The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023518	Burkholderia cepacia strain FDAARGOS_388 chromosome 1, complete sequence	3779890	63934	103639	3779890	plate,protease,transposase	Leptospira_phage(16.67%)	32	NA	NA
WP_088611350.1|63934_65034_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	2.9e-35
WP_138143282.1|65710_68200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088611304.1|68610_69820_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	1.0e-97
WP_027787261.1|70173_71433_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	1.5e-43
WP_138143283.1|72270_72684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787260.1|72694_73582_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_027787258.1|73602_74490_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027787257.1|74491_75829_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027787256.1|75825_76929_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_027787255.1|76925_78278_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_080982084.1|78274_79024_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_027787253.1|79533_79788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080982120.1|79726_80128_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_027787252.1|80352_81198_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_006485265.1|81611_82178_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_006491801.1|82297_83038_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_027787251.1|83172_84354_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_027787250.1|84453_86319_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_027787249.1|86678_87518_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_027787248.1|87524_88733_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021163132.1|88774_89599_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027787247.1|89703_91950_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.3	4.8e-77
WP_006478692.1|92005_92221_-	YdcH family protein	NA	NA	NA	NA	NA
WP_027787246.1|92298_93051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787245.1|93211_95536_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_034195767.1|95952_96981_+	sesquiterpene cyclase	NA	NA	NA	NA	NA
WP_027787243.1|97003_98920_-	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	32.7	1.1e-77
WP_021163124.1|99196_99793_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011352252.1|99799_101146_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.6	2.6e-70
WP_027787242.1|101259_102408_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_011352254.1|102511_102703_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_027787241.1|102739_103639_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 2
NZ_CP023518	Burkholderia cepacia strain FDAARGOS_388 chromosome 1, complete sequence	3779890	380698	472634	3779890	portal,protease,integrase,capsid,holin,transposase,terminase,plate,tRNA,head,tail	uncultured_Caudovirales_phage(25.0%)	94	417104:417126	460904:460926
WP_027787063.1|380698_382108_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_027787062.1|382388_383315_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	27.2	1.7e-07
WP_027787061.1|383459_384134_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	40.8	1.2e-20
WP_027787060.1|384262_385885_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.8e-20
WP_021162484.1|385881_386979_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_027787059.1|387027_388071_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_148668953.1|388121_388805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148668954.1|389589_389814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787057.1|390129_390495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011352504.1|390824_391157_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_021162482.1|391157_391766_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_021162481.1|391765_393772_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027787056.1|393775_394663_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027787055.1|394933_396463_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_138143286.1|397057_397435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787053.1|397832_398231_-	heme-binding protein	NA	NA	NA	NA	NA
WP_027787052.1|398223_399000_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_034195760.1|399068_400001_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027787050.1|400623_401877_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027787049.1|402220_403642_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_006478433.1|403688_404660_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_027787048.1|404763_405591_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_027787047.1|405634_407032_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.9	4.1e-42
WP_027787046.1|407266_407989_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_021162660.1|408028_408610_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	38.5	1.2e-11
WP_006751616.1|408698_409190_+	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.6	1.7e-06
WP_027787045.1|409217_410018_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_021162662.1|410076_410850_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_027787044.1|411157_411982_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_027787043.1|412262_413066_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_027787042.1|413391_415014_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_100199223.1|415167_415911_-	AAA family ATPase	NA	NA	NA	NA	NA
417104:417126	attL	CCAATGATGCAGCAGTACCTGCG	NA	NA	NA	NA
WP_027787040.1|417285_418002_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_049096236.1|418222_419173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787038.1|419366_420845_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.8	4.5e-15
WP_081040819.1|421069_421393_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	48.0	1.4e-17
WP_059633410.1|421798_422410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080982199.1|422297_422768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787035.1|422757_423255_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158605805.1|423261_423645_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_027787034.1|423866_424652_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	83.2	9.7e-134
WP_027787033.1|424822_425317_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	59.5	2.0e-39
WP_027787032.1|425313_425808_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	86.6	7.6e-76
WP_027787031.1|425810_426095_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	95.7	3.8e-40
WP_027787030.1|426171_427221_-	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.5	3.6e-83
WP_027789299.1|427230_427437_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	1.5e-14
WP_027787029.1|427411_428290_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	8.9e-35
WP_027787028.1|428300_430742_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	38.1	3.5e-57
WP_027787027.1|430822_431125_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	2.7e-07
WP_027787026.1|431221_431725_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	54.3	2.1e-44
WP_027787025.1|431735_432905_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	71.8	2.5e-157
WP_027787024.1|432989_433769_-|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	57.1	1.2e-56
WP_174543632.1|433784_435185_-|tail	tail fiber protein	tail	E5E3V2	Burkholderia_phage	53.8	2.2e-104
WP_088611304.1|435360_436570_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	1.0e-97
WP_034195755.1|437110_437689_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	44.1	5.6e-30
WP_027787018.1|437678_438575_-|plate	baseplate J/gp47 family protein	plate	A0A218M4K5	Erwinia_phage	41.0	3.9e-46
WP_034195754.1|438571_438907_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	48.1	3.9e-23
WP_027787016.1|438906_439107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787015.1|439166_439847_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	28.5	4.9e-17
WP_027787014.1|439850_440375_-	hypothetical protein	NA	Q75QM3	Wolbachia_phage	41.2	1.1e-24
WP_027787013.1|440364_440895_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	31.0	9.2e-11
WP_027787012.1|440897_441185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787011.1|441186_442182_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	62.7	7.3e-118
WP_027787010.1|442255_442600_-|head	head decoration protein	head	NA	NA	NA	NA
WP_027787009.1|442630_443707_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.5	3.4e-52
WP_027787008.1|443703_445197_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.4	5.8e-135
WP_027787007.1|445193_445400_-	hypothetical protein	NA	A0A219Y8X9	Aeromonas_phage	52.1	8.5e-05
WP_027787006.1|445413_447399_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	1.0e-179
WP_172535148.1|447400_447931_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174543642.1|448396_449056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787004.1|449065_449908_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_027787003.1|450273_450861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787002.1|451081_453589_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	39.8	4.9e-94
WP_099318678.1|453638_454124_-	hypothetical protein	NA	K7ZPX8	Xanthomonas_citri_phage	33.5	2.1e-09
WP_027787000.1|454401_454785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027786999.1|454786_455314_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.1	2.0e-29
WP_080982019.1|455703_456132_+	transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	63.5	3.4e-16
WP_027786997.1|456589_456808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786996.1|456858_457221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786995.1|457220_458705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786994.1|458701_459169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080982086.1|459177_459420_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	63.2	4.9e-20
WP_027786993.1|459397_460672_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	57.8	1.6e-146
WP_049098137.1|460831_463522_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.6	4.8e-23
460904:460926	attR	CCAATGATGCAGCAGTACCTGCG	NA	NA	NA	NA
WP_034195751.1|463502_464774_+	membrane protein	NA	NA	NA	NA	NA
WP_027786990.1|464753_465296_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027786989.1|465328_466549_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_034195863.1|466780_467044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027786988.1|467157_467934_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_027786987.1|467938_469084_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_027786986.1|469195_470101_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_027786985.1|470149_470752_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011352534.1|470760_471963_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_027786984.1|471971_472634_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 3
NZ_CP023518	Burkholderia cepacia strain FDAARGOS_388 chromosome 1, complete sequence	3779890	2125291	2163795	3779890	plate,protease,transposase	Burkholderia_phage(50.0%)	36	NA	NA
WP_027788532.1|2125291_2125819_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.7e-21
WP_080981881.1|2126122_2126368_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	90.1	1.5e-32
WP_138143304.1|2126971_2128369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080981880.1|2128613_2128745_+	AlpA family phage regulatory protein	NA	E5E3Y1	Burkholderia_phage	88.1	8.2e-14
WP_027788530.1|2128939_2129674_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080981879.1|2129675_2130761_-	histidine kinase	NA	NA	NA	NA	NA
WP_027788528.1|2131175_2131718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788527.1|2132072_2132276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788526.1|2132335_2133136_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027788525.1|2133969_2134278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138143305.1|2134955_2135297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788523.1|2135558_2135882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788522.1|2136169_2136751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788521.1|2136854_2137343_+	DUF4265 domain-containing protein	NA	NA	NA	NA	NA
WP_049096227.1|2137396_2137849_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_027788519.1|2137838_2138198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049096226.1|2138194_2138890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788517.1|2138982_2139765_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011350756.1|2139761_2141108_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027788516.1|2141210_2141822_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_027788515.1|2142195_2142834_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_027788514.1|2142878_2143394_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006477094.1|2143409_2144900_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|2144970_2145474_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_021161818.1|2145818_2146304_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027788513.1|2146381_2148217_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_027788512.1|2148180_2149281_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_027788511.1|2149607_2152277_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.8	3.5e-90
WP_027788510.1|2152316_2153438_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_027788509.1|2153523_2154453_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027788508.1|2154457_2155447_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_027788507.1|2155443_2159388_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_021161809.1|2159689_2160535_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027788506.1|2160656_2161616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027788505.1|2161822_2162848_+	transporter	NA	NA	NA	NA	NA
WP_027788504.1|2162844_2163795_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP023518	Burkholderia cepacia strain FDAARGOS_388 chromosome 1, complete sequence	3779890	2815913	2824203	3779890		Bacillus_phage(16.67%)	8	NA	NA
WP_027788058.1|2815913_2817314_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.8e-77
WP_051363294.1|2817321_2818272_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	7.6e-16
WP_027788057.1|2818335_2819328_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	1.5e-27
WP_021157453.1|2819401_2819749_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027788056.1|2819963_2820866_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.2	3.7e-52
WP_080982007.1|2820944_2822288_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_021157450.1|2822331_2823255_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.9	6.7e-41
WP_027788054.1|2823282_2824203_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	27.2	8.7e-17
>prophage 5
NZ_CP023518	Burkholderia cepacia strain FDAARGOS_388 chromosome 1, complete sequence	3779890	3428235	3437473	3779890		Pseudomonas_phage(22.22%)	15	NA	NA
WP_027787629.1|3428235_3429195_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.6	1.0e-28
WP_006476104.1|3429252_3429468_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_027787628.1|3429607_3429805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787627.1|3429859_3430105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787626.1|3430329_3430599_-	pyocin activator PrtN family protein	NA	I6NSR8	Burkholderia_phage	61.4	1.3e-21
WP_027787625.1|3430595_3431378_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	40.4	4.9e-37
WP_027787624.1|3431374_3431863_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	50.6	1.6e-38
WP_027787623.1|3431859_3432297_-	hypothetical protein	NA	A0A097EYP5	Mycobacterium_phage	48.1	6.8e-20
WP_138143316.1|3432702_3432990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787622.1|3432986_3434066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787621.1|3434058_3434826_-	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	45.1	1.9e-65
WP_027787620.1|3434889_3435645_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	53.0	4.7e-69
WP_174543627.1|3435641_3435989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787619.1|3436070_3436460_-	hypothetical protein	NA	A0A1S6L2W9	Erwinia_phage	73.7	2.7e-44
WP_027787618.1|3436477_3437473_-	RNA-directed DNA polymerase	NA	H7BVN7	unidentified_phage	35.7	3.2e-41
>prophage 6
NZ_CP023518	Burkholderia cepacia strain FDAARGOS_388 chromosome 1, complete sequence	3779890	3441186	3519432	3779890	tRNA,integrase,capsid,terminase,plate,portal,head,tail	Burkholderia_phage(38.1%)	108	3481345:3481393	3526370:3526418
WP_158605810.1|3441186_3441933_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	35.0	2.9e-18
WP_063623143.1|3442078_3442396_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034195786.1|3443167_3443467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787610.1|3443837_3444692_+	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	65.9	5.5e-90
WP_081040784.1|3444688_3445774_+	helix-turn-helix domain-containing protein	NA	A4JX55	Burkholderia_virus	48.6	1.5e-63
WP_027787607.1|3445770_3446316_+	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	46.0	2.6e-29
WP_099318686.1|3446327_3446720_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027787606.1|3446716_3446983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787605.1|3446979_3447423_+	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	87.8	9.2e-73
WP_027787604.1|3447425_3447758_+	hypothetical protein	NA	A4JX59	Burkholderia_virus	70.0	2.6e-40
WP_051363288.1|3447754_3447994_+	hypothetical protein	NA	A4JX60	Burkholderia_virus	42.3	3.7e-12
WP_051363303.1|3448280_3448490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081040786.1|3448953_3449388_+	DUF4406 domain-containing protein	NA	L7TKQ2	Pseudomonas_virus	56.2	4.5e-24
WP_027787599.1|3449384_3449705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081040814.1|3449779_3450088_+	hypothetical protein	NA	A0A1L7N0Z9	Ralstonia_phage	49.5	5.5e-24
WP_027787597.1|3450112_3450337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787596.1|3450333_3450702_+	DUF2591 family protein	NA	F8TVJ2	EBPR_siphovirus	38.4	5.4e-10
WP_027787595.1|3450710_3450947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057056459.1|3450974_3451547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787593.1|3451824_3452127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787592.1|3452128_3452707_+|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	32.1	1.0e-10
WP_027787591.1|3452911_3453505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081040788.1|3453557_3455594_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.7	5.5e-96
WP_027787589.1|3455601_3455847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787588.1|3455846_3457517_+|portal	phage portal protein	portal	V5Q9Y6	Xylella_phage	35.8	1.1e-73
WP_027787587.1|3457513_3458380_+	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	52.1	1.6e-49
WP_051363286.1|3458408_3459029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051363285.1|3459071_3460004_+|head	head decoration protein	head	NA	NA	NA	NA
WP_027787586.1|3460112_3461177_+|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	37.5	1.8e-53
WP_027787585.1|3461177_3461510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787584.1|3461506_3462064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787583.1|3462075_3462273_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_027787582.1|3462269_3463772_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	46.5	3.9e-107
WP_034195783.1|3463835_3464207_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_051363284.1|3464209_3464497_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_027787579.1|3464642_3466400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787578.1|3466403_3467861_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	24.4	2.1e-12
WP_027787577.1|3467864_3468947_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	32.9	1.7e-43
WP_027787576.1|3468943_3469546_+|plate	phage baseplate assembly protein V	plate	A0A192Y8K5	Salmonella_phage	31.9	2.3e-10
WP_034195782.1|3469542_3469992_+	phage GP46 family protein	NA	B5TAA8	Burkholderia_phage	31.3	1.3e-10
WP_081040790.1|3469992_3471105_+|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	26.9	1.0e-19
WP_081040791.1|3471116_3471758_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_138143318.1|3471770_3472682_+	hypothetical protein	NA	O22004	Shigella_phage	46.2	1.8e-06
WP_051363283.1|3472697_3473234_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_099318693.1|3475136_3475841_+	lysozyme	NA	A0A059VA40	Pseudomonas_phage	42.2	2.6e-29
WP_027787569.1|3475918_3476554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034195779.1|3476556_3476751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787568.1|3476793_3477477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787567.1|3477473_3477782_+	hypothetical protein	NA	A0A1B2IBL3	Erwinia_phage	54.4	6.7e-22
WP_027787566.1|3477778_3478378_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027787565.1|3478396_3478612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787564.1|3479019_3480099_-|integrase	tyrosine-type recombinase/integrase	integrase	I6NSG1	Burkholderia_phage	54.5	2.1e-110
WP_081040793.1|3480219_3481260_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3481345:3481393	attL	AGGATTGTGATTCCTGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCA	NA	NA	NA	NA
WP_080981894.1|3481480_3482575_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027787562.1|3482502_3482709_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_027787561.1|3482711_3483725_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	62.5	1.6e-117
WP_111946790.1|3483721_3484480_-	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	52.9	1.5e-30
WP_027787560.1|3484476_3484872_-	hypothetical protein	NA	Q6JII6	Burkholderia_virus	70.2	1.7e-46
WP_027787559.1|3484882_3485878_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.6	1.7e-45
WP_027787558.1|3486221_3486578_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_027787557.1|3486592_3487057_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_027787556.1|3487087_3487450_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_027787555.1|3487539_3488163_-	hypothetical protein	NA	A9YX18	Burkholderia_phage	92.6	3.7e-19
WP_027787554.1|3488159_3489926_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	35.8	3.0e-74
WP_027787553.1|3489938_3490997_-	hypothetical protein	NA	H2BD49	Pseudomonas_phage	54.9	1.1e-76
WP_027787552.1|3491011_3491821_-	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	61.3	6.1e-91
WP_167562609.1|3491820_3491985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787551.1|3491981_3492164_-	hypothetical protein	NA	A9YWW6	Burkholderia_phage	73.0	1.0e-06
WP_027787550.1|3492163_3492493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034195891.1|3492627_3493053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787548.1|3493086_3493467_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_081040797.1|3494300_3494699_-	hypothetical protein	NA	C7BGF7	Burkholderia_phage	76.5	6.8e-51
WP_027787547.1|3494783_3495038_+	Cro/Cl family transcriptional regulator	NA	C7BGF8	Burkholderia_phage	60.0	8.8e-20
WP_027787546.1|3495034_3495262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138143319.1|3495261_3495552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787544.1|3495663_3495888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787543.1|3495884_3496097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080981926.1|3496159_3497209_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	59.0	4.4e-33
WP_027787542.1|3497205_3497571_+	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	80.5	4.8e-51
WP_027787541.1|3497670_3498000_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	64.9	1.9e-22
WP_027787540.1|3497996_3498590_+	hypothetical protein	NA	A9YWZ1	Burkholderia_phage	77.4	6.1e-80
WP_027787539.1|3498697_3498877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787538.1|3498873_3499527_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	85.9	2.1e-105
WP_027787537.1|3499547_3500027_+	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	83.6	3.3e-68
WP_027787536.1|3500028_3501630_+	bacteriophage TerL protein	NA	A9YWZ6	Burkholderia_phage	89.6	1.7e-289
WP_027787535.1|3501626_3503210_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	61.0	4.6e-151
WP_138143324.1|3503193_3503790_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	77.2	1.5e-81
WP_027787533.1|3503791_3505096_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	47.3	1.6e-72
WP_027787532.1|3505108_3505597_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	56.8	4.7e-38
WP_027787531.1|3505607_3506645_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	67.7	1.1e-124
WP_027787530.1|3506654_3507092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787529.1|3507147_3507531_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	75.6	1.2e-52
WP_027787528.1|3507559_3508042_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	84.9	1.6e-70
WP_027787527.1|3508045_3508417_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	87.0	2.2e-59
WP_027787526.1|3508421_3509012_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	79.0	2.8e-85
WP_027787525.1|3509021_3510833_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	38.8	4.6e-94
WP_027787524.1|3510848_3511289_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	58.2	4.9e-42
WP_034195778.1|3511291_3511825_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	40.0	1.8e-22
WP_034195777.1|3511821_3512007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027787522.1|3511999_3513856_+	glucosaminidase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	41.4	1.6e-38
WP_027787521.1|3513852_3514452_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	40.1	3.1e-23
WP_027787520.1|3514451_3514766_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	47.0	1.6e-18
WP_027787519.1|3514765_3515758_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	67.3	3.6e-101
WP_155253125.1|3515754_3516330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027787517.1|3516423_3517167_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	78.1	6.4e-103
WP_027787516.1|3517175_3517529_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	72.6	1.6e-40
WP_027787515.1|3517525_3518713_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	70.4	3.4e-146
WP_027787514.1|3518715_3519432_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	68.2	8.7e-81
3526370:3526418	attR	AGGATTGTGATTCCTGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCA	NA	NA	NA	NA
>prophage 1
NZ_CP023521	Burkholderia cepacia strain FDAARGOS_388 chromosome 2, complete sequence	3397791	1741302	1750284	3397791	transposase	Burkholderia_virus(33.33%)	8	NA	NA
WP_027790966.1|1741302_1741713_-	TIGR02594 family protein	NA	A0A249Y3Q7	Serratia_phage	41.0	4.9e-28
WP_021157316.1|1742034_1742259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027790965.1|1742539_1742743_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	5.4e-20
WP_027790964.1|1743119_1744031_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	46.8	2.5e-72
WP_027790963.1|1744154_1745471_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	56.6	6.9e-132
WP_027790962.1|1745484_1746726_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_027787261.1|1746916_1748176_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	1.5e-43
WP_021157319.1|1748421_1750284_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.2	1.1e-07
