The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023558	Pseudoalteromonas marina strain ECSMB14103 chromosome, complete genome	3441076	1405461	1440823	3441076	tail,terminase,portal,capsid,integrase	Vibrio_phage(23.08%)	47	1405268:1405299	1442378:1442409
1405268:1405299	attL	TCATAATCGTGCCAATAGATTGTTGCTTGATT	NA	NA	NA	NA
WP_039037861.1|1405461_1406679_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	38.8	1.6e-66
WP_158649127.1|1406806_1406983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037860.1|1406982_1407516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158649128.1|1407541_1407700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037859.1|1407768_1408317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037858.1|1408388_1408700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037857.1|1408726_1408960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052242900.1|1409000_1409498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039037856.1|1409701_1410109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037855.1|1410105_1411401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037854.1|1411470_1412091_-	helix-turn-helix domain-containing protein	NA	U5P0T5	Shigella_phage	43.2	7.4e-36
WP_039037853.1|1412245_1412464_+	antirepressor	NA	NA	NA	NA	NA
WP_039037852.1|1412460_1412754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037851.1|1412763_1413177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037850.1|1413186_1413786_+	hypothetical protein	NA	A0A067ZG73	Vibrio_phage	43.2	1.4e-39
WP_039037849.1|1413859_1414144_+	hypothetical protein	NA	A0A1L5C2B9	Pseudoalteromonas_phage	69.2	6.8e-29
WP_039037848.1|1414144_1416706_+	replication endonuclease	NA	A0A1L5C2A7	Pseudoalteromonas_phage	38.9	4.5e-172
WP_052242897.1|1417302_1417716_+	KilA-N domain-containing protein	NA	Q71TC0	Escherichia_phage	50.0	2.4e-06
WP_039037847.1|1417754_1418171_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	51.5	2.3e-33
WP_039037846.1|1418225_1418405_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	64.4	2.1e-15
WP_039037845.1|1418587_1418938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037844.1|1418934_1419180_-	ogr/Delta-like zinc finger family protein	NA	A0A1L5C2B5	Pseudoalteromonas_phage	82.7	1.3e-33
WP_052242896.1|1419342_1419768_+	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	93.6	2.4e-70
WP_039037843.1|1420770_1421226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008135639.1|1421225_1421552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039037842.1|1421548_1422616_-|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	41.9	2.8e-59
WP_039037841.1|1422615_1424397_-|terminase	terminase	terminase	R4JDJ3	Burkholderia_phage	40.0	6.5e-117
WP_039037840.1|1424602_1425484_+|capsid	phage capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	28.1	4.3e-21
WP_039037839.1|1425527_1426565_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	45.4	3.3e-73
WP_039037838.1|1426649_1427378_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_007378146.1|1427489_1427927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037837.1|1427923_1428397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039037836.1|1428389_1429022_+	phage virion morphogenesis protein	NA	A0A2I7RNI6	Vibrio_phage	30.2	4.3e-15
WP_039037835.1|1429043_1430144_+	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	39.6	5.1e-64
WP_007378142.1|1430154_1430604_+	DUF2597 family protein	NA	A0A1L5C2D0	Pseudoalteromonas_phage	43.4	2.0e-30
WP_039037834.1|1430603_1431236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007378140.1|1431225_1431513_+	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	38.3	1.9e-10
WP_039037833.1|1431683_1434932_+|tail	phage tail tape measure protein	tail	R9TRA2	Vibrio_phage	37.6	3.9e-88
WP_033040797.1|1434931_1435261_+	DUF2590 family protein	NA	A0A1D9C9T2	Salinivibrio_phage	39.0	1.2e-13
WP_039037832.1|1435250_1436399_+	bacteriophage protein	NA	A0A1L5C2D1	Pseudoalteromonas_phage	34.0	1.7e-57
WP_039037831.1|1436391_1437195_+	hypothetical protein	NA	A0A0U4JVX3	Pseudomonas_phage	41.7	3.6e-27
WP_039037933.1|1437191_1437755_+|tail	tail fiber protein	tail	A0A0U4K5K2	Pseudomonas_phage	33.5	6.7e-20
WP_039037830.1|1437784_1438717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052242895.1|1438709_1439018_+	hypothetical protein	NA	Q8H9M8	Vibrio_phage	62.5	1.7e-09
WP_052242898.1|1439058_1439640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008135615.1|1439636_1440122_+	hypothetical protein	NA	U3PDI0	Vibrio_phage	39.6	2.5e-15
WP_039037828.1|1440118_1440823_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	32.7	1.6e-23
1442378:1442409	attR	TCATAATCGTGCCAATAGATTGTTGCTTGATT	NA	NA	NA	NA
>prophage 2
NZ_CP023558	Pseudoalteromonas marina strain ECSMB14103 chromosome, complete genome	3441076	1738300	1749068	3441076	capsid	Vibrio_phage(33.33%)	12	NA	NA
WP_039036971.1|1738300_1739131_+	carbohydrate ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.2	1.3e-06
WP_039036972.1|1739141_1740152_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.8	1.7e-21
WP_039036973.1|1740328_1741288_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_039036974.1|1741786_1742929_-|capsid	minor capsid protein	capsid	B5TA65	Burkholderia_phage	37.8	4.1e-48
WP_039036975.1|1742930_1743473_-	hypothetical protein	NA	D4HTZ6	Vibrio_phage	50.6	7.1e-43
WP_039036976.1|1743475_1743919_-	hypothetical protein	NA	M4MHH2	Vibrio_phage	48.9	4.5e-27
WP_039036977.1|1743929_1744544_-	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	40.8	4.9e-40
WP_039036978.1|1744536_1746039_-	DUF935 family protein	NA	B5TA67	Burkholderia_phage	35.0	2.6e-58
WP_039036979.1|1746031_1747771_-	hypothetical protein	NA	A0A2D1GNP7	Pseudomonas_phage	53.3	1.1e-166
WP_039036980.1|1747770_1748277_-	DUF1804 family protein	NA	NA	NA	NA	NA
WP_039036981.1|1748276_1748615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039036982.1|1748624_1749068_-	bacteriophage protein	NA	Q6WHL2	Vibrio_phage	46.8	1.6e-21
>prophage 3
NZ_CP023558	Pseudoalteromonas marina strain ECSMB14103 chromosome, complete genome	3441076	2637823	2645953	3441076		uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_039036522.1|2637823_2638867_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.9	1.7e-117
WP_039036521.1|2638932_2639424_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	39.6	1.3e-24
WP_039036520.1|2639445_2642028_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	26.9	1.5e-37
WP_006791963.1|2642096_2643071_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.3	1.7e-34
WP_039036519.1|2643106_2643931_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G3MBP9	Bacillus_virus	36.0	2.4e-05
WP_008126892.1|2643972_2644551_-	DedA family protein	NA	NA	NA	NA	NA
WP_006791960.1|2644560_2645199_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	5.3e-37
WP_006791959.1|2645188_2645953_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.3	6.0e-72
