096753023.1|17580_17847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753024.1|17877_18678_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	26.5	1.6e-06
WP_138110696.1|18684_19077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175427851.1|19087_19264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096753026.1|19296_19983_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_096753027.1|21344_21605_-	hypothetical protein	NA	A0A1P8DIR2	Virus_Rctr197k	42.7	2.6e-11
WP_138110698.1|21843_22119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096753032.1|23064_23307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138110700.1|23361_23913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096753033.1|24026_24554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138110702.1|24854_25607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138110704.1|25817_26402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175427852.1|26553_27528_-	methyltransferase	NA	NA	NA	NA	NA
WP_138110708.1|27595_28537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096753035.1|28540_30397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138110710.1|30393_31296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096753129.1|31889_32963_-	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	40.0	5.4e-18
WP_096753037.1|32962_33607_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_096753038.1|33915_35613_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.5	2.4e-12
WP_096753039.1|35705_36131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096753040.1|36406_37536_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	26.6	9.7e-10
WP_036057624.1|38135_38906_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.9	7.3e-09
WP_036057623.1|39052_39607_-	OsmC family protein	NA	NA	NA	NA	NA
WP_036057621.1|39965_40529_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080752301.1|40654_40996_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_096753041.1|41065_41746_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_175427859.1|41901_43008_+	alkene reductase	NA	NA	NA	NA	NA
WP_036057612.1|43388_44597_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_036057610.1|44655_44874_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_036057605.1|45561_45909_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.8	2.7e-35
WP_164465439.1|45905_46292_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	30.7	1.7e-06
WP_080752299.1|46708_47320_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
46593:46608	attR	CGAGATCCAGCGGCGC	NA	NA	NA	NA
WP_036057603.1|47468_47873_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036057600.1|47963_48557_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_164465455.1|49316_50249_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036057598.1|50499_50916_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_036057596.1|52612_53032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036057594.1|53454_54069_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_127840950.1|54470_55013_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_080752298.1|55128_55458_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036057592.1|55747_56746_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_036057589.1|56847_57588_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	6.3e-18
WP_036057586.1|58107_59490_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_036057583.1|59936_60350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036057580.1|60878_61607_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	30.9	8.7e-20
