The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010784	Phaeobacter gallaeciensis strain P63 chromosome, complete genome	3775738	1145116	1199722	3775738	lysis,transposase,integrase,tRNA	Acinetobacter_phage(14.29%)	52	1137941:1137957	1190027:1190043
1137941:1137957	attL	CTGACGCTGGTGGTTTT	NA	NA	NA	NA
WP_040103929.1|1145116_1145248_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024096611.1|1145305_1145887_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_096596796.1|1145896_1146007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096612.1|1146019_1146796_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	3.0e-42
WP_024096613.1|1147529_1148339_+	response regulator	NA	Q6JIH3	Burkholderia_virus	52.3	4.2e-07
WP_040103941.1|1148326_1151017_-	response regulator	NA	A0A1V0SGX0	Hokovirus	37.4	1.8e-33
WP_024096615.1|1151019_1151763_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024096616.1|1151932_1152766_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024096617.1|1152794_1153550_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_024096618.1|1153539_1154427_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_024096619.1|1154439_1155189_+	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	2.2e-10
WP_024096620.1|1155307_1156312_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096621.1|1156316_1157120_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024096622.1|1157176_1159267_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	2.1e-10
WP_024096623.1|1159361_1160567_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096624.1|1160579_1161665_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096625.1|1161738_1163409_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024096626.1|1163965_1164910_-	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	28.1	7.6e-08
WP_024096627.1|1165007_1166468_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.7	2.5e-106
WP_024096628.1|1166700_1167225_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_024096629.1|1167282_1168032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096630.1|1168136_1168679_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096631.1|1168679_1169378_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_024096632.1|1169784_1170081_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024096633.1|1170077_1170797_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.2	6.4e-31
WP_040103945.1|1170938_1171151_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024096634.1|1171309_1171951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040103946.1|1171953_1172268_-	Arc family DNA-binding protein	NA	A0A0U4B0M9	Pseudomonas_phage	56.1	3.1e-06
WP_024096636.1|1172352_1172547_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_024096637.1|1172571_1172763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096638.1|1172759_1173791_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	23.6	2.0e-06
WP_024096639.1|1174190_1174940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096640.1|1175115_1177386_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	28.9	9.1e-15
WP_040103947.1|1177382_1178636_-	GfdT protein	NA	NA	NA	NA	NA
WP_024096642.1|1178653_1179370_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024096643.1|1179740_1180289_+	carbon monoxide dehydrogenase subunit G	NA	NA	NA	NA	NA
WP_024096644.1|1180683_1182483_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	6.0e-62
WP_024096645.1|1182664_1184560_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	2.6e-23
WP_024096646.1|1184699_1185626_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024096647.1|1185628_1186192_-	DUF4453 domain-containing protein	NA	NA	NA	NA	NA
WP_024096648.1|1186248_1187085_-	protein of the AP superfamily	NA	NA	NA	NA	NA
WP_024096649.1|1187210_1188848_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.2e-22
WP_024096650.1|1188844_1189660_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096651.1|1189656_1190613_-	ABC transporter permease	NA	NA	NA	NA	NA
1190027:1190043	attR	AAAACCACCAGCGTCAG	NA	NA	NA	NA
WP_024096652.1|1190627_1192214_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024096654.1|1192670_1193117_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_024096655.1|1193145_1193817_-	nitroreductase	NA	NA	NA	NA	NA
WP_024096656.1|1193872_1195024_-	TFIIB-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_024096658.1|1195328_1196516_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_040103961.1|1196614_1197499_-	DUF2927 domain-containing protein	NA	NA	NA	NA	NA
WP_024096660.1|1197585_1198782_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_024096661.1|1198804_1199722_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
>prophage 2
NZ_CP010784	Phaeobacter gallaeciensis strain P63 chromosome, complete genome	3775738	1509493	1577101	3775738	tail,tRNA,capsid,portal,protease,head	uncultured_Mediterranean_phage(22.22%)	65	NA	NA
WP_024096945.1|1509493_1510786_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.9	8.6e-87
WP_024096946.1|1510895_1512392_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_024096947.1|1512571_1512856_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	53.8	2.0e-20
WP_024096948.1|1512890_1514552_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	24.0	1.6e-05
WP_024096949.1|1514554_1515523_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.7	4.7e-61
WP_024096950.1|1515689_1516043_+	membrane protein	NA	NA	NA	NA	NA
WP_024096951.1|1516140_1516767_+	heme ABC exporter ATP-binding protein CcmA	NA	G9BWD6	Planktothrix_phage	29.2	2.0e-09
WP_024096952.1|1516763_1517420_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_024096953.1|1517465_1518197_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_040104006.1|1518196_1518367_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_024096955.1|1518359_1518899_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_024096956.1|1518974_1519274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096957.1|1519549_1522237_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_024096958.1|1522482_1523214_+	DUF1223 domain-containing protein	NA	NA	NA	NA	NA
WP_024096959.1|1523228_1524164_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_024096960.1|1524534_1525731_-	flagellar motor switch protein	NA	NA	NA	NA	NA
WP_024096961.1|1525807_1526413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096962.1|1526602_1527907_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.2	1.1e-17
WP_024096963.1|1528186_1529443_-	OsmC family protein	NA	NA	NA	NA	NA
WP_024096964.1|1529538_1530099_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024096965.1|1530174_1531518_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_024096966.1|1531705_1532464_+	DUF3445 domain-containing protein	NA	NA	NA	NA	NA
WP_024096967.1|1532501_1533527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096968.1|1534068_1535475_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_014874894.1|1535568_1535907_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_024096969.1|1536099_1537791_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_024096970.1|1538165_1540370_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.1	1.3e-13
WP_024096971.1|1540779_1541910_+	porin	NA	NA	NA	NA	NA
WP_024096972.1|1542167_1543499_+	trigger factor	NA	NA	NA	NA	NA
WP_024096973.1|1543713_1544982_-	hemolysin-type calcium-binding protein	NA	M4SNJ8	Pseudoalteromonas_phage	25.9	2.8e-05
WP_024096974.1|1545280_1547239_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_024096975.1|1547387_1547858_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024096976.1|1548170_1548353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096977.1|1548585_1549200_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005982441.1|1549212_1549440_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_014874885.1|1549468_1549822_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_040103985.1|1550347_1550944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014874883.1|1551182_1551758_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024096979.1|1551882_1552182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096980.1|1552453_1553245_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_024096981.1|1553397_1554699_-	cytochrome b561	NA	NA	NA	NA	NA
WP_024096982.1|1554884_1555817_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024096983.1|1555901_1556639_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_005982462.1|1557273_1557507_+	acyl carrier protein	NA	A0A2C9CX86	Yersinia_phage	52.1	7.3e-05
WP_024096984.1|1557671_1558415_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
WP_024096985.1|1558598_1559612_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_024096986.1|1559871_1561137_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024096987.1|1561136_1562291_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_024096988.1|1562582_1562918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096989.1|1562895_1564188_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	41.4	3.9e-71
WP_024096990.1|1564391_1565585_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.9	3.1e-59
WP_024096991.1|1565577_1565796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096992.1|1565831_1566449_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	56.2	1.8e-34
WP_024096993.1|1566497_1567682_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.7	3.3e-61
WP_043939826.1|1567871_1568516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096995.1|1568512_1568884_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_024096996.1|1568880_1569294_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024096997.1|1569398_1569812_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_024096998.1|1569826_1570180_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_024096999.1|1570176_1570434_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_024097000.1|1570426_1571083_+|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	36.6	1.7e-14
WP_024097001.1|1571098_1571731_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.0	2.0e-57
WP_024097002.1|1571730_1572681_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	35.8	2.5e-51
WP_024097003.1|1572677_1573148_+	phage cell wall peptidase NlpC/P60 family	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.1	2.3e-29
WP_024097004.1|1573147_1577101_+|tail	phage tail protein	tail	A0A0B5A7K5	Paracoccus_phage	37.5	6.4e-226
>prophage 3
NZ_CP010784	Phaeobacter gallaeciensis strain P63 chromosome, complete genome	3775738	1777840	1805804	3775738	tail,terminase,capsid,integrase,portal,protease,head	Ruegeria_phage(23.53%)	42	1771034:1771048	1792994:1793008
1771034:1771048	attL	CCAGCAACTCAAAGC	NA	NA	NA	NA
WP_024097172.1|1777840_1778920_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A240F4W2	Ochrobactrum_phage	33.2	1.4e-50
WP_024097174.1|1779213_1779867_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	45.5	6.4e-30
WP_024097175.1|1779888_1780065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096596809.1|1780300_1780999_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	45.0	2.0e-29
WP_024097178.1|1781072_1781219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097179.1|1781275_1781665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052440150.1|1781694_1783782_-	hypothetical protein	NA	A0A1X9HVK8	Ruegeria_phage	59.7	4.6e-215
WP_024097179.1|1783838_1784228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052331592.1|1784252_1784999_-	site-specific DNA-methyltransferase	NA	O03956	Myxococcus_phage	52.9	1.1e-57
WP_024097181.1|1785029_1785803_-	hypothetical protein	NA	A0A068CE44	Rhizobium_phage	28.8	3.6e-08
WP_024097182.1|1785951_1786281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097183.1|1786280_1786520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097184.1|1786516_1786831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097185.1|1787027_1787513_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_145958761.1|1787522_1788440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040104019.1|1788524_1789175_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024097189.1|1789600_1790041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097190.1|1790037_1790205_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043939781.1|1790248_1790575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097192.1|1790853_1791447_+	SAM-dependent methyltransferase	NA	A0A218MLE3	uncultured_virus	48.3	1.3e-42
WP_024097193.1|1791443_1792355_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024097194.1|1792354_1792669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097195.1|1792661_1793324_+	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	60.5	4.4e-55
1792994:1793008	attR	CCAGCAACTCAAAGC	NA	NA	NA	NA
WP_024097196.1|1793333_1793750_+	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	42.9	2.6e-08
WP_024097197.1|1793818_1794199_+	hypothetical protein	NA	A0A1X9HVL1	Ruegeria_phage	35.1	1.5e-07
WP_024097198.1|1794198_1795887_+	DEAD/DEAH box helicase	NA	A0A1X9HX80	Ruegeria_phage	47.6	6.3e-138
WP_024097199.1|1795876_1796455_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_081731415.1|1796649_1796874_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_024097200.1|1796876_1797068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957933.1|1797064_1797391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097202.1|1797566_1797974_+|terminase	phage terminase small subunit	terminase	NA	NA	NA	NA
WP_024097203.1|1797951_1799730_+|terminase	phage terminase-like protein, large subunit	terminase	B0VK29	Azospirillum_phage	40.5	6.9e-119
WP_024097204.1|1799737_1800988_+|portal	phage portal protein	portal	A0A141GEV9	Brucella_phage	52.9	3.4e-104
WP_024097205.1|1800965_1801802_+|protease	Clp protease ClpP	protease	A0A141GEW1	Brucella_phage	73.9	8.5e-112
WP_024097206.1|1801818_1803057_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	55.6	2.1e-127
WP_024097207.1|1803117_1803258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097208.1|1803264_1803834_+	hypothetical protein	NA	A0A141GEW4	Brucella_phage	43.1	3.1e-33
WP_024097209.1|1803833_1804160_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_024097210.1|1804156_1804612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097211.1|1804611_1804965_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024097212.1|1805009_1805297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097213.1|1805357_1805804_+	hypothetical protein	NA	A0A2I7RB20	Vibrio_phage	32.0	5.9e-11
>prophage 4
NZ_CP010784	Phaeobacter gallaeciensis strain P63 chromosome, complete genome	3775738	2284705	2295553	3775738	terminase,coat	Vibrio_phage(33.33%)	14	NA	NA
WP_024097661.1|2284705_2285947_-|coat	phage coat protein	coat	I3PUX4	Vibrio_phage	34.3	5.4e-54
WP_024097662.1|2285959_2286802_-	hypothetical protein	NA	I3PUX5	Vibrio_phage	31.1	3.7e-14
WP_024097663.1|2286815_2288807_-	hypothetical protein	NA	I3PUX6	Vibrio_phage	39.6	3.6e-124
WP_024097664.1|2288803_2290141_-|terminase	phage terminase large subunit	terminase	F8TUR5	EBPR_podovirus	71.8	6.2e-181
WP_024097665.1|2290121_2290424_-	hypothetical protein	NA	A0A088FAU1	Sulfitobacter_phage	41.6	1.5e-05
WP_024097666.1|2291051_2291642_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_040104067.1|2291910_2292297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097669.1|2292308_2292662_-	HNH endonuclease	NA	A0A0B4N249	Escherichia_phage	49.0	5.5e-20
WP_024097670.1|2292730_2293201_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	81.7	4.4e-49
WP_024097671.1|2293200_2293569_-	ATPase involved in DNA replication initiation	NA	NA	NA	NA	NA
WP_024097672.1|2293565_2293934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097673.1|2293920_2294718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097674.1|2294714_2295248_-	T5domain protein	NA	A0A088F856	Sulfitobacter_phage	52.3	2.6e-45
WP_024097675.1|2295244_2295553_-	VRR-NUC domain protein	NA	E2GLY0	Acinetobacter_phage	55.7	1.6e-20
>prophage 5
NZ_CP010784	Phaeobacter gallaeciensis strain P63 chromosome, complete genome	3775738	2299292	2302579	3775738		Pseudoalteromonas_phage(16.67%)	7	NA	NA
WP_024097687.1|2299292_2299961_+	ERF family protein	NA	A0A0H4A6R9	Pseudoalteromonas_phage	48.9	9.1e-24
WP_024097688.1|2299950_2300655_+	3'-5' exonuclease	NA	X2CYL5	Brucella_phage	45.3	2.3e-41
WP_024097689.1|2300654_2300843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097690.1|2300842_2301133_+	hypothetical protein	NA	A0A0B5HDX4	Vibrio_phage	59.8	6.5e-27
WP_024097691.1|2301146_2301602_+	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	29.2	2.0e-06
WP_040104145.1|2301670_2301976_+	DUF1364 domain-containing protein	NA	A0A088F868	Sulfitobacter_phage	60.4	7.3e-29
WP_024097693.1|2301997_2302579_+	hypothetical protein	NA	K4NZ13	Pseudomonas_phage	55.2	2.7e-16
>prophage 1
NZ_CP010791	Phaeobacter gallaeciensis strain P63 plasmid pP63_x_draft, complete sequence	171534	111138	160097	171534	integrase,transposase	Vibrio_phage(33.33%)	47	112774:112833	154177:154322
WP_024099411.1|111138_112773_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
112774:112833	attL	CAATATTTGCCACACGAAGCTGCGAACCCTGTCTCAGGTTTAAGGGCAAAAATATCGGAT	NA	NA	NA	NA
WP_007803148.1|112902_113565_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_052440151.1|113842_114832_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705159.1|114910_115219_-	universal stress protein	NA	NA	NA	NA	NA
WP_082032859.1|115808_116069_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_040104548.1|116232_116538_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158524501.1|116677_117619_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_096705141.1|117681_118392_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_082032860.1|118485_119037_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040104532.1|120425_121664_-	amidohydrolase	NA	NA	NA	NA	NA
WP_040104531.1|121684_121984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040104533.1|121970_122312_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_040104530.1|122558_122903_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705142.1|122899_123838_-	EamA family transporter	NA	NA	NA	NA	NA
WP_096705143.1|123865_124309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040104538.1|124322_125195_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096705144.1|125311_126448_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096705145.1|126488_127427_-	oxidoreductase	NA	NA	NA	NA	NA
WP_096705146.1|127567_128713_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_040104545.1|128840_130121_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_096705147.1|130432_131008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705148.1|131208_133059_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_096705149.1|133279_134269_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_040104543.1|134580_135048_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705150.1|135529_136564_-	dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	31.2	1.5e-20
WP_096705151.1|136563_138333_-	acetolactate synthase	NA	G8DDL3	Micromonas_pusilla_virus	24.4	8.6e-05
WP_096705152.1|138466_139318_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_007803185.1|139444_140923_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_040545992.1|140979_141735_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040104559.1|141843_142563_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_008335453.1|142580_143258_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_076626053.1|143254_144454_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_158524502.1|144459_145377_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705153.1|145452_146235_+	3-oxoadipate enol-lactonase	NA	A0A023W7H4	Mycobacterium_phage	34.6	1.2e-06
WP_065818607.1|146231_146612_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_096705154.1|146611_147340_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_096705155.1|147341_147947_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_096705156.1|148018_149083_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_096705157.1|149214_149940_-	HAD family hydrolase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	29.7	2.8e-10
WP_096705158.1|150056_150878_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.7	3.6e-46
WP_007803196.1|150870_151662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024099410.1|151658_152540_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024099411.1|152541_154176_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_007803209.1|155082_156477_+	membrane protein	NA	NA	NA	NA	NA
154177:154322	attR	CAATATTTGCCACACGAAGCTGCGAACCCTGTCTCAGGTTTAAGGGCAAAAATATCGGATTTAAAGGCAAAATATCATATTTAAGGGCAAAGCAAGGCCGTTGATTTCGTTGGATTTCTCATCTCACAATTAAGGGCTACGCGACA	NA	NA	NA	NA
WP_007803213.1|157407_158199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007803215.1|158195_159074_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_007803217.1|159164_160097_-|transposase	IS5-like element ISRhba5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	37.5	2.5e-51
