The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031449	Pseudomonas aeruginosa strain 97 chromosome, complete genome	6926194	16211	70272	6926194	transposase,tRNA,holin	Shigella_phage(20.0%)	46	NA	NA
WP_102076059.1|16211_17372_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.7	6.8e-83
WP_003120689.1|18130_18904_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_023092222.1|18915_19452_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003100270.1|19783_21490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100271.1|21546_23601_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003097276.1|23600_24548_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_003097280.1|24652_25204_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003097282.1|25347_26235_+	lysophospholipid acyltransferase	NA	NA	NA	NA	NA
WP_003100272.1|26319_26586_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_003097286.1|26732_27386_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.1	2.6e-55
WP_042853987.1|27447_27720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003120685.1|28012_28330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003107053.1|28478_29852_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_003122291.1|29879_31184_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_009316076.1|31180_32125_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_003107059.1|32179_32686_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.3	9.7e-18
WP_003097294.1|32824_33850_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003118479.1|33984_35073_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.5	6.7e-24
WP_003097300.1|35113_35671_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_003111202.1|35680_36658_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_003097311.1|36848_37766_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_016264001.1|37823_38648_+	shikimate dehydrogenase (NADP+)	NA	NA	NA	NA	NA
WP_003111200.1|38758_39745_+	phospholipase C	NA	NA	NA	NA	NA
WP_023113419.1|39725_41012_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003458422.1|41008_41611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009875636.1|41614_43168_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.7e-20
WP_003115797.1|43172_44096_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_096861992.1|44112_45624_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_010792427.1|45751_46651_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003114635.1|46661_47039_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_003097330.1|47017_47383_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_003111192.1|47390_48014_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_003120671.1|48199_49006_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003097340.1|49002_50211_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003111191.1|50314_51202_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003097345.1|51302_51518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003097347.1|51701_51929_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_023089591.1|52225_53914_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_116151292.1|54026_64592_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_019485604.1|64588_64906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003114586.1|65158_65860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016252823.1|67280_67973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071534680.1|67982_68387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071535147.1|68386_68716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533946.1|69155_69398_+	hydrolase	NA	NA	NA	NA	NA
WP_033954923.1|69579_70272_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031449	Pseudomonas aeruginosa strain 97 chromosome, complete genome	6926194	544399	611431	6926194	terminase,tRNA,holin,integrase	Pseudomonas_phage(76.27%)	64	541675:541690	622278:622293
541675:541690	attL	CCTTCGGCCTGGCCGG	NA	NA	NA	NA
WP_009876707.1|544399_545323_-	transaldolase	NA	A0A1D8KMI9	Synechococcus_phage	30.0	3.8e-12
WP_031632324.1|545402_546407_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_031628314.1|546510_547617_+|integrase	integrase	integrase	L7TP61	Pseudomonas_virus	99.7	3.5e-214
WP_003160559.1|547626_547911_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	100.0	8.0e-46
WP_031629037.1|547986_548373_-	hypothetical protein	NA	L7TJJ9	Pseudomonas_virus	100.0	3.6e-65
WP_116151299.1|550210_550717_-	hypothetical protein	NA	L7TI83	Pseudomonas_virus	98.8	5.5e-90
WP_023123612.1|550709_550904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116151301.1|550911_551673_-	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	96.8	1.1e-145
WP_016263630.1|551669_552158_-	DUF1643 domain-containing protein	NA	A0A0U1W068	Pseudomonas_phage	95.7	7.5e-92
WP_116151302.1|552154_552850_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	72.8	1.2e-87
WP_033987707.1|552935_553175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031637056.1|554258_554528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071556516.1|554735_554975_-	hypothetical protein	NA	Q9ZXI4	Pseudomonas_virus	82.4	1.2e-10
WP_033949925.1|555286_555532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033949922.1|555867_556710_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	52.9	2.9e-75
WP_023464875.1|557439_557649_-	LexA repressor	NA	A0A0U1UNR9	Pseudomonas_phage	98.6	3.1e-31
WP_071556514.1|557645_558872_-	recombination-associated protein RdgC	NA	A0A0U1SXS1	Pseudomonas_phage	97.7	6.8e-166
WP_015975415.1|558898_559402_-	single-stranded DNA-binding protein	NA	A0A0U1VYM4	Pseudomonas_phage	100.0	6.5e-91
WP_004349164.1|559405_560011_-	3'-5' exonuclease	NA	A0A0U1W072	Pseudomonas_phage	100.0	7.3e-113
WP_021264620.1|560140_561157_-	DUF1351 domain-containing protein	NA	A0A0U1UNR0	Pseudomonas_phage	98.8	5.5e-121
WP_015975436.1|561161_561917_-	hypothetical protein	NA	A0A0U1UNQ9	Pseudomonas_phage	100.0	5.3e-145
WP_004354971.1|562178_562550_-	hypothetical protein	NA	A0A2K8HNX4	Pseudomonas_phage	99.2	3.4e-60
WP_004354968.1|562546_562768_-	hypothetical protein	NA	A0A0U1SZL8	Pseudomonas_phage	100.0	2.2e-35
WP_016263324.1|562897_563401_-	hypothetical protein	NA	J7I0S8	Pseudomonas_phage	98.2	5.0e-99
WP_004354960.1|563528_563900_-	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	100.0	2.7e-62
WP_034075293.1|563934_564147_-	hypothetical protein	NA	A0A0U1VYM8	Pseudomonas_phage	97.1	1.7e-32
WP_004349174.1|565827_566094_+	DUF1654 domain-containing protein	NA	A0A2K8HZW3	Pseudomonas_phage	100.0	2.3e-42
WP_015975417.1|566130_566928_-	XRE family transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	100.0	1.9e-148
WP_004349179.1|567035_567236_+	Cro/Cl family transcriptional regulator	NA	A0A2K8HL98	Pseudomonas_phage	100.0	1.8e-28
WP_010793311.1|567237_568254_+	hypothetical protein	NA	A0A0U1UNR4	Pseudomonas_phage	100.0	5.6e-150
WP_021264627.1|568240_569098_+	hypothetical protein	NA	A0A2K8HNW6	Pseudomonas_phage	99.6	8.4e-147
WP_023082372.1|569090_569642_+	hypothetical protein	NA	A0A2K8I9A9	Pseudomonas_phage	99.5	1.7e-100
WP_023082373.1|569697_570312_+	hypothetical protein	NA	A0A0U1VZM0	Pseudomonas_phage	98.5	9.0e-111
WP_004349189.1|570390_570885_+	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	99.4	3.2e-82
WP_023980885.1|570887_571112_-	hypothetical protein	NA	A0A0U1UNS7	Pseudomonas_phage	98.6	2.7e-33
WP_034003997.1|571264_571831_+	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	94.7	1.9e-94
WP_079385194.1|571827_573111_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	99.8	7.1e-259
WP_096861953.1|573120_575439_+	hypothetical protein	NA	A0A2K8HKC3	Pseudomonas_phage	99.9	0.0e+00
WP_071536934.1|575585_576716_+	hypothetical protein	NA	A0A2K8HL89	Pseudomonas_phage	99.7	4.2e-178
WP_004349199.1|576728_578021_+	DUF4043 family protein	NA	A0A2K8IBP1	Pseudomonas_phage	100.0	2.2e-252
WP_010793302.1|578079_578559_+	hypothetical protein	NA	A0A2K8HNV7	Pseudomonas_phage	100.0	6.4e-80
WP_004354927.1|578623_579496_+	hypothetical protein	NA	A0A0U1UNM5	Pseudomonas_phage	100.0	8.2e-166
WP_004354925.1|579492_580170_+	hypothetical protein	NA	A0A0U1UNR8	Pseudomonas_phage	100.0	8.7e-131
WP_004349207.1|580166_580373_+	hypothetical protein	NA	A0A0U1SXT5	Pseudomonas_phage	100.0	1.3e-29
WP_004349209.1|580353_580761_+	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	100.0	8.7e-70
WP_010793300.1|580784_581210_+	hypothetical protein	NA	A0A2K8HN63	Pseudomonas_phage	100.0	5.9e-85
WP_004354920.1|581209_582067_+	hypothetical protein	NA	A0A0U1VYN7	Pseudomonas_phage	100.0	4.0e-157
WP_033991422.1|582069_585033_+	hypothetical protein	NA	A0A2K8HKA1	Pseudomonas_phage	97.3	0.0e+00
WP_034003993.1|585032_586223_+	hypothetical protein	NA	A0A0U1UNT0	Pseudomonas_phage	99.5	1.4e-224
WP_004349221.1|586290_586881_+	hypothetical protein	NA	A0A0U1VYN6	Pseudomonas_phage	100.0	1.3e-101
WP_034003991.1|586885_589483_+	hypothetical protein	NA	A0A0U1W0G7	Pseudomonas_phage	99.7	0.0e+00
WP_034004042.1|590033_590639_+	hypothetical protein	NA	Q5QF56	Pseudomonas_virus	99.5	6.4e-109
WP_033937569.1|590639_592532_+	hypothetical protein	NA	A0A0U1SZM6	Pseudomonas_phage	99.8	8.5e-184
WP_058202043.1|593066_595229_+	hypothetical protein	NA	A0A0U1T4P1	Pseudomonas_phage	99.9	0.0e+00
WP_034011972.1|595213_606550_+	SAM-dependent methyltransferase	NA	L7TID4	Pseudomonas_virus	93.3	0.0e+00
WP_015975423.1|606644_606902_+|holin	holin	holin	A0A0U1UNM6	Pseudomonas_phage	100.0	2.1e-37
WP_015975424.1|606885_607419_+	lysozyme	NA	A0A0U1UNS2	Pseudomonas_phage	100.0	1.1e-101
WP_034011971.1|607415_607934_+	hypothetical protein	NA	A0A0U1UNS0	Pseudomonas_phage	97.7	1.3e-70
WP_015975464.1|607944_608538_+	DUF1737 domain-containing protein	NA	A0A0U1VYP2	Pseudomonas_phage	100.0	2.4e-76
WP_071536920.1|608613_609243_+	DUF4124 domain-containing protein	NA	A0A2K8IBL8	Pseudomonas_phage	61.7	3.2e-55
WP_048764667.1|609280_609547_+	hypothetical protein	NA	L7TP56	Pseudomonas_virus	97.7	4.1e-44
WP_033957458.1|609940_610423_-	hypothetical protein	NA	L7THB5	Pseudomonas_virus	96.9	1.1e-87
WP_033957461.1|610412_610790_-	helix-turn-helix domain-containing protein	NA	L7TKV7	Pseudomonas_virus	99.2	1.3e-62
WP_058202042.1|610915_611431_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	89.5	3.9e-91
622278:622293	attR	CCTTCGGCCTGGCCGG	NA	NA	NA	NA
>prophage 3
NZ_CP031449	Pseudomonas aeruginosa strain 97 chromosome, complete genome	6926194	658876	725136	6926194	transposase,tRNA,integrase	Pseudomonas_phage(15.79%)	60	667254:667276	723405:723427
WP_003090677.1|658876_660799_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.5	5.1e-128
WP_003099089.1|660816_661350_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	38.1	2.0e-13
WP_003090673.1|661411_661606_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003099086.1|661629_661986_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003090666.1|662083_663100_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.3	7.9e-27
WP_034037380.1|663134_665513_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003090661.1|665516_665819_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.0e-11
WP_003090655.1|665799_666156_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
667254:667276	attL	AAGTCCATCGACCAGACCTGGTT	NA	NA	NA	NA
WP_096861967.1|667956_668841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003279762.1|669243_669438_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	54.0	6.1e-13
WP_096861968.1|669771_670428_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_096861969.1|670919_673490_+	hypothetical protein	NA	A0A2D0ZND4	Rhodococcus_phage	27.3	3.5e-15
WP_001389365.1|673978_674743_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|674830_674944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|675249_675750_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|675768_675948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|675877_676717_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|676710_677058_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_096862040.1|677279_678323_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_096862041.1|678562_679402_-	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_065761995.1|679513_679876_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000415714.1|680080_680737_-	quinolone resistance pentapeptide repeat protein QnrVC1	NA	NA	NA	NA	NA
WP_096862039.1|681904_683587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021264342.1|683589_684498_+	TniB	NA	NA	NA	NA	NA
WP_023444278.1|684494_685712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155741.1|685773_686397_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	47.6	1.7e-35
WP_096862044.1|686617_687661_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023444277.1|687934_688621_-	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_063860203.1|688668_689424_-	subclass B1 metallo-beta-lactamase DIM-1	NA	NA	NA	NA	NA
WP_000845048.1|689577_690591_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_116151304.1|690529_690790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058355578.1|691258_691453_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_096861997.1|691455_694137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096861998.1|694154_695153_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_096862012.1|695192_698462_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_096861999.1|698458_698965_+	5'-nucleotidase	NA	NA	NA	NA	NA
WP_096862000.1|698976_701700_+	helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.8	1.5e-40
WP_096862001.1|701732_703937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096862002.1|703914_704142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096862003.1|704429_705674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096862013.1|706269_709041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096862004.1|710126_710309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017940311.1|710318_710816_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_096862005.1|710787_711738_-	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_096862006.1|711829_712837_-	alkaline phosphatase	NA	A6XMH8	Bacillus_virus	39.6	2.9e-50
WP_096862007.1|712993_713224_+	antitoxin	NA	NA	NA	NA	NA
WP_020308731.1|713223_713628_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_096862008.1|713714_714683_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.5	1.1e-59
WP_036992178.1|714742_715075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096862009.1|715440_716662_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	74.4	9.2e-115
WP_096862010.1|716790_717063_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_010953434.1|717050_717344_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_096862011.1|717337_718747_-|integrase	site-specific integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	36.8	3.6e-54
WP_012613967.1|719069_720182_-|integrase	integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	34.1	1.3e-38
WP_023106402.1|720181_720397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031631092.1|720470_720857_-	hypothetical protein	NA	L7TJJ9	Pseudomonas_virus	98.4	6.8e-64
WP_012613970.1|721702_722497_+	peptidase P60	NA	A0A0S2SY75	Pseudomonas_phage	96.8	1.6e-144
WP_116151306.1|722896_724035_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	2.2e-46
723405:723427	attR	AAGTCCATCGACCAGACCTGGTT	NA	NA	NA	NA
WP_034037836.1|724418_724745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023087213.1|724851_725136_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	87.1	5.2e-37
>prophage 4
NZ_CP031449	Pseudomonas aeruginosa strain 97 chromosome, complete genome	6926194	849157	919352	6926194	protease,integrase,terminase,tRNA,holin,tail	Pseudomonas_phage(62.5%)	86	855607:855624	892446:892463
WP_003097649.1|849157_849526_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.6	4.9e-11
WP_003090432.1|849553_851830_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.4e-163
WP_002553999.1|851911_852130_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003097644.1|852234_852942_-|tRNA	arginyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
WP_003108768.1|852996_853677_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_015648973.1|853714_854665_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	5.4e-62
WP_003119977.1|854892_857328_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	52.8	1.9e-87
855607:855624	attL	GTCGCCGAGGTGGTGGCG	NA	NA	NA	NA
WP_003090414.1|857353_857980_+	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_003097632.1|857989_859315_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	1.2e-80
WP_003097631.1|859436_860717_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003160439.1|860718_862116_+	siroheme synthase	NA	NA	NA	NA	NA
WP_003097628.1|862120_863095_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|863182_864166_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|864162_864498_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|864494_864800_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|864799_865159_-	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|865155_865551_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|865661_866330_-	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_016852955.1|866665_867733_-|integrase	integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	68.7	8.3e-136
WP_003116724.1|867734_867971_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	53.2	3.8e-17
WP_042853816.1|870409_870916_-	hypothetical protein	NA	L7TI83	Pseudomonas_virus	96.4	1.4e-88
WP_042853817.1|870912_871278_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	95.5	1.9e-60
WP_116151307.1|871274_872060_-	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	95.4	1.9e-137
WP_016263630.1|872056_872545_-	DUF1643 domain-containing protein	NA	A0A0U1W068	Pseudomonas_phage	95.7	7.5e-92
WP_116151309.1|872541_873240_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	97.3	9.5e-133
WP_033970681.1|873440_873749_-	DUF4406 domain-containing protein	NA	A0A2K8I958	Pseudomonas_phage	46.9	5.7e-05
WP_052156336.1|873812_875147_-	hypothetical protein	NA	Q6V7R9	Burkholderia_virus	49.2	1.3e-98
WP_034033531.1|875647_877558_-	DNA methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	89.3	1.7e-269
WP_042853820.1|878167_879913_-	DUF2813 domain-containing protein	NA	H2BD46	Pseudomonas_phage	94.5	2.5e-299
WP_023094671.1|879916_880681_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	68.1	6.0e-104
WP_003116739.1|880693_880894_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_042853821.1|880900_881719_-	hypothetical protein	NA	H2BD49	Pseudomonas_phage	99.3	4.7e-155
WP_042853822.1|881730_882534_-	hypothetical protein	NA	H2BD50	Pseudomonas_phage	96.3	2.6e-150
WP_042853823.1|882662_883316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016263322.1|883308_883491_-	hypothetical protein	NA	Q9MC67	Pseudomonas_phage	96.6	2.7e-23
WP_010793151.1|883487_883709_-	hypothetical protein	NA	A0A127KNM7	Pseudomonas_phage	95.7	2.8e-30
WP_016263324.1|883844_884348_-	hypothetical protein	NA	J7I0S8	Pseudomonas_phage	98.2	5.0e-99
WP_096862026.1|884923_885295_-	carbon storage regulator	NA	J7I430	Pseudomonas_phage	99.2	2.5e-63
WP_042853826.1|885343_885607_-	hypothetical protein	NA	A0A127KNM4	Pseudomonas_phage	98.9	3.7e-45
WP_033953764.1|885664_885871_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	97.1	3.0e-34
WP_034004099.1|885881_886088_-	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	98.5	1.5e-30
WP_023101084.1|886772_887012_-	DUF1654 domain-containing protein	NA	A0A127KND4	Pseudomonas_phage	96.2	2.0e-37
WP_034004098.1|887105_887423_+	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	97.1	6.6e-49
WP_031635265.1|887476_888076_-	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	51.7	9.3e-52
WP_019396726.1|888224_888467_+	XRE family transcriptional regulator	NA	A0A127KNT2	Pseudomonas_phage	100.0	7.5e-37
WP_034051636.1|888484_888667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034004095.1|888725_889238_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	98.8	2.1e-89
WP_042853827.1|889320_889893_+	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	98.9	3.5e-101
WP_042853828.1|889895_890780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103373.1|890829_891438_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	3.4e-41
WP_010793142.1|891430_891874_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	93.9	4.1e-73
WP_031641999.1|891902_892772_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	96.9	2.9e-163
892446:892463	attR	GTCGCCGAGGTGGTGGCG	NA	NA	NA	NA
WP_023085526.1|892987_893209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004349441.1|893554_893944_+	hypothetical protein	NA	H2BD73	Pseudomonas_phage	100.0	9.9e-63
WP_034004085.1|893936_894221_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	96.8	2.3e-40
WP_034004082.1|894229_894829_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	59.9	9.9e-46
WP_034004080.1|894812_896108_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.7	3.7e-146
WP_023109893.1|896110_897466_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.8	2.1e-96
WP_034004077.1|897462_898542_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	98.1	2.6e-201
WP_003103389.1|898670_899414_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.5	2.2e-87
WP_023087394.1|899423_900395_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	65.0	1.9e-110
WP_034004075.1|900436_900922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034004073.1|900905_901370_+	hypothetical protein	NA	H9EB35	Vibrio_phage	36.4	3.0e-10
WP_034004070.1|901369_901759_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.0	2.8e-33
WP_034004067.1|901760_901988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042853829.1|901991_902666_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.0	3.0e-115
WP_022579906.1|902662_903073_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	44.1	3.0e-25
WP_042853830.1|903140_903794_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.3	7.7e-60
WP_022579905.1|903803_904184_+	hypothetical protein	NA	A0A1B0VMH4	Pseudomonas_phage	45.7	9.8e-23
WP_012075338.1|904246_904510_+	hypothetical protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	1.4e-15
WP_096862025.1|904506_907731_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	37.2	3.6e-118
WP_023130692.1|907736_908075_+	hypothetical protein	NA	A0A0S2SYI2	Pseudomonas_phage	96.4	2.2e-58
WP_023130691.1|908071_908821_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	99.2	2.5e-147
WP_023101106.1|908823_909579_+	hypothetical protein	NA	A0A0S2SY75	Pseudomonas_phage	98.8	3.3e-147
WP_023436164.1|909604_909853_+	hypothetical protein	NA	A0A0S2SYE8	Pseudomonas_phage	97.6	9.1e-38
WP_023101107.1|909836_910067_-	hypothetical protein	NA	A0A0S2SY71	Pseudomonas_phage	97.7	4.8e-17
WP_023101108.1|910103_910388_-	hypothetical protein	NA	A0A0S2SYA2	Pseudomonas_phage	98.8	7.0e-42
WP_096862038.1|911267_911879_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	83.7	3.1e-87
WP_116151311.1|912231_915816_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	75.8	0.0e+00
WP_071557737.1|915812_916097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096862045.1|916093_916759_+	hypothetical protein	NA	A0A0S2SYG5	Pseudomonas_phage	46.1	4.3e-58
WP_116151313.1|916986_917754_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	51.8	6.1e-56
WP_034004052.1|917798_918428_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	94.7	4.6e-110
WP_031755474.1|918424_918793_+	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	83.6	4.8e-43
WP_003130908.1|918789_919053_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	88.5	4.5e-35
WP_003160542.1|919088_919352_+	hypothetical protein	NA	Q9MC87	Pseudomonas_phage	94.3	9.0e-44
>prophage 5
NZ_CP031449	Pseudomonas aeruginosa strain 97 chromosome, complete genome	6926194	2897779	2977842	6926194	capsid,lysis,integrase,transposase,terminase,plate,tRNA,tail,head,portal,holin	Pseudomonas_phage(23.91%)	95	2887899:2887916	2983199:2983216
2887899:2887916	attL	CCGGCCAGTGGCTGGCGG	NA	NA	NA	NA
WP_000845048.1|2897779_2898793_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063844482.1|2898999_2899236_+	trimethoprim-resistant dihydrofolate reductase DfrB5	NA	A0A0H5ARK7	Pseudomonas_phage	55.4	1.6e-12
WP_001209508.1|2899349_2900141_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|2900304_2900652_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2900645_2901485_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_001993321.1|2901414_2901594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|2901727_2902492_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_096861854.1|2902880_2903201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058076426.1|2903478_2903916_+	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	37.0	2.4e-17
WP_096861843.1|2903908_2904154_+	hypothetical protein	NA	A0A218MNF2	uncultured_virus	66.2	2.8e-23
WP_011914410.1|2904209_2905229_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_011914409.1|2905225_2907391_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_026084028.1|2907535_2908099_-	chlorite dismutase	NA	NA	NA	NA	NA
WP_071534424.1|2908122_2908485_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_096861844.1|2908934_2910029_+	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	46.5	1.3e-83
WP_096861855.1|2910138_2910426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096861856.1|2910715_2911171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096861845.1|2911202_2911610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096861857.1|2912066_2912435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096861846.1|2913533_2913731_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_096861847.1|2913742_2914912_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	38.0	7.8e-71
WP_003086015.1|2915498_2915813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003104747.1|2915827_2916187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003112595.1|2916435_2919081_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003112596.1|2919082_2920366_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_003454537.1|2920526_2921075_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	46.7	3.1e-22
WP_003104754.1|2921129_2923034_-	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	32.2	5.5e-74
WP_003159670.1|2922989_2923118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034002925.1|2924144_2924831_+	DUF159 family protein	NA	A0A2K8I970	Pseudomonas_phage	86.0	5.5e-117
WP_034002922.1|2924812_2925079_-	hypothetical protein	NA	A0A0U4JX18	Pseudomonas_phage	70.5	5.2e-31
WP_079384502.1|2926078_2926696_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_034002921.1|2926665_2927295_-	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	71.8	6.1e-78
WP_014603877.1|2927406_2927592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034002919.1|2927629_2928682_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	70.1	1.3e-133
WP_015649042.1|2928695_2928902_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	62.7	9.6e-17
WP_096861848.1|2928876_2929716_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	53.9	8.6e-80
WP_096861849.1|2929724_2932415_-|tail	phage tail protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	28.9	1.3e-41
WP_014603883.1|2932553_2932850_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033964226.1|2932859_2933369_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	98.2	3.4e-87
WP_023107128.1|2933381_2934542_-|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	98.2	2.3e-216
WP_079384501.1|2934585_2934768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096861850.1|2935046_2937128_-|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	50.3	1.2e-111
WP_033964219.1|2937124_2937655_-|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	57.5	1.2e-50
WP_014603889.1|2937651_2938536_-|plate	baseplate assembly protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	73.6	7.4e-114
WP_014603890.1|2938532_2938859_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	65.7	2.3e-33
WP_014603891.1|2938868_2939090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034002907.1|2939146_2939704_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	66.0	1.5e-48
WP_034002905.1|2939700_2940237_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.9	1.3e-33
WP_034002902.1|2940229_2940898_-	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	59.7	1.3e-65
WP_015649052.1|2940897_2941212_-	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	45.8	2.1e-18
WP_014603895.1|2941214_2941400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014603896.1|2941401_2942439_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	40.5	1.7e-69
WP_014603897.1|2942454_2942805_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	42.2	2.5e-12
WP_033964211.1|2942818_2944039_-	S49 family peptidase	NA	A0A219YAK4	Aeromonas_phage	34.7	5.3e-46
WP_031652606.1|2944041_2945655_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	39.6	5.5e-91
WP_014603900.1|2945657_2945873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044261430.1|2945885_2947772_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	50.0	2.7e-161
WP_023127296.1|2947815_2948340_-	hypothetical protein	NA	A0A2D1GMW4	Marinobacter_phage	37.2	1.5e-18
WP_014603903.1|2948455_2948818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015649058.1|2949388_2949760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096861851.1|2949756_2951970_-	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	46.9	1.7e-188
WP_034002897.1|2951966_2952176_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_019726483.1|2952168_2952723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071537145.1|2953054_2953309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078451169.1|2953452_2954193_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	63.3	2.1e-53
WP_034002895.1|2954336_2954528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050158035.1|2954524_2955340_+	BRO domain protein	NA	G1JX52	Mycobacterium_phage	42.2	1.5e-28
WP_096861852.1|2955336_2955648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033949272.1|2955657_2955951_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_033949274.1|2956104_2956413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023107149.1|2956409_2956724_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_033949277.1|2956765_2957044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033949279.1|2957114_2957678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033949281.1|2957674_2957914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033949284.1|2958479_2958962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033949286.1|2958958_2960794_+	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	38.2	2.6e-97
WP_033949289.1|2960790_2961174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071537142.1|2961170_2962232_+	hypothetical protein	NA	A0A2K8HL62	Pseudomonas_phage	46.2	1.5e-60
WP_033949296.1|2962427_2962841_+	hypothetical protein	NA	A0A0S2SYB5	Pseudomonas_phage	79.4	3.0e-17
WP_049950076.1|2962952_2963237_+	hypothetical protein	NA	A8YQQ5	Burkholderia_virus	40.0	6.2e-06
WP_033949299.1|2963220_2964852_-|integrase	integrase	integrase	Q3HQV4	Burkholderia_phage	55.7	1.7e-156
WP_019725859.1|2964880_2966215_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_003104756.1|2966276_2966738_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	48.7	1.0e-34
WP_029611033.1|2966730_2967123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085996.1|2967172_2968621_-	magnesium transporter	NA	NA	NA	NA	NA
WP_029611034.1|2968947_2969463_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_029611035.1|2969508_2969961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003123234.1|2970013_2970517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029611036.1|2970608_2970884_-|holin	phage holin family protein	holin	A0A0U4J8T9	Pseudomonas_phage	51.1	4.9e-16
WP_003104765.1|2970876_2971251_-	hypothetical protein	NA	H2BD73	Pseudomonas_phage	51.9	2.1e-25
WP_003085984.1|2971415_2971946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029611037.1|2972116_2972830_+	helix-turn-helix transcriptional regulator	NA	A0A1B0VRI7	Pseudomonas_phage	49.0	2.7e-58
WP_003085981.1|2973461_2973647_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	68.6	9.9e-13
WP_003085971.1|2973831_2975070_-	aspartokinase	NA	NA	NA	NA	NA
WP_003112602.1|2975217_2977842_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.6	2.4e-75
2983199:2983216	attR	CCGCCAGCCACTGGCCGG	NA	NA	NA	NA
>prophage 6
NZ_CP031449	Pseudomonas aeruginosa strain 97 chromosome, complete genome	6926194	4071847	4124615	6926194	plate,tRNA,tail	uncultured_Caudovirales_phage(29.17%)	55	NA	NA
WP_003129196.1|4071847_4072873_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|4072951_4073521_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003099587.1|4073604_4073958_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|4073948_4074491_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|4074463_4075696_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_016252919.1|4075739_4076246_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_042853567.1|4076339_4077893_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|4077889_4079161_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|4079261_4081184_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003085081.1|4081463_4081796_-	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
WP_019681087.1|4081839_4082691_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	2.8e-09
WP_003085085.1|4082690_4083071_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003161932.1|4083107_4083914_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003123920.1|4084029_4085016_-	4-hydroxythreonine-4-phosphate dehydrogenase 1	NA	NA	NA	NA	NA
WP_003109024.1|4085012_4086305_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_023129218.1|4086285_4089057_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010793494.1|4089183_4090200_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|4090196_4090871_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003459406.1|4090872_4091631_+	molecular chaperone DjlA	NA	NA	NA	NA	NA
WP_009875782.1|4091631_4092693_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_042853568.1|4092844_4095238_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|4095283_4095916_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_003085106.1|4096044_4097079_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|4097312_4098422_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|4098477_4099524_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003113206.1|4099638_4100886_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_034007349.1|4100991_4101822_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|4101945_4102620_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_042853569.1|4102619_4103438_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003142794.1|4103510_4104989_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|4105306_4105621_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|4105720_4106491_-	transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|4106948_4107149_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|4107196_4107556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|4107919_4108369_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_034041275.1|4108390_4108906_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.3	9.2e-32
WP_003085141.1|4108902_4109460_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|4109612_4109939_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|4109935_4110823_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_010895511.1|4110815_4111349_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.0e-62
WP_015502281.1|4111350_4113459_+|tail	tail fiber	tail	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_024928377.1|4113467_4113908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003109051.1|4113950_4115111_+|tail	tail protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085175.1|4115123_4115627_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|4115641_4115986_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_034041277.1|4116155_4118393_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_024928379.1|4118402_4119275_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.4	5.1e-75
WP_003101635.1|4119249_4119456_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_023435428.1|4119513_4120503_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	9.8e-107
WP_003113192.1|4120535_4121165_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_004355109.1|4121161_4121524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031800321.1|4121520_4121778_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	63.4	1.1e-17
WP_023085654.1|4122125_4122731_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	4.6e-75
WP_003085203.1|4122732_4123782_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_096861871.1|4123778_4124615_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	1.1e-69
>prophage 7
NZ_CP031449	Pseudomonas aeruginosa strain 97 chromosome, complete genome	6926194	4305152	4345377	6926194	capsid,protease,lysis,integrase,terminase,tRNA,holin,head,portal,tail	Pseudomonas_phage(67.39%)	59	4293641:4293656	4310118:4310133
4293641:4293656	attL	CGCCTGGGACGCCGAT	NA	NA	NA	NA
WP_031757523.1|4305152_4306202_-|integrase	integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.9	1.0e-101
WP_003158850.1|4306201_4306444_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	60.3	1.1e-16
WP_096861985.1|4306427_4306784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096861970.1|4306788_4307478_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	35.6	8.2e-28
WP_096269139.1|4307650_4307842_-	hypothetical protein	NA	A0A1W6JTB8	Pseudomonas_phage	98.3	2.5e-27
WP_096861971.1|4307960_4308668_-	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	100.0	1.6e-47
WP_096861972.1|4308664_4308865_-	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	98.2	3.7e-21
WP_023103752.1|4308861_4309116_-	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	98.8	1.4e-38
WP_021205288.1|4309215_4309449_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	100.0	6.6e-38
WP_023875741.1|4309451_4309844_-	DNA-binding response regulator	NA	A0A1W6JTA9	Pseudomonas_phage	62.5	6.5e-30
WP_096861973.1|4309909_4310650_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTC8	Pseudomonas_phage	66.2	3.8e-55
4310118:4310133	attR	ATCGGCGTCCCAGGCG	NA	NA	NA	NA
WP_096861974.1|4310687_4311026_+	Cro/Cl family transcriptional regulator	NA	A0A2H4J1L8	uncultured_Caudovirales_phage	57.4	2.2e-10
WP_003085704.1|4311022_4311415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031294203.1|4311353_4311614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031757525.1|4311774_4312020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079380365.1|4312109_4312307_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	69.2	5.6e-14
WP_015648196.1|4312303_4312612_+	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	96.1	2.3e-46
WP_024928451.1|4312608_4312884_+	hypothetical protein	NA	A0A1W6JTB7	Pseudomonas_phage	100.0	1.7e-40
WP_024928450.1|4313009_4313372_+	hypothetical protein	NA	A0A1W6JTB9	Pseudomonas_phage	100.0	2.4e-63
WP_050157694.1|4314159_4314474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033977464.1|4314470_4314788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033977466.1|4314784_4315210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096861975.1|4315206_4316313_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	53.0	8.6e-27
WP_096861976.1|4316306_4318118_+	bifunctional DNA primase/helicase	NA	A0A0U4B0G9	Pseudomonas_phage	70.1	1.6e-259
WP_023093241.1|4318114_4318393_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	95.7	8.1e-43
WP_004353175.1|4318389_4318779_+	hypothetical protein	NA	A0A1W6JTD2	Pseudomonas_phage	99.2	2.2e-70
WP_023083817.1|4319318_4319846_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	61.2	1.4e-27
WP_004353177.1|4319930_4320263_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_096861977.1|4320259_4320877_+	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	93.1	1.2e-107
WP_024928444.1|4320873_4321116_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	53.2	6.4e-20
WP_096861978.1|4321112_4321625_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	93.5	1.4e-72
WP_003119047.1|4321637_4321820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022580268.1|4321819_4322149_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.7	5.1e-28
WP_078464133.1|4322238_4322427_+	hypothetical protein	NA	Q9MC37	Pseudomonas_phage	70.0	9.1e-14
WP_003119048.1|4322563_4323055_+	hypothetical protein	NA	S4TNN3	Salmonella_phage	37.0	3.2e-10
WP_057390174.1|4323058_4324738_+|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	66.0	1.9e-195
WP_096861979.1|4324740_4325964_+|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	73.3	6.3e-172
WP_015649331.1|4325947_4326592_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	75.7	3.5e-89
WP_096861980.1|4326588_4327803_+|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	68.3	1.5e-157
WP_003085760.1|4327854_4328058_+	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	50.0	1.8e-07
WP_003085762.1|4328057_4328381_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	65.6	9.1e-30
WP_022580265.1|4328380_4328707_+|head,tail	head-tail adaptor protein	head,tail	A0A2D1GNG1	Pseudomonas_phage	57.3	2.8e-18
WP_071556460.1|4328712_4328907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096861981.1|4328910_4329483_+	hypothetical protein	NA	A0A2D1GNN2	Pseudomonas_phage	50.0	3.5e-40
WP_096861982.1|4329475_4329862_+	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	65.4	2.6e-39
WP_034014150.1|4329893_4330400_+	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	74.1	8.6e-59
WP_031691341.1|4330470_4330815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079386508.1|4330811_4331045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096861983.1|4331825_4335119_+|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	35.4	4.8e-65
WP_096861984.1|4335118_4335418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031691339.1|4335420_4335759_+|tail	minor tail family protein	tail	K7PKL8	Enterobacterial_phage	51.8	8.4e-26
WP_057390180.1|4335755_4336499_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	73.9	4.2e-110
WP_057390181.1|4336501_4337257_+	hydrolase Nlp/P60	NA	A0A0S2SY75	Pseudomonas_phage	91.5	2.8e-138
WP_034014143.1|4337253_4337856_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	61.1	4.6e-59
WP_116151345.1|4338368_4341926_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	64.3	0.0e+00
WP_071557737.1|4341922_4342207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096862045.1|4342203_4342869_+	hypothetical protein	NA	A0A0S2SYG5	Pseudomonas_phage	46.1	4.3e-58
WP_116151347.1|4343096_4343864_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	53.1	5.5e-57
WP_003105684.1|4344138_4345377_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CX69	Yersinia_phage	33.3	7.8e-53
>prophage 8
NZ_CP031449	Pseudomonas aeruginosa strain 97 chromosome, complete genome	6926194	4993007	5044416	6926194	lysis,integrase,terminase,holin,tail,portal	Pseudomonas_phage(80.88%)	77	4999035:4999057	5041415:5041437
WP_015649078.1|4993007_4993643_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	7.8e-41
WP_003115226.1|4993688_4994582_+	lipoprotein NlpD/LppB	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|4994686_4995691_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|4996117_4996441_-	Ferredoxin 1	NA	NA	NA	NA	NA
WP_079386749.1|4996507_4999087_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
4999035:4999057	attL	TACTGCTGCATCATTGGCGTGTG	NA	NA	NA	NA
WP_014602574.1|4999146_5000121_-|integrase	integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	57.6	1.1e-102
WP_071538228.1|5000130_5000340_-	DUF4224 domain-containing protein	NA	A0A1B0VMB6	Pseudomonas_phage	57.8	2.9e-13
WP_096861746.1|5000559_5000850_-	hypothetical protein	NA	A0A1B0Z2L6	Pseudomonas_phage	97.9	1.5e-47
WP_031629755.1|5000922_5001306_-	HNH endonuclease	NA	A0A0U4IIE4	Pseudomonas_phage	98.8	2.2e-46
WP_096861745.1|5001735_5002005_-	DUF3850 domain-containing protein	NA	A0A2I7RB38	Vibrio_phage	50.6	1.1e-15
WP_096861744.1|5002004_5003141_-	hypothetical protein	NA	A0A125RNQ8	Pseudomonas_phage	70.8	1.1e-88
WP_023103693.1|5003137_5003344_-	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	85.5	3.5e-27
WP_096861743.1|5003307_5003556_-	hypothetical protein	NA	H2BD39	Pseudomonas_phage	95.1	1.4e-38
WP_096861742.1|5003552_5004182_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	65.2	2.3e-69
WP_096861741.1|5004432_5004969_-	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	95.5	9.4e-96
WP_073652347.1|5004965_5005343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034076557.1|5005409_5005712_-	hypothetical protein	NA	A0A0U4ISH7	Pseudomonas_phage	96.0	8.2e-41
WP_034076560.1|5005711_5006074_-	hypothetical protein	NA	A0A0U4KL54	Pseudomonas_phage	94.2	1.1e-52
WP_100209532.1|5006022_5006226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031630603.1|5006460_5006709_-	hypothetical protein	NA	A0A0U3TGX2	Pseudomonas_phage	87.8	1.0e-33
WP_034066242.1|5006719_5007103_-	LuxR family transcriptional regulator	NA	A0A0U4IIG4	Pseudomonas_phage	95.3	1.8e-61
WP_094202342.1|5007414_5008281_-	hypothetical protein	NA	A0A0U4JP11	Pseudomonas_phage	99.0	2.6e-156
WP_057390219.1|5008502_5008769_-	hypothetical protein	NA	A0A2H4J103	uncultured_Caudovirales_phage	50.0	5.2e-15
WP_094202333.1|5008996_5009221_-	hypothetical protein	NA	A0A0U4B0L2	Pseudomonas_phage	91.9	1.0e-27
WP_015649351.1|5009238_5009445_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	97.1	3.9e-34
WP_003159007.1|5009455_5009662_-	hypothetical protein	NA	A0A0U4IBH8	Pseudomonas_phage	98.5	3.1e-31
WP_023517913.1|5010377_5010632_+	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	70.4	6.3e-26
WP_079279252.1|5011116_5011557_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_052161481.1|5011558_5011822_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_079278862.1|5012027_5012864_-	XRE family transcriptional regulator	NA	L7TH81	Pseudomonas_virus	63.2	3.3e-87
WP_015649348.1|5012935_5013136_+	regulatory protein cro	NA	A0A0U4K5A6	Pseudomonas_phage	77.3	3.1e-20
WP_031285126.1|5013416_5013677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034066246.1|5013841_5014558_+	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	91.5	1.1e-91
WP_094202336.1|5014554_5015238_+	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	98.7	7.9e-124
WP_003159465.1|5015234_5015441_+	hypothetical protein	NA	A0A1B0YZY8	Pseudomonas_phage	94.1	3.1e-31
WP_094202337.1|5015437_5015809_+	recombinase	NA	NA	NA	NA	NA
WP_058168138.1|5015805_5016153_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0H5AUD2	Pseudomonas_phage	57.0	2.2e-29
WP_033950491.1|5016149_5016449_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	97.9	2.4e-48
WP_021205614.1|5016486_5017161_+	hypothetical protein	NA	A0A1B0YZZ3	Pseudomonas_phage	100.0	1.8e-120
WP_058168140.1|5017271_5017754_-	transcriptional regulator	NA	Q7Y3V7	Yersinia_phage	49.3	7.5e-28
WP_033971890.1|5017800_5017983_-	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	55.0	4.2e-08
WP_043494869.1|5018182_5018515_+|holin	phage holin, lambda family	holin	A0A1B0YZZ1	Pseudomonas_phage	80.0	7.4e-43
WP_073665565.1|5018511_5019129_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	91.2	8.2e-104
WP_023875728.1|5019125_5019368_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	51.9	3.2e-19
WP_116151353.1|5019364_5019835_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	92.9	4.8e-72
WP_003159066.1|5019831_5020575_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	99.6	6.4e-135
WP_010791974.1|5020694_5021240_+	hypothetical protein	NA	A0A1B0Z033	Pseudomonas_phage	100.0	1.5e-96
WP_096861739.1|5021211_5023176_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	99.7	0.0e+00
WP_003159476.1|5023166_5023382_+	hypothetical protein	NA	A0A1B0YZU1	Pseudomonas_phage	100.0	8.5e-32
WP_096861738.1|5023381_5025028_+|portal	phage portal protein	portal	A0A1B0YZU4	Pseudomonas_phage	99.8	0.0e+00
WP_079988383.1|5024987_5027081_+	peptidase S14	NA	A0A1B0YZU0	Pseudomonas_phage	99.9	0.0e+00
WP_023110592.1|5027147_5027465_+	DUF2190 family protein	NA	A0A1B0YZT7	Pseudomonas_phage	100.0	1.6e-50
WP_023110593.1|5027461_5027791_+	hypothetical protein	NA	A0A1B0YZU3	Pseudomonas_phage	100.0	3.1e-57
WP_033950511.1|5027787_5028258_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	98.7	1.2e-86
WP_015980908.1|5028261_5028456_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	98.4	1.5e-27
WP_096861737.1|5028457_5029210_+	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	99.2	2.6e-136
WP_071537778.1|5029291_5029933_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	95.8	7.2e-111
WP_031640281.1|5029994_5030297_+	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	99.0	4.1e-48
WP_096861736.1|5030399_5032883_+|tail	tail length tape measure protein	tail	A0A1B0YZV6	Pseudomonas_phage	98.3	0.0e+00
WP_096861735.1|5032922_5033444_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	99.4	9.7e-98
WP_096861734.1|5033443_5035141_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	95.4	1.6e-311
WP_096861733.1|5035143_5035554_+	hypothetical protein	NA	A0A1B0YZV0	Pseudomonas_phage	96.3	8.5e-65
WP_096861732.1|5035553_5036099_+	hypothetical protein	NA	A0A0A0YWE1	Pseudomonas_phage	96.1	7.3e-96
WP_096861731.1|5036111_5036516_+	hypothetical protein	NA	A0A0A0YR47	Pseudomonas_phage	98.5	1.2e-66
WP_096861730.1|5036512_5038171_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	98.2	0.0e+00
WP_096861729.1|5038200_5038788_+	hypothetical protein	NA	A0A1W6JT86	Pseudomonas_phage	96.9	6.0e-104
WP_096861728.1|5038780_5038972_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	95.2	3.0e-28
WP_031640240.1|5038976_5039537_+	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	98.9	1.5e-99
WP_031691360.1|5039536_5039818_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	98.9	1.0e-45
WP_096861727.1|5039810_5040374_+|tail	phage tail protein	tail	A0A0A0YRS1	Pseudomonas_phage	81.8	6.8e-81
WP_034011739.1|5040373_5040676_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	88.0	1.4e-43
WP_096861726.1|5040672_5040912_+	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	98.7	2.6e-34
WP_083568136.1|5040934_5041213_+	hypothetical protein	NA	A0A0U4JEI3	Pseudomonas_phage	96.7	1.2e-46
WP_003092267.1|5041434_5041599_+	hypothetical protein	NA	NA	NA	NA	NA
5041415:5041437	attR	TACTGCTGCATCATTGGCGTGTG	NA	NA	NA	NA
WP_012613731.1|5041580_5042588_-	TolB-like translocation protein	NA	NA	NA	NA	NA
WP_003092262.1|5042735_5043242_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|5043375_5044416_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
