The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	80606	122404	2740566	tRNA,transposase	uncultured_Caudovirales_phage(22.22%)	34	NA	NA
WP_002298563.1|80606_81353_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002298562.1|82311_83118_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002324277.1|83240_83609_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002317769.1|83705_84878_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000997695.1|85296_86475_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002317041.1|86706_87045_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_002301170.1|87041_87581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730438.1|87692_88352_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002324522.1|88420_89329_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002298555.1|89451_92121_-	YfhO family protein	NA	NA	NA	NA	NA
WP_002290463.1|92358_92547_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002294298.1|92816_93179_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002298554.1|93230_94913_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002294296.1|95029_97066_+	ATP-dependent DNA helicase RecG	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	23.1	3.1e-06
WP_002289721.1|97114_98116_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002294295.1|98237_98480_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002297293.1|98858_100046_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002287889.1|100367_101372_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	5.1e-18
WP_002297777.1|101372_102317_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.9e-20
WP_002287892.1|102316_103279_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287893.1|103305_104220_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002297779.1|104245_106027_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096948707.1|106175_107471_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.7	5.5e-09
WP_002287896.1|107896_108583_+	ribonuclease III	NA	K7YH73	Megavirus	32.3	9.1e-27
WP_002317044.1|108602_112184_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002317045.1|112192_113002_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002317046.1|113013_114012_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_002307330.1|114197_116465_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002287902.1|116552_117005_-	YueI family protein	NA	NA	NA	NA	NA
WP_002297787.1|117154_118105_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	5.6e-67
WP_002317047.1|118097_119057_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002297790.1|119053_119809_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.2e-13
WP_002317048.1|119831_120785_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002333851.1|121450_122404_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	204376	263281	2740566	tRNA,holin,transposase	uncultured_Mediterranean_phage(25.0%)	52	NA	NA
WP_002317082.1|204376_205552_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.3e-17
WP_002296565.1|205744_206776_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002294185.1|210201_210900_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002294183.1|211116_212262_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002300794.1|212358_212739_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_002326248.1|213078_214398_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	1.1e-209
WP_002294180.1|214726_217324_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002325884.1|217677_218631_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002333852.1|218554_218743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317085.1|218895_220356_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_002317086.1|220352_221609_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_002288248.1|221622_222468_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_002317087.1|222469_222781_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_002317088.1|222862_224014_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_002294170.1|224140_224899_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288242.1|224998_225643_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002298306.1|225649_226657_+	sugar kinase	NA	NA	NA	NA	NA
WP_002298305.1|226672_227515_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002317093.1|228585_229650_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002288233.1|229646_230732_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_002317094.1|230744_231722_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_002288231.1|231714_232659_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_002307422.1|232974_233634_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	51.8	1.9e-58
WP_002294163.1|233718_234624_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002294161.1|234625_235258_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002293357.1|235577_236102_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
WP_002289309.1|236173_236374_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002289310.1|236426_236786_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002317096.1|237037_238375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324306.1|238422_240552_+	hydantoinase/oxoprolinase	NA	NA	NA	NA	NA
WP_002317098.1|240526_241216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289316.1|241526_242213_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002377012.1|242348_242543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289317.1|242592_243033_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002317100.1|243036_243882_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002294157.1|244030_245449_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002324311.1|245505_245796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317103.1|246311_247268_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002317104.1|247439_247793_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002317105.1|247991_249071_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002317106.1|249362_249683_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002317107.1|249712_250180_+	universal stress protein	NA	NA	NA	NA	NA
WP_002317108.1|250489_251095_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_002324312.1|251152_252436_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	6.7e-23
WP_002317110.1|252888_253368_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_086956687.1|253742_254905_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002317111.1|255115_256246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010778368.1|256413_257322_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002317112.1|257408_258263_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002317113.1|258359_260609_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002317114.1|260611_261784_+	MFS transporter	NA	NA	NA	NA	NA
WP_002326248.1|261961_263281_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	1.1e-209
>prophage 3
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	671584	680056	2740566		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|671584_672229_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|672243_672573_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_002288071.1|672586_673525_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|673560_674385_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|674377_674725_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|674793_675666_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|675774_676896_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|676949_677552_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|677866_680056_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 4
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	733066	828042	2740566	tRNA,protease,capsid,integrase,head,holin,tail,portal,transposase,terminase	Enterococcus_phage(22.73%)	109	790172:790187	793524:793539
WP_002286621.1|733066_735865_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|735913_737440_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|737454_738102_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|738285_738615_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|738791_739520_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002317177.1|739535_740549_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|740548_741826_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|741888_744591_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|744742_745060_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|745089_745410_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|745517_746978_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|747045_747267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|747297_747480_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|747479_747893_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|748015_749197_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286676.1|749267_749432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286587.1|749727_750867_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|751165_751801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|751913_752549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|752582_753044_-	SHOCT domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|753173_753605_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|753622_753943_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|754241_755018_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|755032_755236_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|755251_755590_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|755576_755756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|755798_756269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|756355_757054_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|757231_757573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|757565_758237_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|758242_758929_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|758931_759681_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|759692_759962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|759966_760131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|760123_760426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|760422_760584_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|760580_760886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|760885_761242_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002322165.1|761228_761447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|761443_761863_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|761859_762417_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|762413_762710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|762786_763200_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002296602.1|763508_763661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300143.1|763657_763933_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|764386_764593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|764788_764956_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|764981_765326_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|765330_765612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|765714_766029_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|766006_767701_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|767720_768899_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|768861_769548_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|769547_770708_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|770717_771593_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|771589_771901_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|771890_772244_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|772233_772635_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|772627_773032_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|773043_773652_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|773671_774034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286502.1|774235_777667_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002297218.1|777752_779048_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_069972676.1|779239_779977_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002296595.1|779986_782278_+|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.0	1.6e-88
WP_002286495.1|782301_784428_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002290627.1|784444_784594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286491.1|784590_785037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290625.1|785038_785176_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002349644.1|785213_785507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|785503_785728_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002286484.1|785724_786750_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|787689_788851_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|789774_790182_+	hypothetical protein	NA	NA	NA	NA	NA
790172:790187	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|790195_790597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|790598_790970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|791557_791758_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286469.1|792062_793295_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|793548_794118_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
793524:793539	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002286465.1|794295_794736_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|794893_795658_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|795689_796613_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|796688_797828_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|797820_798621_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|798620_799448_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|799425_800160_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|800259_801126_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|801139_801712_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002296544.1|801733_802762_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.2	2.2e-69
WP_002294531.1|802859_803711_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.3e-38
WP_002296543.1|803745_805779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296542.1|805822_807103_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002289081.1|807312_808119_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296541.1|808130_809351_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	3.3e-11
WP_002296539.1|809340_810927_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002296538.1|810965_813104_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002297271.1|813171_814131_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002295430.1|814465_815857_+	sugar transferase	NA	NA	NA	NA	NA
WP_002321510.1|815915_816719_+	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.5	5.1e-13
WP_002312566.1|816751_817606_+	LicD family protein	NA	NA	NA	NA	NA
WP_002297058.1|817602_818304_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002321509.1|818311_819379_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002297060.1|819371_820337_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	34.6	2.5e-06
WP_002297061.1|820381_821356_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	35.2	2.5e-06
WP_002297062.1|821378_822914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321507.1|822970_824086_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002297064.1|824082_825498_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002297065.1|825530_826478_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	38.2	2.3e-52
WP_002288571.1|826596_828042_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.2e-125
>prophage 5
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	1114427	1123488	2740566		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1114427_1115723_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1115902_1116280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1116535_1117264_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1117263_1117518_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1117519_1118191_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1118191_1120414_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1120398_1121838_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288011.1|1121860_1122913_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1122909_1123488_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 6
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	1538247	1697609	2740566	tRNA,protease,capsid,integrase,head,holin,tail,portal,transposase,plate,terminase	Streptococcus_phage(14.04%)	169	1600353:1600371	1696982:1696997
WP_002294466.1|1538247_1538730_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_002294467.1|1538879_1539248_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_002296526.1|1539712_1540165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288523.1|1540288_1541140_-	sugar transporter	NA	NA	NA	NA	NA
WP_002288522.1|1541152_1541938_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002288521.1|1542289_1543231_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_002288520.1|1543234_1544158_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002288514.1|1547334_1547508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288513.1|1547664_1548012_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002288511.1|1548038_1550345_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1550357_1550669_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1550665_1550959_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002288500.1|1550980_1552156_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1552178_1552652_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002288497.1|1552796_1557155_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.9e-21
WP_002288495.1|1557366_1559076_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002288494.1|1559143_1560412_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002296531.1|1560572_1561373_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1561369_1562182_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002293875.1|1562376_1562934_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1562936_1563659_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1563794_1564676_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1564774_1565557_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1565915_1566395_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1566611_1567703_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002296514.1|1567695_1567824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1567827_1568373_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1568826_1570518_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1570937_1571885_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1571999_1573019_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1573109_1574339_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1574799_1575501_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288444.1|1576109_1577126_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	7.1e-60
WP_002288445.1|1577122_1577587_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288446.1|1577593_1578136_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1578119_1578944_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1579032_1580013_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1580036_1581521_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1581532_1582522_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1582769_1582937_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1582998_1584810_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1584806_1585172_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1585334_1585730_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1585747_1586710_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1586709_1586922_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1586942_1587641_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1587660_1588203_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002296124.1|1588334_1589339_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002320813.1|1589335_1590325_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1590321_1591128_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|1591293_1592250_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1592326_1592845_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1592932_1593082_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1593309_1593756_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1593950_1595846_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002288571.1|1596120_1597566_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.2e-125
WP_000997695.1|1598193_1599372_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
1600353:1600371	attL	CAGCTTCTTCACAACCTCT	NA	NA	NA	NA
WP_086953915.1|1600885_1602224_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
1600353:1600371	attL	CAGCTTCTTCACAACCTCT	NA	NA	NA	NA
WP_069972698.1|1602264_1603284_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	68.6	7.1e-60
WP_002302122.1|1603294_1603492_-|holin	phage holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	7.8e-24
WP_069972697.1|1603514_1603808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331002.1|1603844_1603982_-	XkdX family protein	NA	NA	NA	NA	NA
WP_069972696.1|1603983_1604430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317324.1|1604430_1606497_-|plate	BppU family phage baseplate upper protein	plate	A0A096XSZ6	Enterococcus_phage	47.0	1.4e-86
WP_002349645.1|1606496_1607279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025476995.1|1607295_1609053_-|plate	BppU family phage baseplate upper protein	plate	Q9AZ56	Lactococcus_phage	46.1	3.2e-36
WP_069972695.1|1609027_1611733_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q9AZX5	Lactococcus_phage	40.4	5.0e-169
WP_002349218.1|1611729_1612434_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069972694.1|1612445_1614755_-|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	49.0	1.2e-83
WP_047649774.1|1614949_1615414_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	41.0	5.7e-17
WP_002353259.1|1615413_1616040_-|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.0	1.7e-27
WP_002353260.1|1616046_1616412_-	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	41.1	7.7e-17
WP_002353261.1|1616401_1616740_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	46.8	6.6e-23
WP_002303041.1|1616729_1617056_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002301326.1|1617036_1617315_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	3.5e-22
WP_069972693.1|1617316_1618678_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.6	4.9e-125
WP_033655421.1|1618690_1619260_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	72.2	3.2e-70
WP_002353265.1|1619231_1620419_-|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	66.0	2.7e-143
WP_002353266.1|1620482_1622210_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.0	7.1e-262
WP_069972692.1|1622206_1622659_-|terminase	terminase small subunit	terminase	A0A2H4JFK0	uncultured_Caudovirales_phage	69.2	3.6e-48
WP_002304435.1|1622770_1623151_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_069972691.1|1623147_1623534_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	35.8	5.6e-10
WP_069972690.1|1623514_1623901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972689.1|1623961_1624258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972688.1|1624576_1625053_-	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	51.6	2.2e-27
WP_069972687.1|1625309_1625999_+	hypothetical protein	NA	Q7Y4L3	Streptococcus_phage	40.1	2.7e-31
WP_069972686.1|1626098_1626665_-	DUF1642 domain-containing protein	NA	D2IZL3	Enterococcus_phage	32.8	2.8e-18
WP_002286547.1|1626661_1627081_-	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002322165.1|1627077_1627296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972685.1|1627282_1627639_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	4.0e-10
WP_002326231.1|1627638_1627929_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	43.4	1.1e-13
WP_002311435.1|1627922_1628228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172864997.1|1628220_1628385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002338904.1|1628389_1628659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286552.1|1628670_1629420_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_096948709.1|1629422_1630109_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	68.6	9.2e-88
WP_010738857.1|1630114_1630786_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.8	5.5e-29
WP_038809834.1|1630778_1631120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096948710.1|1631297_1631996_-	ORF6C domain-containing protein	NA	D2IYT0	Enterococcus_phage	33.8	3.9e-25
WP_163299668.1|1632608_1632761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016631437.1|1632764_1632935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317757.1|1632939_1633260_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_010722429.1|1633275_1633458_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	55.0	1.1e-11
WP_002315392.1|1633760_1634135_+	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	38.7	3.2e-18
WP_002350678.1|1634139_1634568_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_069972682.1|1634617_1635271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060789858.1|1635409_1635850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972681.1|1635987_1637193_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	7.3e-64
WP_002296332.1|1637476_1638043_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|1638298_1639630_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1639595_1639946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296336.1|1640037_1640457_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296337.1|1640457_1640802_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002325884.1|1641073_1642027_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287776.1|1642218_1642815_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1642938_1644738_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1645015_1645228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293931.1|1645689_1645839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1646091_1647051_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002288571.1|1648105_1649551_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.2e-125
WP_002288573.1|1649774_1650161_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002297218.1|1650343_1651639_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288574.1|1651990_1653337_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1653448_1654798_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1654914_1656168_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1656238_1656724_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1656746_1657505_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1657520_1658699_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002288584.1|1658928_1661049_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.1	2.8e-220
WP_002296838.1|1661271_1661997_+	hypothetical protein	NA	NA	NA	NA	NA
1661150:1661168	attR	CAGCTTCTTCACAACCTCT	NA	NA	NA	NA
WP_002288586.1|1661986_1662496_+	hypothetical protein	NA	NA	NA	NA	NA
1661150:1661168	attR	CAGCTTCTTCACAACCTCT	NA	NA	NA	NA
WP_002288588.1|1662566_1664015_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1664014_1664731_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1664711_1665062_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1665205_1665979_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1666735_1667038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1667241_1668420_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002323892.1|1669528_1669843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1669959_1671138_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321263.1|1671201_1671669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289620.1|1671873_1673538_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002289619.1|1673550_1674261_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289618.1|1674390_1674888_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289617.1|1675072_1675333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|1675694_1675934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1676270_1677449_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321035.1|1677532_1677748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303949.1|1677757_1678573_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002297218.1|1678953_1680249_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288989.1|1680356_1680800_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1680933_1681272_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288986.1|1681259_1681637_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288985.1|1681860_1683054_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1683219_1683642_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002321037.1|1684036_1684231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288983.1|1684227_1684722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1684883_1686056_-	class C sortase	NA	NA	NA	NA	NA
WP_002311687.1|1686261_1687077_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288979.1|1687226_1687673_-	cell wall anchor	NA	NA	NA	NA	NA
WP_158003446.1|1687669_1688674_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002352916.1|1688713_1689043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305732.1|1689168_1691496_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288970.1|1692338_1692632_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|1693034_1694213_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002300928.1|1694316_1694631_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|1694737_1694953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|1695252_1695495_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002311683.1|1695481_1695910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299190.1|1696061_1697609_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	1711519	1774266	2740566	tRNA,transposase	Streptococcus_phage(53.33%)	57	NA	NA
WP_087040414.1|1711519_1712682_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002305710.1|1712774_1713284_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002325884.1|1713622_1714576_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|1714528_1714765_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289051.1|1715184_1716306_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002321361.1|1716633_1718043_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289053.1|1718039_1718768_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002289055.1|1718895_1719807_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289057.1|1719823_1720831_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289059.1|1720827_1722957_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
WP_002296840.1|1723257_1724445_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002321772.1|1724537_1726883_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002288938.1|1726869_1727259_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002297208.1|1727308_1728205_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288935.1|1728207_1730055_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002288934.1|1730151_1730652_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_033657400.1|1730664_1730889_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002286940.1|1730992_1732903_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_002305703.1|1733648_1733786_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286934.1|1733782_1734967_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002286933.1|1735222_1735477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286932.1|1735501_1736644_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_024265279.1|1736703_1736955_-	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	73.0	7.6e-24
WP_002297361.1|1737048_1738908_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_024265280.1|1739622_1740768_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	63.0	4.3e-130
WP_002286928.1|1740838_1741183_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002286926.1|1741192_1741567_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286925.1|1741579_1741894_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286924.1|1742007_1745235_-	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002286921.1|1745313_1745976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286913.1|1746348_1746696_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1746831_1747593_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1747582_1748104_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1748273_1749065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1749189_1749441_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1749452_1749728_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1749980_1750535_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1750613_1751135_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_069972679.1|1751138_1751717_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1751828_1753247_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1753267_1753606_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002293705.1|1754198_1754903_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297195.1|1754899_1756636_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1756738_1759210_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_096948711.1|1759481_1760750_+|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.4	5.0e-55
WP_002296623.1|1760855_1762151_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289807.1|1762553_1763444_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002289809.1|1763640_1764123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1764330_1764696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1764786_1765104_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002296840.1|1765364_1766552_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_096948707.1|1767374_1768670_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.7	5.5e-09
WP_002287105.1|1768825_1769800_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002287107.1|1770209_1771460_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1771745_1772003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305693.1|1772234_1772666_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_086953915.1|1772926_1774266_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 8
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	1996169	2001842	2740566	capsid,head,tail,portal,terminase	uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_002296483.1|1996169_1996505_-|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
WP_002296484.1|1996491_1996776_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296485.1|1996831_1998355_-|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296486.1|1998347_1999523_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002317249.1|1999526_1999712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296487.1|1999677_2001372_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002296488.1|2001368_2001842_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
>prophage 9
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	2223268	2271699	2740566	capsid,protease,integrase,head,holin,tail,portal,transposase,plate,terminase	Enterococcus_phage(30.77%)	74	2224870:2224888	2268853:2268871
WP_002296840.1|2223268_2224456_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
2224870:2224888	attL	TACATCATACCGCCCATCA	NA	NA	NA	NA
WP_002293622.1|2225075_2225297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|2225647_2226019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|2226020_2226422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|2226435_2226843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|2227765_2228928_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286484.1|2229867_2230893_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_002286683.1|2230889_2231114_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002349644.1|2231110_2231404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290625.1|2231441_2231579_-	XkdX family protein	NA	NA	NA	NA	NA
WP_069972703.1|2231580_2232027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317324.1|2232027_2234094_-|plate	BppU family phage baseplate upper protein	plate	A0A096XSZ6	Enterococcus_phage	47.0	1.4e-86
WP_002349645.1|2234093_2234876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025476995.1|2234892_2236650_-|plate	BppU family phage baseplate upper protein	plate	Q9AZ56	Lactococcus_phage	46.1	3.2e-36
WP_002317183.1|2236624_2239456_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8BMB8	Lactococcus_phage	59.7	0.0e+00
WP_002311466.1|2239452_2240220_-|tail	phage tail family protein	tail	D7RWD9	Brochothrix_phage	45.5	1.2e-59
WP_002311465.1|2240252_2243372_-|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	79.2	1.8e-167
WP_002318903.1|2243388_2243676_-	hypothetical protein	NA	D7RWD7	Brochothrix_phage	44.3	2.4e-13
WP_002293018.1|2243729_2244098_-	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	54.8	8.6e-24
WP_002311463.1|2244143_2244656_-|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	66.3	7.4e-58
WP_002311462.1|2244666_2245059_-	hypothetical protein	NA	Q77K20	Lactococcus_phage	76.2	2.2e-49
WP_002311461.1|2245055_2245427_-	HK97 gp10 family phage protein	NA	Q77K21	Lactococcus_phage	51.2	6.8e-29
WP_002311460.1|2245423_2245750_-	hypothetical protein	NA	A0A1P8BMJ2	Lactococcus_phage	50.5	8.1e-18
WP_002311459.1|2245746_2246085_-|head,tail	phage head-tail connector protein	head,tail	A0A097BY74	Leuconostoc_phage	40.4	3.8e-10
WP_002311458.1|2246124_2246331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311457.1|2246341_2247349_-|capsid	major capsid protein	capsid	C9E2J5	Enterococcus_phage	86.2	5.4e-161
WP_002311456.1|2247373_2247727_-	hypothetical protein	NA	C9E2J4	Enterococcus_phage	73.5	6.7e-42
WP_002311455.1|2247738_2248380_-	DUF4355 domain-containing protein	NA	C9E2J3	Enterococcus_phage	48.1	2.4e-37
WP_002311453.1|2248494_2248677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311451.1|2249014_2249968_-|capsid	minor capsid protein	capsid	Q9AZ64	Lactococcus_phage	65.8	2.7e-114
WP_002311450.1|2249972_2250236_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	54.0	3.2e-17
WP_002318892.1|2250248_2250479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311447.1|2250432_2252067_-|portal	phage portal protein	portal	C9E2I8	Enterococcus_phage	61.4	1.3e-185
WP_002311446.1|2252077_2253376_-|terminase	PBSX family phage terminase large subunit	terminase	D7RWC5	Brochothrix_phage	81.5	2.2e-207
WP_002311445.1|2253368_2253824_-|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	41.4	2.7e-19
WP_002311444.1|2253849_2254074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170310976.1|2254560_2254752_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_024265261.1|2254744_2255158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300143.1|2255448_2255724_+	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002296602.1|2255720_2255873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|2256181_2256595_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002286693.1|2256671_2256968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286545.1|2256964_2257522_-	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002312822.1|2257518_2257914_-	hypothetical protein	NA	Q938M1	Temperate_phage	41.6	6.6e-14
WP_002311440.1|2257910_2258084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311438.1|2258080_2258392_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	58.6	9.1e-27
WP_002311437.1|2258391_2258682_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	43.4	1.8e-13
WP_002322110.1|2258675_2258987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290675.1|2258983_2259145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311433.1|2259141_2259444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349663.1|2259436_2259601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311431.1|2259605_2259875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311430.1|2259886_2260738_-	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SFJ6	Streptococcus_phage	66.4	2.7e-49
WP_002317389.1|2260846_2261362_-	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	37.5	2.9e-17
WP_002330486.1|2261369_2262062_-	hypothetical protein	NA	A0A0S2MYA3	Enterococcus_phage	52.3	9.7e-61
WP_002286557.1|2262067_2262739_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002311424.1|2262731_2263073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330484.1|2263109_2263256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311421.1|2263394_2263583_-	hypothetical protein	NA	D2IZW5	Enterococcus_phage	58.6	1.7e-07
WP_002311419.1|2263603_2263888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311418.1|2263935_2264235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296611.1|2264249_2264453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002311416.1|2264467_2265214_-	phage antirepressor KilAC domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	41.8	1.6e-48
WP_002322655.1|2265289_2265541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311413.1|2265521_2265677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311412.1|2265727_2265916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311411.1|2265912_2266071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317392.1|2266363_2266684_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	57.3	2.6e-21
WP_002290613.1|2266701_2267124_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002311408.1|2267210_2267516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311406.1|2267614_2268763_+|integrase	site-specific integrase	integrase	A0A1B1IMP1	Lactococcus_phage	48.4	3.9e-91
WP_002288864.1|2268851_2270477_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
2268853:2268871	attR	TACATCATACCGCCCATCA	NA	NA	NA	NA
WP_002288862.1|2270527_2270812_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002288860.1|2271036_2271699_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP018128	Enterococcus faecium strain A_020709_82 chromosome, complete genome	2740566	2605644	2625252	2740566		Streptococcus_phage(87.5%)	21	NA	NA
WP_002297366.1|2605644_2605959_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2605971_2606346_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297364.1|2606355_2606691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343904.1|2606773_2607919_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002297361.1|2608633_2610493_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002297360.1|2610586_2610826_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297358.1|2610903_2611578_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_002297357.1|2611570_2611735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321810.1|2611810_2612245_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2612245_2612953_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2612942_2613233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2613491_2614676_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2614672_2614810_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2615555_2617466_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2617569_2617794_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2617806_2618310_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2618369_2618759_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_002297348.1|2618745_2621193_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002297347.1|2621197_2623321_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2623317_2624322_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2624340_2625252_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP018129	Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence	222278	19072	69542	222278	transposase	Streptococcus_phage(61.11%)	44	NA	NA
WP_096948707.1|19072_20368_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	6.9e-44
WP_096948707.1|20512_21808_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	6.9e-44
WP_096948717.1|21921_23229_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.0e-55
WP_002290397.1|24323_24578_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002290394.1|24578_24896_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001015311.1|25408_26089_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002292678.1|26261_26591_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002292679.1|26580_26868_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292680.1|27153_28011_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292681.1|28011_28560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287937.1|28704_30132_+|transposase	IS1182-like element ISEfa12 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	4.4e-124
WP_096948718.1|30329_31008_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	94.7	1.1e-122
WP_002322527.1|31031_31637_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.6	4.2e-20
WP_002311512.1|31636_33061_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002287522.1|33427_33832_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002330559.1|33848_34997_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	91.0	1.0e-200
WP_002311511.1|35346_36189_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002343823.1|36513_36930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298375.1|36926_37397_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002298373.1|37410_38184_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298371.1|38197_39010_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002322451.1|39063_40029_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002343825.1|40144_42868_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002311505.1|42880_43513_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.4	1.0e-08
WP_002322453.1|44411_45239_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096948707.1|45468_46764_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	6.9e-44
WP_165483009.1|46789_47464_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.6	6.0e-116
WP_002317374.1|48153_48852_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301687.1|48835_49570_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301686.1|49786_50800_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301685.1|50810_51221_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002301684.1|51220_51688_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002301683.1|51705_52452_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002301682.1|52451_53261_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_001015311.1|53821_54502_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002289583.1|54891_56736_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289584.1|56790_58257_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002289586.1|58293_59136_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002296623.1|59352_60648_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002311502.1|60926_62381_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002297271.1|63224_64184_+|transposase	IS30-like element IS6770 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	2.1e-37
WP_002343830.1|64180_65059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|65694_66873_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_000997695.1|68363_69542_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
>prophage 2
NZ_CP018129	Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence	222278	73971	136189	222278	transposase,integrase	Streptococcus_phage(25.0%)	52	68325:68384	126428:127743
68325:68384	attL	ATTTTGTGTAAATAAATTGTCCTCCTGCAAAATAATTAGTTACTCAGTAAACATTGAAAC	NA	NA	NA	NA
WP_002325884.1|73971_74925_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.3e-34
WP_002317381.1|75109_75409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311756.1|76010_76616_+	Fic family protein	NA	NA	NA	NA	NA
WP_002295743.1|77037_77946_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002301108.1|78442_78997_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002287522.1|79245_79650_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002330559.1|79666_80815_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	91.0	1.0e-200
WP_002305121.1|81054_81660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305939.1|81646_82606_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	4.5e-32
WP_087046766.1|83561_84724_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002298088.1|84998_85541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322515.1|85696_86071_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_087046766.1|86177_87340_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002301194.1|87589_88867_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|88876_89533_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002298085.1|89532_90909_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002285758.1|91218_91413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|91402_91756_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002299190.1|91857_93405_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_096948707.1|93491_94787_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	6.9e-44
WP_002302275.1|97343_98315_+	radical SAM protein	NA	NA	NA	NA	NA
WP_002322470.1|98392_98629_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_077828694.1|98597_98729_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002317021.1|98804_99188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302270.1|99220_100006_-	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002302268.1|100183_101284_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302267.1|101273_102098_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_002317023.1|102094_102910_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002304872.1|102906_103737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|103743_104775_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_096948720.1|104997_106272_+|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.4	2.9e-55
WP_002302980.1|106654_107383_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002304873.1|107360_108935_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.0	1.6e-10
WP_002304874.1|109163_110102_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002289655.1|110113_111025_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002304876.1|111048_112521_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002304878.1|112572_113184_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002304880.1|113213_115127_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002305865.1|115254_118236_+	glycoside hydrolase family 42	NA	L0N6M2	Herpes_simplex_virus	28.8	2.2e-122
WP_002288608.1|118232_119894_+	hyaluronate lyase	NA	NA	NA	NA	NA
WP_002288609.1|119933_120866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032494987.1|121225_122791_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	2.4e-19
WP_060855706.1|122845_124120_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.6	1.6e-56
WP_002285815.1|124407_125061_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002300494.1|125057_126377_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000997695.1|126466_127645_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002313174.1|127800_128061_+	hypothetical protein	NA	NA	NA	NA	NA
126428:127743	attR	ATTTTGTGTAAATAAATTGTCCTCCTGCAAAATAATTAGTTACTCAGTAAACATTGAAACTAATGTATCGGTTACCTGTTGAAAACCTTTATGGCTTCTGTTTAGAAATTTTTGATTGTATGTATCAAAAATGCTGACTAGAAAGCGTTCTAGTGATTCTTCATTTTGAAACTGCTCTTTTCTACGGCTGTATCTTTTAATTTGCTTATTGAAAGACTCGATTAGATTGGTTGAGTAAATGGTTCTACGAATGCTAGGTGGAAAATCATAAAAAGTTAATAAGTCTTGGTTTTCTATGAGTGACTGCGTCACTTTAGGATAGTTTTTCTTCCATTTCTCAATCATGCCGGATAAGAAGGTATTCGCTTCTTCTTTTGAGTTAGCTTGATAAACAGCCTTAAAGTCATCACAGATTTCTTTTCGGTCTTTGACACGTACTTTATGAGCGATATTACGAGATACATGGATACAACAATGCTGATATTTTGCTTTAGGATAAATTTGATGGATAGTATCTTTCATGCCTTTTAAGCCGTCCGTAATAAAAAGCAAGACTTCTTGAACTCCTCTGGAGTTAATATCCTGTAGCAGCTCATTCCAAACGTATGTTGATTCAGTTGGAGCAATCGCATAACTCAGTACTTCTTTAGTGCCGTCTTCTCGTATACCAATGGCAATATAAATCGCTTCTTTGGATACGGTTTGACGTTTTAGTGGAATGTAAGTAGCGTCCATAAAAATAGCGACATACTTATCATTTAAGGCTCTGGATTTAAAGGCATTTACTTCTTCAGTCAGAACTTTAGTCATGTTGGACATGGTTTGTGGAGTATAGTGATGACCGTACATTTTTTCGATCAAATCAGCAATTTCAGACATCGTAACACCTTTTTCGAATAAATGGATAATAGTGGTTTCCAATGTATCGTTTGTTCTTTTGTAGGCTGGTAAAGTTTGTTGTTTAAACTCACCATTACGATCTCTAGGTATTTCCAATGTTAATTCACCATATTCGGTTTTGATTGATCGAAAGTAAGAACCGTTTCTCGAATTACCTGAATTAAAACCAGTGCGATCATATTTTTCGTAATCTAAAAAAGCCGTTAATTCAGTCCGTAGGAGTGTGTTTATCGCTTTTTCTAAGTGCGAACGGAATAATTCATTTAAATCGCCTTTAGTGACTAGAGTTTGCACAATTTCTGTAGTAAAATCATTCATAGGGAAGTCCTCTTTTCTGTGAATTGGTTGTCGTTAACTTTATTCTACAGAAGCGACTTCCTTTTTTGTATGGATTTTTTCATTTACACAAAATATTT	NA	NA	NA	NA
WP_002287525.1|128334_129483_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|129499_129904_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_096948707.1|130299_131595_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	6.9e-44
WP_086953915.1|133430_134770_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_086956687.1|135027_136189_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
>prophage 3
NZ_CP018129	Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence	222278	143138	197781	222278	transposase,bacteriocin,integrase,holin	Streptococcus_phage(23.53%)	50	162243:162302	206492:208282
WP_002330559.1|143138_144287_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	91.0	1.0e-200
WP_002287522.1|144303_144708_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287937.1|144915_146343_-|transposase	IS1182-like element ISEfa12 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	4.4e-124
WP_002322511.1|146474_146750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|146971_148133_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002301131.1|148904_149639_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301130.1|149654_150824_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301128.1|150839_151835_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002298736.1|151913_152840_+	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301126.1|152858_154109_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002325884.1|154239_155193_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.3e-34
WP_002301591.1|155300_156386_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002287870.1|158461_158980_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_086956687.1|160097_161259_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002300328.1|161757_162234_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
162243:162302	attL	CCTCCTCGTAAAATATCATTTGTCTAATAGTTTTTATTCAAAATGTTTCTAGATTATAAA	NA	NA	NA	NA
WP_002287107.1|162643_163894_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002289252.1|164029_165532_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289253.1|165545_166235_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289254.1|166395_167214_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326248.1|167945_169265_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	1.1e-209
WP_002301718.1|169943_170399_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_096948721.1|170641_172067_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	3.0e-48
WP_002302077.1|172237_173200_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_002302078.1|173201_174641_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002293868.1|174825_176772_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002317769.1|177002_178175_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002292418.1|178367_179240_+	ROK family protein	NA	NA	NA	NA	NA
WP_002322465.1|180252_180852_-	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_002301839.1|180915_181515_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002300846.1|182468_182651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300845.1|182640_182820_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002300843.1|183062_184583_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002300842.1|184769_185342_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300841.1|185348_186011_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300840.1|186026_186542_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300838.1|186543_186828_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300836.1|186861_188190_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300835.1|188203_188659_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300833.1|188661_190608_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000997695.1|190996_192175_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300807.1|192546_192810_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_002333851.1|192930_193884_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	3.7e-34
WP_002311569.1|194852_195209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|195267_195447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|195891_196164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300799.1|196173_196329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|196343_196595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322893.1|196594_196801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305809.1|197244_197469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|197658_197781_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
206492:208282	attR	CCTCCTCGTAAAATATCATTTGTCTAATAGTTTTTATTCAAAATGTTTCTAGATTATAAAATTTATTGAATAACACATTCCTAACGGAATTTGTTTCGATATTGTGTGATTTCTCAGAGTACAATGGATGTATGGAAAGGATCCAACGGGAATTTGCTATTTCCTCCTGTAGCGTTTGTCTACCCTGTTTAGTCTGTTACCCGAACCACTGTTATCACTACCAACTCATTAGCTGTTTCGATAATGGACTAGACTTTCAAATAGTAGTTTGGAAGGCAGCTTCTAGCTCTTTTATCACCGTATTCTATTAGGCGAGGTTGTGGCTATACAGTGAGTTTCTGGGAAATCCCACAGTATCGAAGCATTTTCCAAAATTTATATCGAAAGGAGGTCCTTCTTCCATGAAATTATTTGTCGGTATTGACGTTAGCTCTGAAAAACTAGATGTTTGTTTTTTAACAGACGACAATCAATTGTCTATCTTATCTGAAATCTCTGTTGCCAATGACATCGAAGGTGCTTCATTCATACGAGAAACAATTCTTGAATTCAATAACAGCTACCACTTTGATCAAATTGTGATTGGCATGGAGTCAACGTCCATGTACAGCTTCCATCCTTCCATGTTTTTTCATGAAGATGAGAAACTAAAGAAGCTCAACACACTTGTAACGATTGAAAATCCTTTTCGGGTGAAACAATTTAGTCGCATGTTTGATGAGAATAAAACTGATCGAAACGATGCATTAAGAATCGCTGATTTCTTGCGTATTCAACGATTCACAACTTCCCCTATCAAAGAAGAGAAATACATGGCCTTACAGCGTTTAACACGTACTCGCTATCAACTTATTAAGCAATTGATTCGTACAAAGCAACATTTTCTTGAAAATCTAACGTACAAATGTAATACGCTTGCTCGAGAAATGCGAGACGAATCGACGAGTCTTTTTAGTGCAACCCTCATTTCACTCATGACGGAAGATTTCACATTGGATGAACTTGCTGAGCTTCCTTTAGAAGCTTTCTGTGATTTACTTCAAGAAAAAGGAAAAGGCCGTTTCAAGCAACCAGAAAAAATCGCTAAAGCAATTCAACGTGCAATTACCATGAGTTACCGCCTAGGTGCTCTTGCACAAGAATCAATTAATGTTGTTTTAAGTGTTCTCGTACGAGAAATACGAGCACTTGAAAAAAATATCAAAGAATTAGATAAAGCCATCGAACAAGTAATTGTTGTCATTCCAGAATATCAATGCTTAACCAGTATTCCAGGCGTTGGTAAAGTCTATGCTGCCGGTTTAATCGCTGAAATTGGTCAAATCGAAAGATTTGAAGATCAGACAAAATTGGCAAAATACGCTGGATTAAGTTGGAAAGTGAACCAATCTGGAAACTATCAGTCGCAAAATACACCTCTGACAAAACAAGGAAATCGATATTTTAGATACTACTTAGTTGAAGCTGCCAACTCTGTAAAAAATTATCTTCCTGAATACAAAGCTTTTTATCAAAGTAAATATAAGGAGGTTCCAAAGCATCAACACAAACGTGCACTCGTCCTAACCGCAAGAAAATTTACGCGTCTGGTGGATACGCTACTACGTAAACACCAACTCTATACGCCACCAAGGAGTGTGATAGAGAAATAACAATCCGTTATTGACGCAAATCCTTGAATCAACCCGAAAAAAATTTGATTTTGATCGGGTCTAGTTTCGTGCGCTTCAAAACATATTACTCAATAAAGAAAATCTTAAATTTCATCTTGACTTATCACCATTAGACTAA	NA	NA	NA	NA
>prophage 1
NZ_CP018131	Enterococcus faecium strain A_020709_82 plasmid unnamed3, complete sequence	23736	47	7196	23736		Streptococcus_phage(100.0%)	8	NA	NA
WP_002321977.1|47_590_-	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	98.3	2.4e-91
WP_001096887.1|865_1660_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000627290.1|1752_2295_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001255866.1|2291_3200_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000662263.1|3232_3967_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000228166.1|3947_4817_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000567888.1|4919_5165_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001038792.1|6458_7196_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
