The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	2729	45605	2710941	protease,transposase,holin	Burkholderia_virus(20.0%)	38	NA	NA
WP_080595781.1|2729_3638_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	4.9e-12
WP_003573417.1|4143_5124_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_003601171.1|5180_6140_+	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003601173.1|6279_7209_+	ribokinase	NA	NA	NA	NA	NA
WP_096835879.1|7626_9618_-	cell division protein FtsI	NA	NA	NA	NA	NA
WP_003601178.1|9792_11175_+	MFS transporter	NA	NA	NA	NA	NA
WP_003601179.1|11155_11590_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003601180.1|11586_12150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601181.1|12162_12378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601182.1|13191_13881_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003601183.1|13944_14631_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_016385778.1|15142_16669_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	1.3e-52
WP_016385779.1|16938_19035_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003601187.1|19035_19347_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_016385780.1|19474_20761_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016385781.1|20777_21200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|21221_22082_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_016385782.1|22195_22837_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003601195.1|23123_23954_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003563257.1|23946_24816_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003601196.1|24855_25851_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_003601202.1|26647_27337_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.3e-29
WP_003601205.1|27497_28868_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	4.8e-11
WP_032765802.1|29231_30050_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003563382.1|30366_30636_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003601215.1|30875_31883_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003563385.1|31934_32426_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563386.1|32468_33278_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003568992.1|33270_34122_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003597397.1|34151_36395_+	maltodextrin glucosidase	NA	NA	NA	NA	NA
WP_003573589.1|36484_36901_+	PTS N-acetylglucosamine transporter subunit IIBC	NA	NA	NA	NA	NA
WP_096836520.1|36893_38579_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003585301.1|38812_39010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585300.1|38984_39338_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011674296.1|39438_40941_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_016386039.1|41071_42883_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	2.3e-45
WP_071798369.1|45103_45226_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_071798372.1|45467_45605_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 2
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	114968	220543	2710941	protease,transposase,portal,integrase,holin,terminase,capsid,tail	Lactobacillus_phage(55.36%)	105	122080:122102	176031:176053
WP_096835888.1|114968_116387_+|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_003601283.1|117661_118165_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_016386092.1|118343_119237_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	31.5	9.7e-05
WP_003601286.1|119391_120258_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003601287.1|120274_121108_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003601288.1|121204_122101_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
122080:122102	attL	CCGGTTAGAAACCGGAGTGTAAG	NA	NA	NA	NA
WP_096835890.1|122251_123469_+	MFS transporter	NA	NA	NA	NA	NA
WP_003601290.1|123487_124387_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003601291.1|124831_125647_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003601293.1|125680_126610_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.4	8.6e-105
WP_003601295.1|126799_127345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096835892.1|127666_128836_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.5	2.0e-220
WP_096835894.1|128954_129218_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	43.5	6.5e-10
WP_096835897.1|129331_129934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096835902.1|130289_130967_-	transcriptional regulator	NA	A0A2D1GPN7	Lactobacillus_phage	95.6	4.2e-85
WP_096835904.1|131023_131671_-	helix-turn-helix domain-containing protein	NA	B4XYR6	Lactobacillus_phage	42.2	1.4e-37
WP_096835905.1|131819_132086_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096835907.1|132082_132844_+	phage antirepressor KilAC domain-containing protein	NA	Q6J1W3	Lactobacillus_phage	90.9	3.2e-126
WP_096835909.1|132978_133224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661433.1|133298_133544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032780976.1|133558_133828_-	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	58.6	5.7e-09
WP_003661430.1|134066_134255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661429.1|134251_134932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096835911.1|134997_135357_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	1.4e-63
WP_128528277.1|135458_135677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096835913.1|135627_136332_-	DUF4145 domain-containing protein	NA	A0A1L2JZ52	Aeribacillus_phage	30.2	1.3e-12
WP_016378891.1|136573_136888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096835915.1|136880_137708_+	helix-turn-helix domain-containing protein	NA	U5U793	Lactobacillus_phage	75.8	1.6e-115
WP_096835917.1|137704_138967_+	DNA helicase	NA	U5U3Y9	Lactobacillus_phage	97.1	1.1e-232
WP_096835919.1|138968_139313_+	hypothetical protein	NA	U5U420	Lactobacillus_phage	99.1	3.7e-61
WP_032957370.1|139354_139756_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	4.4e-50
WP_096835921.1|139768_140233_+	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	97.4	1.3e-13
WP_096835923.1|140244_141072_+	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	73.9	1.1e-103
WP_096835924.1|141190_141727_+	DUF1642 domain-containing protein	NA	C1KFT3	Lactobacillus_virus	59.2	2.0e-50
WP_096836523.1|141716_141929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096835925.1|141918_142209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096835927.1|142198_142624_+	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	63.7	1.5e-40
WP_096835929.1|142620_142908_+	hypothetical protein	NA	Q6J1U4	Lactobacillus_phage	86.0	9.0e-37
WP_096835931.1|142904_143318_+	hypothetical protein	NA	C1KFT7	Lactobacillus_virus	56.6	6.4e-36
WP_096835935.1|143702_143921_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	95.8	1.1e-31
WP_096835937.1|143994_144423_+	DUF1492 domain-containing protein	NA	A0A0P0IJK8	Lactobacillus_phage	97.2	3.3e-75
WP_096835939.1|145412_146561_+	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	98.4	1.1e-221
WP_096835941.1|146573_147104_+	HNH endonuclease	NA	Q8LTA0	Lactobacillus_phage	65.5	2.3e-62
WP_096835943.1|147107_147428_+	ribonucleoside-diphosphate reductase	NA	U5U741	Lactobacillus_phage	93.3	1.1e-51
WP_096835946.1|148000_148336_+	HNH endonuclease	NA	A0A2H4J213	uncultured_Caudovirales_phage	53.8	4.9e-26
WP_003572621.1|148569_148788_+	hypothetical protein	NA	D2XR14	Bacillus_phage	41.1	1.2e-06
WP_096835948.1|148784_150476_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	52.9	1.9e-171
WP_096835950.1|150490_151798_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	43.5	1.0e-82
WP_096835953.1|151775_152504_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	39.5	4.2e-38
WP_096835954.1|152525_153695_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	51.7	1.7e-102
WP_114650373.1|153691_153838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096835955.1|153830_154121_+	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	45.8	1.8e-16
WP_096835956.1|154113_154494_+	hypothetical protein	NA	M9QX19	Staphylococcus_phage	32.7	1.2e-09
WP_096835958.1|154490_154904_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	54.5	1.7e-33
WP_003603965.1|154900_155278_+	hypothetical protein	NA	A0A059T681	Listeria_phage	43.2	6.5e-19
WP_096835961.1|155292_155883_+|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	39.6	1.2e-32
WP_080769642.1|155900_156137_+	Ig domain-containing protein	NA	B8QTT6	Erwinia_phage	58.7	2.4e-11
WP_096835962.1|156211_156529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096835964.1|156708_160677_+|tail	phage tail tape measure protein	tail	E9LUJ2	Lactobacillus_phage	35.9	3.1e-10
WP_096835966.1|160673_162572_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	78.2	4.0e-290
WP_096835968.1|162572_165491_+|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	65.1	0.0e+00
WP_096835970.1|165492_165783_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	55.2	1.5e-23
WP_003601642.1|165775_165907_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	93.0	9.4e-18
WP_016369921.1|165937_166336_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	99.2	4.4e-66
WP_016376687.1|166304_166514_+	hypothetical protein	NA	A8YQK5	Lactobacillus_phage	92.3	3.3e-12
WP_096835971.1|166506_166953_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.9	8.4e-66
WP_096835973.1|166963_168262_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	90.0	1.2e-221
WP_096835975.1|168276_168480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601297.1|168759_169548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601307.1|169630_170770_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003563521.1|170871_171684_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003573812.1|171715_172429_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003601310.1|173255_174167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601311.1|174439_175828_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003601313.1|176874_177540_+	WxL domain-containing protein	NA	NA	NA	NA	NA
176031:176053	attR	CTTACACTCCGGTTTCTAACCGG	NA	NA	NA	NA
WP_016386016.1|177607_178627_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_003601318.1|178607_178985_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_096835977.1|181649_182570_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
WP_003583596.1|182872_183574_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003563546.1|183724_184084_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003563548.1|184067_184769_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_096835978.1|184933_186955_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003601323.1|187030_188005_-	EamA family transporter	NA	NA	NA	NA	NA
WP_016386090.1|188172_189900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003601325.1|189886_190681_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	8.0e-27
WP_003563576.1|190932_191481_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003601326.1|191528_192353_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003601327.1|192524_193397_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_003601328.1|193374_195660_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003601329.1|196536_198255_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	5.2e-31
WP_003601330.1|198259_200041_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	3.5e-46
WP_003601331.1|200202_201447_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_003587307.1|201733_202450_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_080595781.1|203024_203933_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	4.9e-12
WP_003597552.1|203869_204568_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.7	2.3e-22
WP_016385746.1|206016_208020_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563595.1|208360_209665_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_003593375.1|209885_211361_+	amino acid permease	NA	NA	NA	NA	NA
WP_003601337.1|212708_214049_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003563620.1|214221_214422_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	3.1e-20
WP_003601343.1|215176_215617_-	OsmC family protein	NA	NA	NA	NA	NA
WP_096835982.1|215816_217298_-	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	26.9	3.1e-32
WP_003601347.1|217657_218272_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096835984.1|218491_219337_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	23.5	6.2e-09
WP_003600190.1|219526_220543_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.6	6.4e-37
>prophage 3
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	409422	515002	2710941	protease,transposase,portal,integrase,holin,terminase,tRNA,capsid,tail,head	Lactobacillus_phage(81.13%)	105	420704:420722	498762:498780
WP_096836011.1|409422_410925_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_016385900.1|411025_411550_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096836013.1|411698_412967_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.1	7.7e-48
WP_003564071.1|413336_413885_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003601618.1|414262_415981_+	APC family permease	NA	NA	NA	NA	NA
WP_003569394.1|416267_417476_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_096836015.1|417478_418507_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003601621.1|418519_419533_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003564083.1|419568_419922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016378905.1|420007_421183_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
420704:420722	attL	AGCAATCGTTGCTTCGATC	NA	NA	NA	NA
WP_003601625.1|421428_421707_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_003601628.1|421937_424031_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	46.8	8.0e-151
WP_003564091.1|424223_424664_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003601647.1|430717_431365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003601648.1|431545_432730_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.7	7.3e-141
WP_016386015.1|432843_434337_+	MFS transporter	NA	NA	NA	NA	NA
WP_003569429.1|434434_434905_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003601651.1|436620_437346_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_096836017.1|437446_438130_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016377889.1|438584_440996_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
WP_003601656.1|441261_442905_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003601658.1|442909_443620_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_003564132.1|443762_443978_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003601660.1|444094_444916_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003564134.1|444912_445416_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_016387342.1|445739_446879_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	98.9	2.3e-216
WP_157780093.1|447041_447200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836019.1|447196_448054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071798118.1|448148_448913_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	55.5	7.0e-44
WP_071798119.1|448926_449337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003578190.1|449940_450138_+	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
WP_096836021.1|450134_450932_+	ORF6N domain-containing protein	NA	A0A0P0IDD0	Lactobacillus_phage	59.8	2.8e-56
WP_003593164.1|450939_451152_+	hypothetical protein	NA	A0A0N7IRA6	Lactobacillus_phage	98.6	1.7e-29
WP_003657835.1|451260_451485_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
WP_012491233.1|451573_451786_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	100.0	2.5e-36
WP_060611972.1|451795_452671_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	98.6	1.0e-168
WP_016364601.1|452673_452868_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	98.4	5.5e-30
WP_025376214.1|452867_453755_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	99.0	1.6e-161
WP_071798131.1|453763_454009_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	95.1	5.5e-35
WP_071798133.1|454013_454847_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	90.4	2.2e-120
WP_096836023.1|454884_455706_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	99.6	1.8e-154
WP_096836025.1|455702_456002_+	hypothetical protein	NA	A0A0P0IK66	Lactobacillus_phage	85.9	2.1e-41
WP_003593183.1|455964_456249_+	hypothetical protein	NA	A0A0P0IDD7	Lactobacillus_phage	95.7	4.9e-43
WP_060611979.1|456217_456565_+	hypothetical protein	NA	A0A0P0IQU7	Lactobacillus_phage	99.1	9.7e-62
WP_012491243.1|456557_457136_+	HNH endonuclease	NA	A0A0P0I7T6	Lactobacillus_phage	100.0	1.1e-105
WP_025376211.1|457152_457572_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	98.6	3.5e-74
WP_096836027.1|457576_457867_+	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	96.6	1.6e-38
WP_096836029.1|457863_458187_+	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	98.1	1.1e-54
WP_096836031.1|458265_458715_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0P0IZR0	Lactobacillus_phage	91.9	8.4e-74
WP_096836033.1|458939_459320_+	HNH endonuclease	NA	A0A0P0HRY0	Lactobacillus_phage	95.2	2.6e-68
WP_003582259.1|459389_459764_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	100.0	3.6e-62
WP_096836035.1|459766_461497_+|terminase	terminase large subunit	terminase	A0A1B0Y6B8	Lactobacillus_phage	99.1	0.0e+00
WP_020751509.1|461515_462751_+|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	99.3	8.4e-233
WP_096836037.1|462728_463436_+|protease	Clp protease ClpP	protease	A0A0P0HRU7	Lactobacillus_phage	99.6	1.6e-127
WP_071798154.1|463440_464670_+|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	99.5	2.8e-228
WP_096836040.1|464743_464992_+	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	98.8	9.1e-38
WP_003582271.1|465005_465332_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_012491255.1|465270_465609_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_096836041.1|465592_465922_+	hypothetical protein	NA	A0A1B0Y3M9	Lactobacillus_phage	99.1	6.8e-57
WP_096836043.1|465911_466295_+	hypothetical protein	NA	A0A0P0IQS9	Lactobacillus_phage	97.6	5.0e-67
WP_096836045.1|466306_466954_+|tail	phage tail protein	tail	A0A0P0I7R6	Lactobacillus_phage	98.1	1.4e-117
WP_003595114.1|467030_467396_+	hypothetical protein	NA	A0A1B0Y865	Lactobacillus_phage	100.0	4.6e-62
WP_012491334.1|467476_467638_+	hypothetical protein	NA	A0A1B0Y4R4	Lactobacillus_phage	100.0	5.7e-25
WP_096836047.1|467657_470828_+|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	86.4	1.7e-248
WP_096836049.1|470834_471530_+|tail	phage tail protein	tail	A0A1B0Y2S2	Lactobacillus_phage	96.5	1.2e-124
WP_096836051.1|471526_475831_+|tail	phage tail protein	tail	A0A1B0Y2S0	Lactobacillus_phage	71.9	0.0e+00
WP_096836053.1|475859_476285_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	99.3	2.6e-72
WP_020751519.1|476287_476557_+	hypothetical protein	NA	A0A1B0Y3N0	Lactobacillus_phage	97.7	4.4e-38
WP_096836055.1|476603_476897_+	hypothetical protein	NA	A0A0P0IK41	Lactobacillus_phage	89.7	2.9e-43
WP_096836056.1|476886_477318_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	95.9	6.7e-44
WP_096836058.1|477319_478372_+	peptidoglycan recognition protein	NA	A0A1B0Y4R9	Lactobacillus_phage	98.3	1.8e-204
WP_016386020.1|478895_480395_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016386019.1|480422_481982_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003601666.1|482069_482543_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003601668.1|482887_484093_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_003601670.1|484226_485555_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003564140.1|485745_486012_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003574245.1|486060_487404_+	PFL family protein	NA	NA	NA	NA	NA
WP_003601672.1|487513_488569_+	competence protein	NA	NA	NA	NA	NA
WP_003601677.1|488758_489394_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003601679.1|489463_490057_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003564145.1|490250_490922_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003564146.1|490923_491721_+	NAD kinase	NA	NA	NA	NA	NA
WP_003601681.1|491720_492623_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_016386017.1|492731_493790_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003583942.1|493946_494582_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003564150.1|494603_495422_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_016377049.1|495540_496539_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_096836061.1|496744_497785_-	lactonase family protein	NA	NA	NA	NA	NA
WP_003564152.1|498056_498434_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564153.1|498545_498815_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
498762:498780	attR	AGCAATCGTTGCTTCGATC	NA	NA	NA	NA
WP_003564154.1|498942_499932_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.9	8.2e-138
WP_003564155.1|500159_501107_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_096836063.1|501172_502015_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003601708.1|502269_502779_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003564159.1|502905_503316_+	DUF1149 family protein	NA	NA	NA	NA	NA
WP_003601713.1|503488_505810_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.0	8.5e-85
WP_003601715.1|505818_507081_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003601717.1|507077_508370_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	27.3	3.7e-05
WP_003601719.1|508369_509098_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003601721.1|509184_510123_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003564171.1|510119_510713_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016386175.1|511128_512370_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016386176.1|512426_513488_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	3.6e-123
WP_016386172.1|513724_515002_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.9e-49
>prophage 4
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	536900	611229	2710941	tRNA,transposase,holin	Streptococcus_phage(27.27%)	58	NA	NA
WP_003564220.1|536900_537236_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003564222.1|537426_538386_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_003578277.1|538387_539215_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_096836070.1|539225_540281_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003564228.1|540346_541294_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.2	3.6e-82
WP_003564230.1|541875_543603_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	55.1	5.0e-183
WP_003601747.1|543818_544487_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003601756.1|546271_548638_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003564240.1|548900_549548_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003601758.1|549753_551769_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_003564244.1|552036_554928_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
WP_003601760.1|555278_555818_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|555980_556868_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564250.1|556864_557893_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_016378121.1|557897_558845_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564253.1|559230_559686_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003601767.1|559802_560393_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	51.8	3.1e-52
WP_003601769.1|561194_562232_+	central glycolytic pathway regulator	NA	NA	NA	NA	NA
WP_003564265.1|562268_563291_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003564267.1|563481_564672_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003601772.1|564746_565502_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003564271.1|565550_566855_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	67.1	4.4e-163
WP_180370776.1|567203_568484_+	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	34.9	4.7e-61
WP_003578319.1|568489_568846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601777.1|568934_570506_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003564279.1|570691_570928_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003569577.1|571170_571905_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016385787.1|571906_574276_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.6	3.9e-93
WP_003564285.1|574307_574781_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	60.5	1.2e-46
WP_096836074.1|575178_576132_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003601783.1|578008_579754_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_080595781.1|579850_580759_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	4.9e-12
WP_003597552.1|580695_581394_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.7	2.3e-22
WP_096836077.1|581579_582500_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
WP_003601789.1|584736_585429_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_016386188.1|585433_586564_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.8	5.5e-21
WP_096836079.1|586591_588217_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003601796.1|588256_589489_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_096836083.1|590061_591480_+|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_003564309.1|592494_593352_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003564311.1|593489_593792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564314.1|593781_593970_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003601799.1|594374_595622_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_096836085.1|595750_597064_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003569669.1|597073_597895_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003564323.1|597910_598804_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003593952.1|598793_599855_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	1.8e-21
WP_003569672.1|600224_600806_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003569673.1|601102_601609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569675.1|601821_602715_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003601805.1|602834_603521_+	uracil-DNA glycosylase	NA	A0A0S1TKU8	Elephant_endotheliotropic_herpesvirus	41.7	2.1e-39
WP_003564336.1|603642_604620_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003601807.1|604616_605078_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003601809.1|605527_606424_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	6.1e-23
WP_003561810.1|607242_608172_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_003564348.1|608857_609400_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	41.0	3.7e-23
WP_016385769.1|609411_610170_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.7	4.0e-60
WP_096836087.1|610308_611229_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.0e-21
>prophage 5
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	621073	665249	2710941	transposase,portal,integrase,terminase,capsid,tail,head	Staphylococcus_phage(16.67%)	47	619481:619497	668090:668106
619481:619497	attL	GGGAAAATGGCTTTAAA	NA	NA	NA	NA
WP_011674296.1|621073_622576_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_096836090.1|622636_625444_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.0	2.1e-74
WP_003584127.1|625547_626192_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016385771.1|626229_627369_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003574320.1|627358_628093_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.8	2.5e-27
WP_003598215.1|628356_629214_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_003598218.1|629210_630299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004559590.1|630320_631685_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_003569704.1|632000_633812_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1GV45	Paramecium_bursaria_Chlorella_virus	37.5	4.4e-89
WP_004559592.1|634019_635825_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_004559593.1|635899_636391_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003564397.1|636461_637193_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004559594.1|637317_638184_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_004559595.1|638180_639023_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_019728331.1|639052_640069_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_003564402.1|640328_640652_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_003598228.1|640648_641089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598230.1|641133_641370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598231.1|641329_641791_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_003598233.1|641774_642107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598234.1|642209_643220_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003598235.1|643438_643897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601839.1|644035_645424_+	amino acid permease	NA	NA	NA	NA	NA
WP_003598236.1|645623_646388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564420.1|646384_647224_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_003601841.1|647224_648181_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_096836092.1|648177_649047_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016386340.1|649324_651616_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_003569727.1|651886_652195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836095.1|652466_653615_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	29.6	3.5e-31
WP_096836097.1|653708_654362_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003571956.1|654490_654769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005690517.1|654865_655261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836099.1|655371_655563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064520392.1|655610_655883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016366752.1|655879_656068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836101.1|656051_656879_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.5	4.5e-12
WP_049166530.1|656871_658263_+	DNA primase	NA	A0A0M4RE09	Enterococcus_phage	34.0	1.4e-42
WP_049166529.1|658614_658956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_183406784.1|659039_659414_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	8.4e-11
WP_049166528.1|659538_660009_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_096836105.1|660005_661709_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.0	1.7e-119
WP_016386406.1|661674_661854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836107.1|661858_663043_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.7	1.8e-59
WP_096836109.1|663029_664571_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	30.1	1.0e-33
WP_075761396.1|664633_664924_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_096836110.1|664907_665249_+|head	phage head closure protein	head	I7AUE6	Enterococcus_phage	37.0	3.6e-08
668090:668106	attR	GGGAAAATGGCTTTAAA	NA	NA	NA	NA
>prophage 6
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	682307	743822	2710941	protease,tRNA,transposase	Cafeteria_roenbergensis_virus(15.38%)	50	NA	NA
WP_003564470.1|682307_682604_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003598273.1|682607_684062_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003578560.1|684063_685494_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003564476.1|685766_686801_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	28.1	2.2e-16
WP_016373214.1|686793_688167_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	51.3	1.1e-127
WP_029507390.1|688760_689972_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	34.1	1.2e-53
WP_013245625.1|690000_690837_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003601915.1|690916_691792_-	PPK2 family polyphosphate--nucleotide phosphotransferase	NA	NA	NA	NA	NA
WP_003601917.1|691960_693865_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	27.0	1.6e-57
WP_016386361.1|693984_695409_+	MFS transporter	NA	NA	NA	NA	NA
WP_003598288.1|695494_695947_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003569778.1|696244_697117_-	DegV family protein	NA	NA	NA	NA	NA
WP_003574021.1|697276_698197_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_096836114.1|698331_699348_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	1.6e-35
WP_003578571.1|699621_700548_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_003574445.1|701716_702454_+	lysozyme	NA	NA	NA	NA	NA
WP_003564501.1|702586_702943_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003598290.1|703154_703511_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003564506.1|703857_704811_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003578577.1|704824_706111_+	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	26.6	2.1e-32
WP_003569787.1|706110_706479_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564512.1|706552_706975_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003564514.1|707272_707995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598291.1|708080_709859_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	35.4	3.0e-74
WP_003598292.1|710012_711248_-	aminopeptidase	NA	NA	NA	NA	NA
WP_003598293.1|711572_712181_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003601952.1|712570_713944_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_016385834.1|714084_715092_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003564526.1|715177_715639_-	flavodoxin	NA	NA	NA	NA	NA
WP_003601954.1|715889_716714_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003601955.1|716992_718054_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003601956.1|718272_718530_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_003564534.1|718545_718755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003601957.1|719133_720210_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_096836077.1|720225_721146_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
WP_003574465.1|721419_722334_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.0	2.2e-73
WP_016385819.1|722560_723859_+|protease	Zn-dependent protease M10 family	protease	NA	NA	NA	NA
WP_096836116.1|726588_727452_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	9.0e-24
WP_096836118.1|729416_731270_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_016386364.1|731356_732187_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003601580.1|732729_735393_-	YfhO family protein	NA	NA	NA	NA	NA
WP_071798946.1|735703_737443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601582.1|737621_738551_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.7	7.8e-74
WP_016378353.1|738637_739276_-	YkyA family protein	NA	NA	NA	NA	NA
WP_003566523.1|739403_740369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658399.1|740515_740644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003601584.1|741327_741528_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	2.0e-19
WP_003585301.1|741693_741891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585300.1|741865_742219_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011674296.1|742319_743822_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	1114548	1211929	2710941	transposase,portal,integrase,holin,terminase,tRNA,capsid,tail,head	Lactobacillus_phage(30.3%)	92	1143671:1143730	1176490:1176649
WP_003565615.1|1114548_1115847_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	27.9	1.0e-50
WP_003602342.1|1115877_1117053_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003602344.1|1117107_1117596_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_096836177.1|1117898_1120685_-	ribonuclease H-like domain-containing protein	NA	A0A1X9I5C8	Streptococcus_phage	28.8	6.3e-42
WP_096836179.1|1120723_1124428_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	22.4	1.0e-15
WP_096836181.1|1124424_1127964_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_003602348.1|1128314_1129250_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_003575170.1|1129257_1130262_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_003602350.1|1130227_1131262_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_096836182.1|1131750_1133082_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003602353.1|1133068_1134025_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003602355.1|1134077_1134821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003565641.1|1134914_1135265_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003565643.1|1135316_1135505_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003602357.1|1135647_1136442_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_003565647.1|1136428_1137139_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_003565648.1|1137354_1138623_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	1.1e-38
WP_003602358.1|1138636_1140424_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.0	1.6e-54
WP_003602359.1|1140616_1142686_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003602360.1|1142687_1143584_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
1143671:1143730	attL	ATGCGCGGTTCCACCCTACTTCAGATAGAAAAAACTACCTGCGGCTTCATCATTTGGTTC	NA	NA	NA	NA
WP_096836184.1|1143975_1145145_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.5	7.6e-42
WP_029943783.1|1145187_1145514_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016372179.1|1146490_1146751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836186.1|1146820_1147045_-	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	94.6	4.4e-31
WP_096836189.1|1147089_1148247_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	62.2	1.8e-131
WP_016372181.1|1148249_1148582_-|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	2.6e-32
WP_016378024.1|1148594_1148828_-	hypothetical protein	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	94.8	1.7e-33
WP_096836192.1|1148852_1148984_-	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.7	4.2e-18
WP_096836194.1|1148976_1149267_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	85.4	3.6e-41
WP_096836196.1|1149276_1151961_-|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	82.8	0.0e+00
WP_096836198.1|1151961_1153899_-|tail	phage tail family protein	tail	Q7Y4B1	Lactobacillus_phage	79.7	1.9e-303
WP_096836200.1|1153899_1158576_-	tape measure protein	NA	Q3L0S4	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	50.9	7.8e-154
WP_016375976.1|1158582_1158822_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	54.4	7.7e-18
WP_016375975.1|1158790_1159150_-|tail	putative phage tail protein	tail	Q3L0S6	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	49.1	1.5e-20
WP_096836202.1|1159313_1159922_-|tail	phage tail protein	tail	A8YQJ7	Lactobacillus_phage	92.1	1.3e-101
WP_096836204.1|1159922_1160303_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	93.7	3.7e-62
WP_096836206.1|1160299_1160719_-	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	85.6	1.7e-60
WP_096836208.1|1160721_1161066_-|head	phage head closure protein	head	A8YQJ4	Lactobacillus_phage	83.9	4.2e-49
WP_096836209.1|1161055_1161340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836212.1|1161411_1163205_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	34.3	6.0e-62
WP_096836213.1|1163197_1164304_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	43.6	2.5e-79
WP_183406786.1|1164300_1164483_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_096836217.1|1164607_1166500_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.0	2.7e-153
WP_014569686.1|1166493_1166958_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	39.7	3.1e-23
WP_094515910.1|1167710_1168497_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096836218.1|1169412_1169922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157780095.1|1169922_1170099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_183406787.1|1170095_1170638_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	45.1	2.4e-30
WP_096836222.1|1170634_1171018_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_096836223.1|1171010_1171781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836225.1|1171770_1171992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836227.1|1172054_1172663_-	HNH endonuclease	NA	A0A126HDE2	Lactococcus_phage	30.6	9.5e-12
WP_096836229.1|1172972_1174205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836231.1|1175918_1176197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836232.1|1177068_1177377_-	hypothetical protein	NA	NA	NA	NA	NA
1176490:1176649	attR	ATGCGCGGTTCCACCCTACTTCAGATAGAAAAAACTACCTGCGGCTTCATCATTTGGTTCGAAAACGCCAATCACAACAACCGTTATCAGGCTTACACTTTCCCCGACTCGCTTTAATAGGTTTCGTTGCGACCCTTTTTCTCATCACCGATTCAATTTC	NA	NA	NA	NA
WP_094515910.1|1177408_1178196_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003602393.1|1178381_1178693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016377725.1|1178943_1179723_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003565663.1|1179722_1180625_-	GTPase Era	NA	NA	NA	NA	NA
WP_003570376.1|1180621_1181011_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_003565665.1|1181012_1181411_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_003565667.1|1181394_1181853_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_003602397.1|1181856_1182843_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	46.5	1.9e-49
WP_016386243.1|1183176_1183611_-	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
WP_003565673.1|1183639_1183816_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003565675.1|1184119_1184950_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_003602399.1|1184946_1185834_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	28.1	1.8e-22
WP_003565679.1|1185969_1186890_-	YitT family protein	NA	NA	NA	NA	NA
WP_003602400.1|1186981_1187434_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016386242.1|1187523_1189329_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	34.4	8.0e-06
WP_003594587.1|1189330_1190614_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016386241.1|1191133_1191460_+	inorganic diphosphatase	NA	NA	NA	NA	NA
WP_016386240.1|1193090_1193966_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	1.0e-22
WP_003602403.1|1194211_1194652_+	diadenosine tetraphosphate hydrolase-related HIT family hydrolase	NA	NA	NA	NA	NA
WP_003602405.1|1194790_1196113_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	32.2	8.4e-13
WP_011674532.1|1196185_1196812_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003565699.1|1196811_1197258_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_096836234.1|1197378_1199607_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	34.3	1.5e-06
WP_003602408.1|1199843_1200167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003590908.1|1200193_1200934_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003590917.1|1202129_1202624_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_018041523.1|1202620_1203226_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003575242.1|1203331_1203580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003602417.1|1203649_1204036_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003565717.1|1204498_1204681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003565719.1|1204680_1205067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032797982.1|1205246_1205735_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016378566.1|1206178_1206364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003602421.1|1207031_1207622_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003602423.1|1207614_1208181_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003565728.1|1211092_1211407_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_003575271.1|1211425_1211929_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	1417010	1427286	2710941	protease,transposase	Aichi_virus(16.67%)	9	NA	NA
WP_003602660.1|1417010_1418423_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.5	1.9e-26
WP_003602661.1|1418721_1420449_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	30.8	2.9e-21
WP_003566007.1|1420448_1420715_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003566008.1|1420858_1421050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658650.1|1421398_1423495_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.8	9.3e-115
WP_003570563.1|1423615_1423909_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_003597552.1|1423999_1424698_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.7	2.3e-22
WP_096836256.1|1424634_1425543_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.1	1.4e-11
WP_003566014.1|1425711_1427286_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.0	3.4e-29
>prophage 9
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	1497933	1588385	2710941	transposase,portal,integrase,holin,terminase,tRNA,capsid,tail,head	Lactobacillus_phage(64.91%)	111	1543525:1543551	1586826:1586852
WP_003573322.1|1497933_1499217_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	1.4e-84
WP_003599137.1|1499588_1501166_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003599138.1|1501426_1502956_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003602714.1|1503019_1504474_-	amino acid permease	NA	NA	NA	NA	NA
WP_016365770.1|1504987_1505131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566135.1|1505215_1505926_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003599140.1|1505984_1507661_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_003602715.1|1507972_1508524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599144.1|1508643_1509168_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016385913.1|1509770_1510805_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_003566145.1|1511102_1511678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003602719.1|1511740_1511890_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003588188.1|1512107_1512725_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.5	2.3e-58
WP_003599164.1|1512828_1513710_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003602720.1|1513843_1514653_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003599167.1|1514804_1515386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566163.1|1515609_1516035_+	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	35.8	1.4e-06
WP_003599172.1|1515988_1516831_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_003566168.1|1516823_1517519_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003599174.1|1517655_1519059_-	oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003602722.1|1519296_1519845_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_003602723.1|1519837_1521370_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_003566178.1|1521369_1522248_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_003566181.1|1522235_1522541_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_003599176.1|1522530_1523535_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_003566186.1|1523536_1523680_-	OadG family protein	NA	NA	NA	NA	NA
WP_016385912.1|1523853_1524978_-	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_016385911.1|1524992_1525391_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_016385910.1|1525396_1525723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003579853.1|1525821_1527171_-	citrate transporter	NA	NA	NA	NA	NA
WP_003566197.1|1527455_1527713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599179.1|1527786_1528353_-	RNA 2'-phosphotransferase	NA	G3MA21	Bacillus_virus	36.0	1.5e-19
WP_003599180.1|1528399_1528894_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003566203.1|1528908_1529526_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_003599181.1|1529788_1530127_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016385909.1|1530123_1530981_+	membrane protein	NA	NA	NA	NA	NA
WP_003599183.1|1531074_1531830_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016385907.1|1532455_1533373_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.2e-20
WP_016385906.1|1533359_1534976_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003599186.1|1534972_1535611_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012490951.1|1535735_1536734_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	2.5e-49
WP_016386109.1|1536817_1538227_-	MFS transporter	NA	NA	NA	NA	NA
WP_016386108.1|1538389_1539127_+	sulfite exporter TauE/SafE family protein	NA	Q6EVM7	Oenoccocus_phage	42.9	8.5e-47
WP_016386107.1|1539246_1540281_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003599206.1|1540365_1541217_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003566227.1|1541398_1541776_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003574021.1|1542154_1543075_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
1543525:1543551	attL	TACCGGTCATTCCCACTCAATCGTTGC	NA	NA	NA	NA
WP_096836274.1|1543658_1544030_+	acetyl-CoA carboxyl transferase	NA	NA	NA	NA	NA
WP_016378596.1|1544136_1545072_-	hypothetical protein	NA	Q8HA04	Enterobacteria_phage	36.5	1.5e-43
WP_096836275.1|1545232_1546285_-	peptidoglycan recognition protein	NA	A0A1B0Y4R9	Lactobacillus_phage	96.9	2.9e-202
WP_096836277.1|1546286_1546559_-|holin	holin	holin	Q9MCC7	Lactobacillus_phage	93.3	3.1e-39
WP_096836279.1|1546548_1546782_-	hypothetical protein	NA	U5U779	Lactobacillus_phage	72.4	6.8e-11
WP_096836281.1|1546774_1547152_-	hypothetical protein	NA	U5U712	Lactobacillus_phage	94.4	3.6e-62
WP_016386025.1|1547306_1547597_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	51.1	2.0e-20
WP_096836285.1|1547598_1550517_-|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	64.7	0.0e+00
WP_096836287.1|1550517_1552464_-|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	73.6	8.8e-269
WP_096836289.1|1552464_1555554_-	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	87.8	3.6e-264
WP_096836532.1|1555546_1555900_-	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	95.7	6.9e-55
WP_016376572.1|1556004_1556337_-|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	98.2	6.7e-52
WP_096836290.1|1556414_1557014_-|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	94.2	9.5e-97
WP_096836292.1|1557025_1557430_-	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	3.0e-70
WP_016377792.1|1557430_1557796_-	hypothetical protein	NA	A0A0P0I3G7	Lactobacillus_phage	90.9	2.4e-55
WP_096836294.1|1557792_1558095_-	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	90.0	1.6e-47
WP_096836296.1|1558099_1558474_-|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	95.2	2.0e-60
WP_096836298.1|1558473_1559352_-	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	83.2	2.6e-151
WP_084413647.1|1559420_1560467_-|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	97.6	3.8e-186
WP_096836300.1|1560480_1560795_-	hypothetical protein	NA	A0A0N7IR89	Lactobacillus_phage	94.2	4.7e-47
WP_096836302.1|1560807_1561446_-	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	95.8	1.8e-85
WP_096836305.1|1561563_1561926_-	hypothetical protein	NA	A0A141E1N9	Streptococcus_phage	56.0	9.0e-18
WP_096836306.1|1561942_1562383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836308.1|1562394_1563381_-|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	94.8	1.3e-175
WP_096836310.1|1563346_1564774_-|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	95.6	8.2e-256
WP_096836312.1|1564778_1566032_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	98.1	4.0e-246
WP_096836313.1|1566015_1566588_-|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.2	2.2e-79
WP_016385955.1|1566973_1568122_-	phage protein	NA	A0A0P0I3G0	Lactobacillus_phage	96.9	2.9e-219
WP_096836315.1|1568543_1568753_+	CsbD family protein	NA	NA	NA	NA	NA
WP_128517163.1|1568861_1569104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032797607.1|1569351_1569825_-	SocA family protein	NA	Q9AZG0	Lactococcus_phage	40.0	5.8e-25
WP_032797608.1|1570353_1570797_-	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	95.9	1.6e-77
WP_016365722.1|1571281_1571500_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	94.4	4.3e-31
WP_096836317.1|1571680_1572025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836319.1|1572025_1572391_-	hypothetical protein	NA	C1KFE9	Lactobacillus_virus	63.9	1.5e-33
WP_096836321.1|1572387_1572690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836322.1|1572686_1573058_-	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	49.2	1.4e-18
WP_096836324.1|1573047_1573260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836326.1|1573249_1573795_-	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	54.2	2.0e-37
WP_096836328.1|1573791_1573974_-	hypothetical protein	NA	A8YQM8	Lactobacillus_phage	86.7	1.4e-24
WP_096836329.1|1573970_1574753_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	94.9	3.8e-138
WP_032797610.1|1574749_1575001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686928.1|1575012_1575396_-	DUF1064 domain-containing protein	NA	B4XYT1	Lactobacillus_phage	89.0	1.2e-60
WP_096836331.1|1575398_1575848_-	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	81.9	9.0e-60
WP_032964570.1|1575844_1576060_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	67.1	2.6e-20
WP_096836333.1|1576367_1576853_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	89.4	1.1e-63
WP_096836335.1|1576864_1577827_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	92.8	1.4e-161
WP_096836337.1|1577838_1578603_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	55.2	3.9e-79
WP_045601324.1|1578622_1579489_-	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	53.6	5.1e-59
WP_096836339.1|1579502_1579673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080940780.1|1579674_1579917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003581994.1|1580035_1580362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836341.1|1580352_1580826_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011674683.1|1580888_1581047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040167039.1|1581135_1581336_+	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	50.0	5.3e-12
WP_155598324.1|1581332_1581482_-	hypothetical protein	NA	A0A1B0Y2Q8	Lactobacillus_phage	87.8	3.4e-16
WP_096836343.1|1581478_1581721_-	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	95.0	1.2e-34
WP_003574523.1|1581855_1582194_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	6.6e-55
WP_096836345.1|1582183_1582603_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	98.6	7.6e-77
WP_096836347.1|1582660_1583212_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_096836348.1|1583302_1584004_+	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	38.7	4.3e-24
WP_096836351.1|1584253_1585387_+	Abi family protein	NA	NA	NA	NA	NA
WP_096836353.1|1585503_1586667_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S8Y2	Streptococcus_phage	31.1	2.6e-42
WP_003566292.1|1586831_1588385_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
1586826:1586852	attR	TACCGGTCATTCCCACTCAATCGTTGC	NA	NA	NA	NA
>prophage 10
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	1645358	1680061	2710941	protease,tRNA,transposase	Pectobacterium_phage(14.29%)	24	NA	NA
WP_003570829.1|1645358_1646633_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.1	2.7e-85
WP_003566598.1|1647166_1648111_-	cation transporter	NA	NA	NA	NA	NA
WP_003566600.1|1648287_1648623_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003580097.1|1648797_1649727_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003600202.1|1650174_1651953_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_003600200.1|1652202_1654611_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.0	1.2e-12
WP_003602866.1|1654826_1656272_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_003602867.1|1656264_1657434_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_016378692.1|1657430_1658573_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_096836363.1|1658569_1660669_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_003602870.1|1661045_1662077_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_096836365.1|1662343_1663246_-	sortase	NA	NA	NA	NA	NA
WP_003580111.1|1663603_1664434_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.5	2.4e-18
WP_096836367.1|1664900_1665167_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_003574021.1|1665193_1666114_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003602889.1|1666129_1667887_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_003570841.1|1668320_1668722_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003602890.1|1669355_1671506_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.5	5.2e-121
WP_003602891.1|1671876_1672641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003602892.1|1672818_1673712_+	LCP family protein	NA	NA	NA	NA	NA
WP_049152602.1|1674847_1676266_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_096836369.1|1676351_1677770_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_080595781.1|1677814_1678723_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	4.9e-12
WP_096836371.1|1679044_1680061_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.9e-36
>prophage 11
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	1794671	1832367	2710941	bacteriocin,transposase	Staphylococcus_phage(40.0%)	28	NA	NA
WP_096836391.1|1794671_1795834_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	7.4e-29
WP_016386370.1|1796597_1797605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586222.1|1798677_1799418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025600146.1|1799587_1799803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836393.1|1800462_1801250_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003603074.1|1801577_1801697_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003603079.1|1802297_1803212_-	UPF0104 family protein	NA	NA	NA	NA	NA
WP_016385900.1|1804008_1804533_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011674296.1|1804633_1806136_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003603095.1|1806874_1807945_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003605762.1|1807970_1808885_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_003603101.1|1808960_1809929_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003603103.1|1810219_1811425_+	acetate kinase	NA	NA	NA	NA	NA
WP_003603106.1|1812021_1812909_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	6.7e-22
WP_096836394.1|1812911_1814183_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003566897.1|1814196_1814592_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003603108.1|1814581_1815448_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.8e-17
WP_003603109.1|1815440_1816085_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_003571168.1|1816192_1816978_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.5	1.0e-13
WP_003588501.1|1817606_1818728_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_003599602.1|1818740_1819760_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_003603118.1|1821886_1822243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836396.1|1822379_1823807_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_096836398.1|1823908_1825240_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003588511.1|1825445_1826864_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003599615.1|1827154_1827721_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096836400.1|1827965_1828982_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	2.2e-37
WP_096836402.1|1830951_1832367_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	1944362	2011167	2710941	protease,bacteriocin,tRNA,transposase	Bacillus_phage(16.67%)	55	NA	NA
WP_096836408.1|1944362_1945769_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.6	1.5e-52
WP_003603233.1|1946009_1947404_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003603234.1|1947529_1948117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576205.1|1948116_1948308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576207.1|1948783_1950277_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003588680.1|1950424_1951405_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003603236.1|1951520_1952192_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003603237.1|1952375_1953206_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003603238.1|1953352_1954192_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003603239.1|1954204_1955221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567242.1|1955227_1955602_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016371648.1|1955766_1957038_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_011674977.1|1958044_1959061_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_003603253.1|1959341_1960229_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	1.5e-34
WP_003567252.1|1960531_1961647_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_016386262.1|1961669_1963034_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|1963050_1963593_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|1963813_1964104_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|1964220_1964598_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003603256.1|1964842_1966162_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	7.0e-60
WP_003603257.1|1966520_1967867_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003599703.1|1968094_1969195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661801.1|1969191_1970388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567269.1|1970450_1971329_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003599714.1|1971490_1973545_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.6e-63
WP_016365316.1|1973701_1976332_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.0	1.6e-87
WP_003576237.1|1976493_1977117_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003603261.1|1977616_1978288_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003567280.1|1979931_1980216_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003588738.1|1980406_1981522_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|1981709_1981916_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|1982048_1982306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|1982376_1982583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603264.1|1983386_1984619_+	MFS transporter	NA	NA	NA	NA	NA
WP_003599729.1|1984697_1985954_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	5.6e-99
WP_003599730.1|1986042_1986876_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	7.3e-47
WP_003588746.1|1987192_1987387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571396.1|1987640_1988177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603266.1|1988365_1989589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599733.1|1989824_1990652_-	class C sortase	NA	NA	NA	NA	NA
WP_003603268.1|1990658_1992218_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_096836412.1|1992214_1993537_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_003567312.1|1998316_1998874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365506.1|1998968_2000165_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_016377825.1|2000373_2001429_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003599756.1|2001699_2002329_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
WP_003567322.1|2002464_2002794_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016386260.1|2002790_2003579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016385889.1|2003852_2005268_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_050555697.1|2005239_2006001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2006045_2006324_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003599758.1|2006347_2006632_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2007219_2008575_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2008880_2009192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603306.1|2009787_2011167_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
>prophage 13
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	2017889	2062123	2710941	protease,bacteriocin,transposase	Staphylococcus_phage(28.57%)	43	NA	NA
WP_003599800.1|2017889_2018063_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003591780.1|2018101_2018275_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567359.1|2018596_2018821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376287.1|2019622_2020435_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003599805.1|2020718_2020877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603316.1|2020992_2021349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836413.1|2021378_2022062_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.1e-59
WP_003599810.1|2022402_2022594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599812.1|2022907_2023243_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003599817.1|2024109_2024364_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003603326.1|2024924_2025878_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.9	2.8e-10
WP_012490951.1|2026098_2027097_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	2.5e-49
WP_096836415.1|2027192_2027936_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016386079.1|2027961_2029125_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003603330.1|2029300_2030677_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_032797705.1|2030809_2031568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599829.1|2031859_2033467_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003603333.1|2033854_2036572_+	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	28.5	1.7e-60
WP_003580900.1|2036871_2037237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599833.1|2037390_2038764_-	MFS transporter	NA	NA	NA	NA	NA
WP_003599835.1|2038803_2040333_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003567401.1|2040459_2040651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599837.1|2040779_2041418_+	cation transporter	NA	NA	NA	NA	NA
WP_003599840.1|2041438_2041771_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003603334.1|2041890_2042832_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016377718.1|2042828_2043725_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003599846.1|2043721_2044465_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.3e-15
WP_003599848.1|2044740_2046207_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003567416.1|2046407_2046677_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003567418.1|2046765_2046885_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003576335.1|2047085_2048003_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003599853.1|2048242_2048884_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003603337.1|2049001_2049634_-	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003599857.1|2049790_2050315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016386267.1|2052601_2053504_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567431.1|2053747_2053897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016378520.1|2054045_2055065_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003599864.1|2055145_2055559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032797876.1|2056609_2058973_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_016386265.1|2059308_2060070_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_080596464.1|2060237_2060552_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003597552.1|2060579_2061278_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.7	2.3e-22
WP_096836417.1|2061214_2062123_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	4.9e-12
>prophage 14
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	2201193	2267263	2710941	protease,tRNA,transposase	unidentified_phage(27.27%)	57	NA	NA
WP_003600190.1|2201193_2202210_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.6	6.4e-37
WP_003599974.1|2202361_2204344_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.1	1.1e-93
WP_003567758.1|2204422_2205301_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_003599976.1|2205509_2206322_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003599978.1|2206314_2206794_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003567764.1|2206937_2207843_-	L-2-hydroxyisocaproate dehydrogenase	NA	NA	NA	NA	NA
WP_003567766.1|2207870_2208479_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003576531.1|2208570_2209263_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003567770.1|2209546_2209693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836432.1|2209689_2210616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003581145.1|2210868_2211378_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003581148.1|2211453_2211732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567776.1|2211767_2212751_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003567778.1|2212968_2213910_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003585697.1|2213906_2216069_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_003599982.1|2216065_2217595_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003603471.1|2219198_2220023_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003585698.1|2220045_2220546_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567789.1|2220732_2222088_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003599986.1|2222302_2223163_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_003599988.1|2223171_2223780_-	LemA family protein	NA	NA	NA	NA	NA
WP_003567794.1|2223965_2224982_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003599990.1|2225400_2226726_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003599992.1|2226731_2227691_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	2.6e-27
WP_003599994.1|2227690_2229223_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003599996.1|2229756_2232045_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016377615.1|2232179_2233013_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003600000.1|2233037_2234009_-	TDT family transporter	NA	NA	NA	NA	NA
WP_003600002.1|2234444_2235089_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003600045.1|2235612_2236287_-	HD domain-containing protein	NA	S4W232	Pandoravirus	31.4	1.3e-14
WP_003600048.1|2236414_2236831_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003600050.1|2237043_2237211_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_003600052.1|2237211_2239572_+	hypothetical protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.2	5.9e-110
WP_003600054.1|2239637_2240642_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003603483.1|2240942_2241755_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003567827.1|2241817_2242162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567829.1|2242469_2242733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003600061.1|2243021_2243699_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_003567833.1|2243704_2244391_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003567836.1|2244435_2245248_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003600063.1|2245344_2245827_+	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	38.1	3.1e-21
WP_003567840.1|2245832_2246735_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003600064.1|2246984_2248187_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.5	1.6e-23
WP_003600065.1|2248491_2249685_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.3	5.5e-104
WP_003567846.1|2250085_2250784_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_003603493.1|2250941_2251415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836436.1|2251431_2252361_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	30.8	8.5e-20
WP_096836438.1|2253045_2255028_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003603502.1|2255031_2255961_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_003567854.1|2256086_2256839_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003600071.1|2256943_2258458_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_096836440.1|2259058_2260261_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.6	1.9e-88
WP_003601468.1|2260493_2261981_-	PTS galactitol IIC component	NA	NA	NA	NA	NA
WP_003600074.1|2262012_2262333_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003576630.1|2262364_2262844_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_096836436.1|2263562_2264492_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	30.8	8.5e-20
WP_016386247.1|2265847_2267263_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	2403418	2464217	2710941	protease,tRNA,transposase,holin	unidentified_phage(16.67%)	52	NA	NA
WP_096836465.1|2403418_2404435_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.9e-36
WP_096836466.1|2407262_2408348_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_096836468.1|2408491_2409691_-	amidohydrolase	NA	NA	NA	NA	NA
WP_003568415.1|2409687_2410176_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003568534.1|2410177_2410942_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003572790.1|2411574_2413476_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003572791.1|2413517_2414906_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003600670.1|2415419_2416184_-	protein jag	NA	NA	NA	NA	NA
WP_003572795.1|2416201_2417038_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_012492235.1|2417182_2417539_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003568442.1|2417865_2418006_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003568444.1|2418813_2420163_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003600672.1|2420335_2421475_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.1	5.0e-14
WP_003568449.1|2422052_2422265_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003600282.1|2422261_2423377_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003600283.1|2423629_2425591_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.4	2.8e-145
WP_016385862.1|2425652_2428274_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	33.5	4.9e-113
WP_003600673.1|2428378_2429083_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003568458.1|2429265_2429697_+	single-stranded DNA-binding protein	NA	A0A2I2MUI5	uncultured_Caudovirales_phage	46.9	1.3e-26
WP_003568460.1|2429824_2430121_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016378371.1|2430151_2430760_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	67.8	4.2e-52
WP_003568467.1|2430846_2431083_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003600674.1|2431523_2433002_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003600287.1|2434039_2434234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836470.1|2434660_2435581_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	6.9e-22
WP_003600703.1|2435726_2436029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577228.1|2436428_2437664_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003596885.1|2437867_2440441_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003596886.1|2440453_2441155_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_003592429.1|2441451_2442003_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003596889.1|2442046_2442853_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003577235.1|2444928_2445702_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003600709.1|2445879_2446485_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568507.1|2446608_2447502_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003568509.1|2447550_2448189_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|2448417_2449794_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003596899.1|2450016_2450361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|2450436_2450796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016386168.1|2451036_2452479_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003600713.1|2452673_2453303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836472.1|2453613_2454775_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.9e-29
WP_003562592.1|2454943_2455606_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096836474.1|2455605_2456535_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|2456546_2457176_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003596965.1|2457178_2458432_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003596967.1|2459052_2459706_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016378075.1|2459771_2459993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596968.1|2460116_2460302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016385767.1|2460338_2462195_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.7	3.2e-66
WP_003562606.1|2462214_2462442_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003596972.1|2462589_2463174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836470.1|2463296_2464217_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	6.9e-22
>prophage 16
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	2472365	2525802	2710941	transposase	unidentified_phage(33.33%)	52	NA	NA
WP_096836083.1|2472365_2473784_+|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_096836476.1|2473785_2474013_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003597003.1|2474005_2474461_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003600738.1|2475033_2475747_-	SMUG2 DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_016386111.1|2476083_2477223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597008.1|2477860_2478049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003600742.1|2478165_2479995_-	MFS transporter	NA	NA	NA	NA	NA
WP_003572955.1|2480153_2480732_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003597012.1|2480871_2481246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836541.1|2481229_2481934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674296.1|2481981_2483484_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003585300.1|2483584_2483938_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003585301.1|2483912_2484110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597016.1|2484461_2485694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597018.1|2485698_2486613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597020.1|2486609_2487296_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	3.8e-25
WP_011674296.1|2488066_2489569_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003585300.1|2489669_2490023_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003585301.1|2489997_2490195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597022.1|2490430_2490829_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003597024.1|2490791_2491061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597025.1|2491210_2491978_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003600754.1|2491974_2492880_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_096836479.1|2492972_2494124_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003572973.1|2494131_2494836_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_003600756.1|2494846_2496193_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003597032.1|2496906_2498286_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003592633.1|2498287_2499295_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003597036.1|2499298_2500357_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003562673.1|2500552_2500930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016378678.1|2501304_2501508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597037.1|2502082_2502496_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003600759.1|2502488_2503355_+	DMT family transporter	NA	NA	NA	NA	NA
WP_096835977.1|2503503_2504424_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
WP_003574021.1|2504819_2505740_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_096836481.1|2506085_2507504_+|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_016378584.1|2507564_2507912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562684.1|2508610_2510617_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003562688.1|2510632_2511088_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_096836483.1|2511701_2512718_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_016386095.1|2513059_2514895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100223497.1|2514985_2516179_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_096836485.1|2516074_2516862_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016386172.1|2517111_2518389_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.9e-49
WP_016378972.1|2518512_2518728_-	acetyltransferase	NA	NA	NA	NA	NA
WP_003597469.1|2519084_2519654_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039639870.1|2519661_2522607_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003597463.1|2522697_2522922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836487.1|2523052_2523840_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071799137.1|2523867_2524311_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_096836489.1|2524645_2525509_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	1.4e-24
WP_079322958.1|2525505_2525802_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP017261	Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome	2710941	2544818	2602836	2710941	transposase	Acanthamoeba_polyphaga_mimivirus(11.11%)	47	NA	NA
WP_096836543.1|2544818_2545606_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016386247.1|2546918_2548334_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096836495.1|2548534_2549950_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003600819.1|2550202_2550439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016378753.1|2550672_2552034_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003597101.1|2552757_2553042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003600825.1|2553508_2554489_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003600831.1|2554705_2555782_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_003562754.1|2556003_2556255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003600832.1|2556408_2557482_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003562762.1|2557655_2558147_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	39.7	2.6e-15
WP_003573025.1|2558213_2559215_+	D-2-hydroxyisocaproate dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	34.5	1.8e-47
WP_003577355.1|2559297_2559594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003573029.1|2559755_2560262_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096836496.1|2560372_2561305_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003600836.1|2561429_2561792_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_004469170.1|2562011_2562362_-	YisL family protein	NA	NA	NA	NA	NA
WP_096836499.1|2562430_2563447_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	4.2e-36
WP_003597113.1|2563748_2565206_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	28.7	9.8e-39
WP_003600855.1|2565346_2565670_+	DsrE family protein	NA	NA	NA	NA	NA
WP_016386298.1|2565741_2566716_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_003562796.1|2566908_2567205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597119.1|2567459_2568035_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096836501.1|2568377_2570432_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_016378570.1|2570809_2571583_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003597129.1|2572601_2573681_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_003562813.1|2573905_2574139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597134.1|2574135_2575596_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003597136.1|2575736_2576723_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_096836502.1|2576825_2578058_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.3	1.6e-10
WP_003573065.1|2578253_2578583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003598946.1|2578763_2580110_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.4	5.1e-90
WP_003583008.1|2580167_2581358_+	acetate kinase	NA	NA	NA	NA	NA
WP_003598943.1|2581458_2582283_-	serine/threonine protein phosphatase	NA	A8AT52	Listeria_phage	29.5	1.2e-12
WP_003598941.1|2582498_2583227_+	endonuclease III domain protein	NA	NA	NA	NA	NA
WP_016385897.1|2584294_2585554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096836506.1|2587135_2588551_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016386172.1|2590243_2591521_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.9e-49
WP_003600905.1|2591747_2592881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003600903.1|2593040_2593508_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014566722.1|2593556_2593766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016378115.1|2593771_2594047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003600902.1|2594451_2596077_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003600901.1|2596320_2598702_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_003597152.1|2598961_2599108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597148.1|2601077_2601677_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096836507.1|2601673_2602836_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	9.6e-29
>prophage 1
NZ_CP017262	Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.21, complete sequence	62971	9251	41531	62971	holin,transposase	Staphylococcus_phage(25.0%)	36	NA	NA
WP_011674169.1|9251_9356_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_016372359.1|9511_9901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587058.1|9903_10047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587060.1|10039_10489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003570626.1|10502_10793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016374048.1|10802_11249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836562.1|11915_12275_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096836565.1|12452_13240_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_021353390.1|13645_13735_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_016377529.1|14201_15551_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.1	7.8e-123
WP_071799104.1|15592_15787_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096836569.1|16134_16921_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096836571.1|16908_17232_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003589800.1|17575_18454_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_050894538.1|18574_20308_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003589794.1|20334_21759_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_003589792.1|21807_22143_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_096836575.1|22677_23483_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002819966.1|23544_23829_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_096836579.1|23834_24485_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.1e-18
WP_016377587.1|24882_25140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018041603.1|26386_26545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016364943.1|26546_26729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022669498.1|27002_27686_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	3.6e-60
WP_003625288.1|27940_28219_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_016386159.1|28208_28511_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003573999.1|28526_29945_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_096836592.1|30441_31065_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_022669498.1|31422_32106_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	3.6e-60
WP_096836594.1|32127_32844_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_016386086.1|32895_34548_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003597659.1|34561_36574_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_096836470.1|37410_38331_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	4.5e-37
WP_096836596.1|38517_39381_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_016377556.1|39811_40561_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	44.0	2.1e-45
WP_096836598.1|40601_41531_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
>prophage 1
NZ_CP017264	Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.23, complete sequence	83229	8997	68399	83229	transposase,holin,bacteriocin	Staphylococcus_phage(25.0%)	53	NA	NA
WP_079322958.1|8997_9294_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096836680.1|9290_10154_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.1	6.9e-24
WP_010493218.1|12915_13020_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_049146552.1|13174_13564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019875541.1|13863_14745_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_011674173.1|14761_15121_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_019875535.1|16014_16245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049146560.1|16861_18796_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_012807366.1|18795_19233_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012807367.1|19246_19567_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_012807368.1|19581_20709_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_096836683.1|20711_23306_+	glycosyl hydrolase family 38	NA	NA	NA	NA	NA
WP_012807370.1|23427_24291_+	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_183406792.1|25342_25639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016381850.1|26337_28053_+	site-specific DNA-methyltransferase	NA	S5VTV9	Campylobacter_phage	34.5	2.9e-42
WP_016381849.1|28057_30667_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_003577187.1|31003_32419_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_060612723.1|32584_34000_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	25.6	6.0e-09
WP_050569250.1|34053_36123_+	DEAD/DEAH box helicase family protein	NA	E5EQY5	Bathycoccus_sp._RCC1105_virus	27.4	1.2e-18
WP_049162374.1|36240_36813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016381847.1|36954_37494_+	helix-turn-helix domain-containing protein	NA	A0A139ZPK3	Marinitoga_camini_virus	49.2	9.7e-08
WP_016381846.1|37793_38129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096836686.1|39997_42070_+	family 31 glucosidase	NA	NA	NA	NA	NA
WP_016381843.1|42069_42855_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016381842.1|42847_43660_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_016381841.1|43675_44161_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_016381840.1|44175_44586_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_016381839.1|44634_45804_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_002816607.1|46044_46728_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_032766659.1|47757_48342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603542.1|48362_48842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663168.1|48854_50249_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003603544.1|50230_50542_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_162137657.1|51292_51541_+|bacteriocin	class IIc cyclic bacteriocin	bacteriocin	NA	NA	NA	NA
WP_016377575.1|51614_52112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018041653.1|52127_52625_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003603547.1|53242_54412_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003603548.1|54411_55092_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	7.1e-32
WP_003603550.1|55088_56144_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_016377574.1|56448_56946_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_018041624.1|57234_57333_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002816607.1|57980_58664_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_045137359.1|58791_59025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012778337.1|59045_59777_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.7	6.1e-13
WP_096836689.1|59778_60600_-	cobalt ABC transporter permease	NA	NA	NA	NA	NA
WP_016377519.1|60574_61561_-	cobalt transporter CbiM	NA	NA	NA	NA	NA
WP_045137360.1|61575_62241_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641711.1|62493_63768_+	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_096836692.1|63769_64510_+	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	47.2	4.7e-21
WP_029327658.1|64540_65803_+	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_003643656.1|65807_66524_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	33.6	4.1e-22
WP_014566892.1|66548_67379_+	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_096836695.1|67715_68399_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	1.6e-60
>prophage 1
NZ_CP017266	Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.25, complete sequence	47078	0	10662	47078	transposase	Lactobacillus_phage(66.67%)	5	NA	NA
WP_191982459.1|861_7935_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_096836724.1|8259_8511_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	3.5e-37
WP_123018149.1|8672_9695_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.2	2.6e-126
WP_080555491.1|9694_9892_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096836653.1|9978_10662_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.8e-59
>prophage 2
NZ_CP017266	Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.25, complete sequence	47078	15524	17978	47078	transposase	Lactococcus_phage(50.0%)	2	NA	NA
WP_096836728.1|15524_16436_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.0	1.0e-57
WP_050894563.1|17048_17978_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
>prophage 3
NZ_CP017266	Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.25, complete sequence	47078	28966	29848	47078		Enterococcus_phage(100.0%)	1	NA	NA
WP_003582592.1|28966_29848_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.6	5.0e-38
>prophage 4
NZ_CP017266	Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.25, complete sequence	47078	33621	39755	47078	transposase	Staphylococcus_prophage(50.0%)	5	NA	NA
WP_096836465.1|33621_34638_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.5	1.9e-33
WP_003600616.1|35532_36042_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_096836738.1|36242_37163_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	3.4e-37
WP_096836740.1|37276_38452_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
WP_002816607.1|39071_39755_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
>prophage 5
NZ_CP017266	Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.25, complete sequence	47078	44212	45388	47078	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003561746.1|44212_45388_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
