The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	171896	251870	4584634	plate,protease,coat,tRNA,terminase,transposase	Salmonella_phage(19.05%)	63	NA	NA
WP_000753940.1|171896_173321_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	6.5e-27
WP_000272188.1|174720_175107_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186650.1|175420_176245_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094599.1|176275_178948_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|179009_179804_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246888.1|180171_180897_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|181154_182006_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|182152_182878_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|183169_183727_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811938.1|183818_185015_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|185203_185962_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|185974_186832_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005059807.1|186843_188196_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240908.1|188225_190658_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|190779_191265_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139283.1|191268_192294_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|192398_192854_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|192857_193646_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000132065.1|193645_194794_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569431.1|194790_195387_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.8e-26
WP_001294738.1|195423_198906_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.7e-209
WP_000055741.1|198918_199878_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_128881983.1|199976_202118_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|202174_202564_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176576.1|202628_203927_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|203975_204236_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|204222_204423_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|204588_205134_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635538.1|205130_205553_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239155.1|205566_206277_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_005053355.1|206431_207256_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|207308_209027_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094030.1|209137_209845_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202325.1|209841_210246_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874221.1|210363_211179_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294596.1|211218_211872_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593997.1|211864_212896_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|213083_213659_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997035.1|219417_220221_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	1.6e-38
WP_000483770.1|220259_221606_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000648578.1|221655_222570_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|222810_223611_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211683.1|223688_224459_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644678.1|224506_225865_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	3.8e-08
WP_001052754.1|225936_226692_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005060310.1|226725_227448_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|227444_227912_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|227976_228708_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000402248.1|229047_230094_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_128882086.1|231086_232970_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_128882085.1|232985_233480_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000343116.1|236590_236878_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
WP_000747032.1|237961_239130_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_071994008.1|239184_240243_+|terminase	terminase	terminase	I1TEI5	Salmonella_phage	99.7	9.2e-212
WP_005124985.1|242422_243334_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	2.4e-160
WP_001196950.1|243333_244629_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.4	1.5e-240
WP_005053303.1|244673_244904_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	69.3	1.2e-23
WP_005124991.1|244881_245382_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	3.2e-90
WP_005124992.1|245381_246800_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	4.3e-273
WP_000785540.1|246799_247648_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	98.6	2.1e-102
WP_005124997.1|247647_248103_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	2.6e-86
WP_000964877.1|248105_248798_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
WP_005124999.1|250139_251870_+	lytic transglycosylase domain-containing protein	NA	A0A088CQ71	Enterobacteria_phage	97.7	1.7e-279
>prophage 2
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	263952	328181	4584634	tail,transposase	Enterobacteria_phage(30.0%)	51	NA	NA
WP_086020932.1|263952_265109_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.0e-67
WP_001295337.1|268874_269849_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004031.1|269954_270806_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114607.1|270802_271630_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939367.1|271626_272394_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
WP_045177322.1|272406_273333_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077696319.1|273599_273794_-	regulator	NA	NA	NA	NA	NA
WP_000003122.1|274702_275371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370403.1|275613_276309_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023933.1|276301_277729_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102097.1|277739_278459_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000667623.1|280241_280628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000011499.1|280652_282866_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_005053237.1|283355_283763_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000568702.1|283759_286237_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_005053234.1|286233_287223_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.7	6.5e-26
WP_128567422.1|287322_287526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032320155.1|287627_287864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139559.1|288271_289042_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532697.1|289195_289669_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_025746263.1|289711_292156_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|292395_292974_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|293179_293947_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225676.1|293917_294658_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000006251.1|295738_296236_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_005060461.1|296452_298192_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207561.1|298136_298922_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_128882050.1|298992_300048_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554759.1|300099_300393_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263491.1|300395_300794_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059861.1|300803_301256_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005060486.1|301501_302545_+	RNA ligase RtcB family protein	NA	A0A059VHB8	Mycobacterium_phage	30.0	6.8e-26
WP_001293009.1|303277_304735_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|304996_305455_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189558.1|305546_306791_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174678.1|306848_307250_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749864.1|307288_308344_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	3.5e-118
WP_001285281.1|309407_310511_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	4.1e-61
WP_000893267.1|310522_311776_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_094099483.1|312992_314149_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_171763968.1|314697_315138_+|tail	tail fiber assembly protein	tail	M1FJ98	Enterobacteria_phage	99.3	2.5e-78
WP_000217914.1|315371_315677_-	hypothetical protein	NA	M1FPE6	Enterobacteria_phage	100.0	2.8e-52
WP_000703663.1|316894_317815_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	99.7	6.2e-172
WP_000915849.1|317811_318174_-	GtrA family protein	NA	U5P0S6	Shigella_phage	99.2	1.1e-58
WP_094099483.1|318837_319994_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_000563002.1|321349_321709_+	hypothetical protein	NA	U5P092	Shigella_phage	99.0	1.7e-53
WP_000206732.1|321708_322014_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_134797288.1|323022_324166_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.7	4.5e-63
WP_171763969.1|325006_326179_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	99.2	2.5e-210
WP_005060548.1|326232_326856_-	hypothetical protein	NA	A0A088CQ58	Enterobacteria_phage	76.3	2.9e-72
WP_171763936.1|326982_328181_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.4e-67
>prophage 3
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	656000	825475	4584634	lysis,head,integrase,capsid,holin,tRNA,terminase,tail,transposase	Enterobacteria_phage(24.44%)	162	706695:706754	732536:733866
WP_000162739.1|656000_657425_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_001018040.1|657577_658618_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
WP_000084469.1|658614_659082_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_001278605.1|659171_660050_+	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_000853054.1|660074_661613_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_001177084.1|662009_662918_+	glutamate/aspartate ABC transporter substrate-binding protein GltI	NA	NA	NA	NA	NA
WP_000020953.1|663087_663828_+	glutamate/aspartate ABC transporter permease GltJ	NA	NA	NA	NA	NA
WP_000272830.1|663827_664502_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_000631382.1|664501_665227_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	1.7e-31
WP_001207526.1|665344_666280_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_005049464.1|668093_669545_-	co-chaperone DjlC	NA	NA	NA	NA	NA
WP_001030938.1|669541_670249_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_001035656.1|670350_670905_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_005125510.1|670914_672342_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_128881951.1|672338_673046_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_000578172.1|673209_674187_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_001044870.1|674256_674739_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001157892.1|674973_677556_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	1.4e-184
WP_001269672.1|677570_678152_+	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_000620544.1|678151_679183_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000838889.1|679184_679826_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_001241888.1|679849_680461_+	adenosylcobalamin/alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_001161664.1|680720_681038_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_000776104.1|681041_681509_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_000776198.1|681539_683441_+	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
WP_000131719.1|683443_684556_+	peptidoglycan glycosyltransferase MrdB	NA	NA	NA	NA	NA
WP_001231406.1|684566_685655_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092085.1|685793_687005_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.2	7.5e-101
WP_000850550.1|687115_687379_+	YbeD family protein	NA	NA	NA	NA	NA
WP_000284045.1|687479_688121_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_000378035.1|688379_689333_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000042632.1|689541_690507_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_000503931.1|690607_690811_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_128881952.1|690939_691728_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_000939741.1|691820_692204_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|692257_692467_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_005049488.1|692641_693202_-	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_000955063.1|693790_695176_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000833599.1|695895_696405_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_077696331.1|696567_696813_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	63.2	6.1e-18
WP_134796890.1|698483_699639_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_011069283.1|699651_699927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627469.1|699923_700865_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	85.9	7.8e-154
WP_005060669.1|701009_701366_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	87.4	4.7e-51
WP_094099483.1|701877_703033_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_000184977.1|703860_704604_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
WP_000113500.1|704494_705961_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.0	9.6e-260
WP_005020049.1|705960_706194_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	65.8	6.2e-20
WP_005098291.1|706181_706721_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	61.4	6.6e-49
706695:706754	attL	TGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGC	NA	NA	NA	NA
WP_000204761.1|708009_708693_-|terminase	PBSX family phage terminase large subunit	terminase	K4NXU1	Acinetobacter_phage	73.4	7.0e-96
WP_001108106.1|708643_709408_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	55.4	7.0e-12
WP_011069285.1|709602_710115_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_128567431.1|710247_710439_-	hypothetical protein	NA	Q76H62	Enterobacteria_phage	98.4	1.3e-28
WP_000747032.1|710521_711689_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_134797294.1|711782_712938_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	3.4e-66
WP_128882095.1|713039_713921_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.3	1.6e-161
WP_001091541.1|714055_715339_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_000593940.1|715479_717660_-	hydratase	NA	NA	NA	NA	NA
WP_001036463.1|717842_719276_-	anion permease	NA	NA	NA	NA	NA
WP_105078295.1|719351_720404_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_000815445.1|721581_722577_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_005061694.1|722836_722968_-	hypothetical protein	NA	A0A0C4UR34	Shigella_phage	86.7	2.6e-07
WP_011110560.1|723458_725285_+	invasion protein	NA	NA	NA	NA	NA
WP_001039888.1|725285_725465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005061679.1|725464_726082_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.7e-81
WP_134798247.1|728316_729446_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	3.5e-60
WP_001069001.1|729661_729943_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	55.8	2.0e-09
WP_000935590.1|729959_730808_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	57.0	9.7e-55
WP_001005968.1|732825_733029_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	1.0e-10
WP_001091985.1|733030_733186_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.2e-07
WP_128882117.1|733388_733796_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	2.2e-28
WP_000912291.1|733872_734100_+	transcriptional regulator	NA	NA	NA	NA	NA
732536:733866	attR	GCAGCGGGCTTGTAATGGGTTAAGTGATAACAGATGTCTGGAAATATAGGGGCAAATCCACTGAGCCAGAGGATTACGAAGGGCTTCATAAATATATGCTCTCACTAGGATTCAGGAGAACGATCCCCCATGGAGATGGTTCGTATAATCAACTCCCGGACGGAACTTATGTTTCCGAAAAGGGCGGTGATATTTATCAAATTCGCAGCCAGATATCTGACTATGCAGACCGACTATCCGGGTATCGCGCGTCTGTTTTTGTTTGCGAATTCAGTCAATGCGCATGGTATTTATACCCCGCCAAGACCCGGTGAATATCCTGCACGGCCTTCTGCTTTGTAGAAGGCTTCTTCGCTATCATAATCGCCAGATTCCAGCGCTTCTTTAGCCAGCCAGATGCGTGCCCCAGTGCCTGCATTTGGCTCCAGTTGCTGGAGGCGTTTTGCATCTTCTAGGAGTAGAGCGATAACGTGTTTTAATTCTGTCTCGTTCATTTTACTCACCTGAATGTCTTCCCAACCAACGACGTGCGCCAGCTTCGGTTTTAAACGTTTTGCTTTTGGTATACGTTATGGCGGTGAATGTGCCGTCCTGGTTGGGGAACACGCCGTACACCGGAGATTCGTTGTTGCCAAGATCGATAGTATTCATGTTGACCCCATTTCCCCTTAACGCCGGGGTAGCGGAACTGTTTGCTGAGAACACCGTGCGGTGTCTTGATGAATAAAATTTAGAATAACCTAAGGAGGGTGATCAAGATTTTTGTGTAGAAAAACCTAAGTTTTTTGATGTAAAAAACACAAGTGTTTGAAAGTTTGTGCTTTTTATTACAGGGTGTGGAGAAAAAAGGGGATTATTTGTTTGAGCTTCTTTTGCGAGCTTTGAGTAGTTCTTCAAAAAGTTTGTTGAAATTTTCAACTCGAGCACGCATCTCTGACAACAGGGCCTTTTGCTCTGACTCAGGCAGTGCGTCGAACAGTTGAAGTAACTCTTTTTGATCTTCTGTCAGAATGGCTGGCTGATTATCCGGGATCGGTTCGCCTGGTTGTTTATCTTCATCCCCAAAAAGAAGCCAAGTCGGTGAGCACTGAAGCGCTTGGCTCAGTGCGAATAATCTTTTCCCCGCCGGCTGTGTTTCATCTCTTTCCCATTGAGAAATTGTTACGTGAGCCACTTTGACCAGCTTACCTAATGCGGCCTGAGACAGTTTTAATTTTTTACGCCTATGTAAGAGGCGAGCACCGAAGGTTTCGTTTTTCATATTAGGGAATTCTAATTTTTCTTGACTTAGGTTTCTCTACGGCCTGGTTTCCTTAGGAAAATCTAAGGAG	NA	NA	NA	NA
WP_000702036.1|734083_734506_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	3.8e-68
WP_001118167.1|736134_736557_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
WP_005048249.1|736614_736971_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_012421537.1|737139_737805_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000882657.1|737975_738188_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
WP_000687442.1|738437_738725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094190774.1|739175_740305_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.9	1.0e-59
WP_000228005.1|740602_740893_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
WP_000747032.1|741076_742244_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000482655.1|742273_742696_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	63.4	9.4e-43
WP_134800205.1|744008_745138_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	4.6e-60
WP_032325845.1|745413_747255_+	toprim domain-containing protein	NA	B0FEC9	Escherichia_phage	98.2	0.0e+00
WP_000747032.1|747311_748479_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_075332552.1|748747_749572_+	hypothetical protein	NA	A0A0P0ZC72	Stx2-converting_phage	99.3	3.3e-156
WP_005061104.1|749646_749925_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	96.7	5.4e-47
WP_000814621.1|749921_750332_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	8.0e-71
WP_024260406.1|750328_750505_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	7.9e-28
WP_000147081.1|750546_750855_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	98.0	3.5e-47
WP_001202685.1|750844_751108_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	93.1	2.9e-42
WP_005061096.1|751039_751546_+	ash family protein	NA	S5MQL6	Escherichia_phage	80.5	2.7e-44
WP_077696494.1|751561_752056_+	Rha family transcriptional regulator	NA	S5MQL6	Escherichia_phage	71.2	5.5e-58
WP_000618004.1|752052_752286_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	51.4	5.1e-14
WP_001247840.1|752272_753181_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.6	1.3e-60
WP_000988183.1|753191_754070_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	95.6	3.0e-139
WP_000211324.1|754066_755458_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.7	3.6e-256
WP_001064799.1|755454_755712_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	93.8	1.1e-33
WP_000111769.1|755806_756007_+	protein ninH	NA	A0A088CC23	Shigella_phage	74.2	1.1e-20
WP_001204832.1|755999_756380_+	antitermination protein	NA	A0A088CD47	Shigella_phage	87.9	8.2e-62
WP_000839566.1|757182_757398_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
WP_005083349.1|757401_758031_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	57.6	4.7e-30
WP_001274722.1|758096_758630_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.6e-100
WP_000092287.1|758626_759094_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	94.8	6.7e-74
WP_094105672.1|759519_760676_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_001346234.1|760851_761160_+	hypothetical protein	NA	Q9B021	Phage_GMSE-1	77.5	2.9e-09
WP_001205133.1|761467_761644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005107083.1|762040_762253_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	52.9	6.2e-11
WP_000747032.1|762604_763773_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_001026848.1|766349_768278_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	1.8e-258
WP_000259004.1|768261_768465_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	57.4	8.6e-10
WP_075332558.1|770044_771550_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.2	3.0e-99
WP_000256830.1|771586_771934_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	6.4e-21
WP_000522637.1|771991_773020_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	63.0	4.9e-117
WP_000201488.1|773071_773458_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000348593.1|773469_773847_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	57.3	2.5e-31
WP_000677140.1|773833_774418_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	87.6	6.0e-88
WP_001079406.1|774414_774816_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	97.7	1.6e-71
WP_000211126.1|774826_775567_+	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.7	1.5e-128
WP_000478927.1|775625_776012_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_001161004.1|776020_776350_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_128881990.1|776321_779363_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.4	0.0e+00
WP_000447264.1|779362_779692_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_001152490.1|779691_780390_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000194737.1|780394_781138_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_000090877.1|781074_781677_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_000515521.1|781737_785217_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_001230368.1|785284_785884_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	6.1e-104
WP_000930145.1|787309_787933_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
WP_000801162.1|788112_789876_-	invasion plasmid antigen	NA	NA	NA	NA	NA
WP_000767391.1|790458_790935_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_024260402.1|790993_792283_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000951226.1|792369_793410_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000118810.1|793406_794561_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246759.1|794547_795303_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000044868.1|795295_795973_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042516.1|796551_798573_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_005048534.1|798764_799673_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000168192.1|800069_801059_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_000084630.1|801080_801593_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000080885.1|801595_802081_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000598624.1|802073_802319_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000852286.1|802320_802773_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000373624.1|802909_803614_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000446914.1|803818_804532_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000045466.1|804567_805524_-	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000650362.1|805523_806765_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_001113348.1|806761_807523_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000871982.1|807655_808066_+	YbhQ family protein	NA	NA	NA	NA	NA
WP_000469031.1|808027_809134_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070107.1|809144_810278_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000996107.1|810270_812007_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|811999_812995_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|812997_813669_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001145124.1|815291_815774_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	1.3e-35
WP_005094896.1|815893_818044_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.6	3.1e-41
WP_000386531.1|818071_819034_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443521.1|819174_820260_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|820488_820749_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000135439.1|821013_821280_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	4.0e-07
WP_000990151.1|821353_822031_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	3.4e-18
WP_005061315.1|824128_825475_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	911750	977148	4584634	protease,transposase,tRNA	Bacillus_phage(22.22%)	45	NA	NA
WP_000520781.1|911750_912071_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934033.1|912101_914378_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	4.3e-166
WP_001040187.1|915061_915280_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|915564_916269_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202220.1|916310_918032_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043574.1|918032_919799_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	4.6e-22
WP_000537402.1|919921_920887_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	3.2e-62
WP_000228473.1|921430_921925_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077072.1|922059_926088_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|926242_926854_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067746.1|926864_928208_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	4.3e-81
WP_000886683.1|928298_929591_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000213098.1|932285_932903_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534651.1|932904_933696_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165870.1|933731_934358_-	hydrolase	NA	NA	NA	NA	NA
WP_000109301.1|934672_935821_+	MFS transporter	NA	NA	NA	NA	NA
WP_004967157.1|936133_936808_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_005048975.1|936804_937155_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_000638232.1|938892_939081_+|transposase	transposase domain-containing protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	4.5e-05
WP_111779742.1|940457_941102_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_134797296.1|941555_942684_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	3.5e-60
WP_094105059.1|942590_942917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111043.1|943843_944584_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292813.1|944775_947058_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	4.9e-162
WP_000642544.1|947112_947970_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_005107139.1|948375_950136_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000057161.1|951090_952179_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	5.0e-80
WP_000445222.1|952249_953533_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005061315.1|953658_955005_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001295345.1|955140_955905_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125013.1|956077_956761_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|956871_958545_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|958704_958989_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000551266.1|961491_963240_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570540.1|963236_964223_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056529.1|964259_965492_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|965543_965726_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011599.1|965722_966469_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|966622_967516_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899599.1|967492_968272_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_005047510.1|968407_969193_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|969189_970512_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|970492_971197_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572706.1|971196_975657_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_005061315.1|975801_977148_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	1069629	1108092	4584634	transposase	Shigella_phage(50.0%)	28	NA	NA
WP_134796907.1|1069629_1070817_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124119.1|1070816_1071182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000154398.1|1072002_1073130_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199452.1|1073135_1074401_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_005047400.1|1075008_1075797_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	8.6e-90
WP_001061095.1|1075846_1076260_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000283673.1|1080009_1080747_+	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_001001917.1|1080770_1081325_+	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_001297187.1|1081426_1081918_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001264088.1|1082783_1083200_-	curli production assembly/transport protein CsgF	NA	NA	NA	NA	NA
WP_000833287.1|1083224_1083614_-	curli production assembly/transport protein CsgE	NA	NA	NA	NA	NA
WP_000481500.1|1083618_1084269_-	transcriptional regulator CsgD	NA	NA	NA	NA	NA
WP_000791650.1|1085020_1085476_+	curlin minor subunit CsgB	NA	NA	NA	NA	NA
WP_001144017.1|1086751_1087117_+	curlin major subunit CsgA	NA	NA	NA	NA	NA
WP_000992821.1|1087175_1087508_+	curli assembly protein CsgC	NA	NA	NA	NA	NA
WP_000489563.1|1087628_1087940_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000857408.1|1088034_1088568_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
WP_011069326.1|1088509_1089991_+	cardiolipin synthase ClsC	NA	NA	NA	NA	NA
WP_001070350.1|1089998_1091156_-	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
WP_011069327.1|1091549_1093085_+	glucans biosynthesis protein MdoG	NA	NA	NA	NA	NA
WP_001295445.1|1093077_1095621_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_134797300.1|1096036_1097224_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124119.1|1097223_1097589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747032.1|1098376_1099545_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000818777.1|1101898_1102144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094105069.1|1102205_1103403_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_094081542.1|1103827_1105055_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_094188155.1|1106936_1108092_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.1e-68
>prophage 6
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	1180978	1194442	4584634	protease,head,integrase,terminase,portal,tail	uncultured_Caudovirales_phage(90.91%)	20	1171257:1171271	1190310:1190324
1171257:1171271	attL	ACTGAATAACCGCAT	NA	NA	NA	NA
WP_000085253.1|1180978_1182208_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000953271.1|1182581_1182770_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_005048024.1|1182827_1183574_+	hypothetical protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	51.0	8.1e-13
WP_000226783.1|1183582_1183783_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005005155.1|1183772_1183994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204964.1|1184208_1184442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770157.1|1184447_1184747_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761796.1|1184743_1186492_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.5	3.3e-89
WP_000557473.1|1186780_1187059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294165.1|1187055_1187361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126701.1|1187370_1187532_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132078.1|1187673_1187898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000504052.1|1189395_1189968_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	6.1e-61
WP_000267597.1|1189969_1191181_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.2	2.0e-186
1190310:1190324	attR	ATGCGGTTATTCAGT	NA	NA	NA	NA
WP_001020662.1|1191177_1191516_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134107.1|1191512_1191809_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.2	2.2e-30
WP_001145905.1|1191808_1192249_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|1192232_1192415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029716858.1|1192470_1192797_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	79.6	9.2e-46
WP_128881933.1|1192780_1194442_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.0	4.9e-276
>prophage 7
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	1389245	1419751	4584634	integrase,transposase	Escherichia_phage(61.9%)	27	1396723:1396782	1414291:1415058
WP_005107451.1|1389245_1390442_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000788996.1|1392319_1393066_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	89.2	2.1e-122
WP_001118167.1|1393080_1393503_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
WP_005048249.1|1393560_1393917_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_000256998.1|1394009_1394228_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_001229298.1|1394229_1394595_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	2.5e-68
WP_000208062.1|1394591_1395257_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	6.1e-36
WP_000610655.1|1395256_1395622_+	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.7	6.1e-30
WP_000018421.1|1396019_1396232_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
1396723:1396782	attL	GGTAATGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTC	NA	NA	NA	NA
WP_000940329.1|1397568_1398168_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.4e-108
WP_000228038.1|1398167_1398458_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000640143.1|1398454_1399009_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	3.7e-71
WP_005049799.1|1399149_1399335_+	hypothetical protein	NA	A0A291AWU3	Escherichia_phage	63.4	1.5e-05
WP_134797302.1|1399396_1400552_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_045178261.1|1400599_1401106_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	73.2	1.9e-42
WP_128882120.1|1401739_1403344_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_119173042.1|1404227_1404437_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_011069357.1|1406111_1406480_+	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	55.4	2.6e-20
WP_064194761.1|1408207_1408831_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	79.7	8.1e-83
WP_000968134.1|1409031_1409889_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|1409885_1410743_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983722.1|1410739_1411567_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_000555620.1|1411566_1412481_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000443257.1|1412942_1413548_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.9e-113
WP_005049823.1|1414523_1414691_-	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.3e-27
WP_000747032.1|1417039_1418208_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
1414291:1415058	attR	GACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCATTACCCACCGGAACTGATTTGATGAACTATCAACGCTCTTAAATTCCCGGCCTTTTTAATGTTACTGTTAGTAATCTCCCAGCCTTTCAATGTTTCCCGACATCGTTTTCCTCGAAACATGAACCAGATGCGAATGTATTTACCTCGAATCTCGACACCTGTTGGTAATTTAGACATATCATGAGTCTTTGATAAACTGATTTATCTTCGGATAGTTGTACCAGATAATCCCTCGCTTACTGTCTGGCTTCCCTAAAGGAGATACTCGTTTGAAGTGGAAGCCTTCCACCCAACAGTTCTGGCGGTATGCTTCAATTTGTCTGGCACCCAGACCAGTGCGAAGCATCAGGCTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGGATGTGGCCCAGCCTTTCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTGAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCCGCCATCGCGTTGTCATACGAGTCGCCTGTACTTCCTGTTGATGCCAGTAATCCGGCTTCCTTAAGCCGCTGTGTGTAGGCCAGCGATACATACTGAGAACCTTTATCACTGTGATGGA	NA	NA	NA	NA
WP_094190485.1|1418595_1419751_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	6.8e-67
>prophage 8
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	1570490	1580944	4584634	holin,transposase	Escherichia_phage(23.08%)	15	NA	NA
WP_000534858.1|1570490_1570730_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|1570729_1571017_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|1571088_1571244_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980987.1|1571461_1571713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265249.1|1572059_1573109_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.2e-108
WP_000904111.1|1573121_1573478_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762884.1|1573492_1574314_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.6e-78
WP_045177689.1|1574849_1575176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000871291.1|1575623_1575959_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|1576218_1576407_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|1576403_1576565_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_000372594.1|1576714_1576894_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	91.5	4.1e-24
WP_134797302.1|1576918_1578075_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000527804.1|1579244_1580705_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_000214712.1|1580740_1580944_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	1794807	1827883	4584634	transposase	Shigella_phage(37.5%)	27	NA	NA
WP_134797556.1|1794807_1796036_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000027560.1|1796194_1796713_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_001076516.1|1796709_1797159_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000018633.1|1797159_1797393_-	YdcY family protein	NA	NA	NA	NA	NA
WP_000061178.1|1797478_1797652_-	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_001303494.1|1797846_1797942_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_000867989.1|1798343_1799153_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	5.9e-17
WP_001163923.1|1799362_1800787_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000555458.1|1800808_1801603_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005108792.1|1802441_1803629_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_086020934.1|1805710_1806866_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_000586723.1|1807480_1808074_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_005047890.1|1808070_1809063_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000140884.1|1810148_1810685_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1810747_1810972_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375931.1|1811111_1812767_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013771.1|1812991_1814335_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414573.1|1814551_1815475_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098548.1|1815512_1817153_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_094081542.1|1818774_1820003_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_134797121.1|1820069_1821226_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.0e-66
WP_023517637.1|1821600_1821750_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1821821_1821995_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|1822239_1822770_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048653.1|1822958_1823960_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115920.1|1824001_1825441_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000747032.1|1826715_1827883_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
>prophage 10
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	1855664	1964521	4584634	tail,transposase,tRNA	Enterobacteria_phage(28.89%)	92	NA	NA
WP_094106059.1|1855664_1856937_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
WP_128882106.1|1856912_1857335_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.1	1.2e-24
WP_000081423.1|1857510_1858446_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	3.2e-144
WP_000123730.1|1858574_1859942_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.2e-51
WP_000387377.1|1860419_1861403_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001046816.1|1862910_1863474_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_011069405.1|1863727_1865182_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_000957853.1|1865686_1865875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587200.1|1868023_1868671_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000156575.1|1868767_1869583_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000945011.1|1870126_1870642_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000611911.1|1870836_1871589_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_001262123.1|1871740_1872691_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000124119.1|1874094_1874460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937573.1|1874459_1875647_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000559908.1|1876322_1877354_+	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_000683016.1|1877404_1879018_-	murein tripeptide ABC transporter substrate-binding protein MppA	NA	NA	NA	NA	NA
WP_119164881.1|1882898_1883321_+	exodeoxyribonuclease VIII	NA	A0A088CD28	Shigella_phage	47.6	4.1e-22
WP_001277358.1|1883298_1883571_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.3	1.0e-37
WP_128882124.1|1883600_1884698_+	AAA family ATPase	NA	I6PCV5	Cronobacter_phage	83.8	4.6e-182
WP_000276807.1|1884748_1884937_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	93.5	8.8e-17
WP_134797305.1|1885037_1886192_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	4.4e-66
WP_005127484.1|1886309_1886591_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_000976476.1|1888025_1888367_-	YebY family protein	NA	NA	NA	NA	NA
WP_000168747.1|1889255_1889630_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1889768_1889999_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000944270.1|1890780_1891443_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	3.5e-07
WP_000936980.1|1891439_1893500_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024751.1|1893709_1894369_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_005062375.1|1894695_1895052_-	protein YebF	NA	NA	NA	NA	NA
WP_000173488.1|1895542_1896721_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|1896776_1897418_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|1897454_1899266_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301736.1|1899500_1900976_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056694.1|1901313_1902183_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000044415.1|1902310_1903753_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448385.1|1903883_1904855_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|1904974_1906297_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|1906312_1907245_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202992.1|1907323_1908079_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	3.8e-18
WP_000571468.1|1908075_1908861_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568525.1|1909007_1910018_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.2	2.8e-08
WP_000580324.1|1910026_1910638_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1910776_1910842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|1910911_1911514_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000974712.1|1911515_1912037_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|1912071_1912812_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032319954.1|1912840_1913293_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258670.1|1913410_1915183_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891627.1|1915492_1915747_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_005049126.1|1915938_1917135_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001210039.1|1917863_1918112_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	4.1e-38
WP_134800208.1|1918710_1920462_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_134798388.1|1920642_1921266_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	74.9	2.5e-76
WP_001230368.1|1922691_1923291_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	6.1e-104
WP_000515521.1|1923358_1926838_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_000090877.1|1926898_1927501_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_000194737.1|1927437_1928181_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_001152490.1|1928185_1928884_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000447264.1|1928883_1929213_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_128881990.1|1929212_1932254_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.4	0.0e+00
WP_001161004.1|1932225_1932555_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_000478927.1|1932563_1932950_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_000211126.1|1933008_1933749_-	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.7	1.5e-128
WP_001079406.1|1933759_1934161_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	97.7	1.6e-71
WP_000677116.1|1934157_1934748_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	78.2	7.4e-78
WP_000753026.1|1934734_1935106_-|tail	tail attachment protein	tail	NA	NA	NA	NA
WP_001074423.1|1935117_1935519_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	66.2	3.3e-37
WP_134797307.1|1935782_1936979_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001064885.1|1938164_1938854_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.4	2.9e-57
WP_001215517.1|1938850_1939210_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.1	8.3e-40
WP_000755956.1|1941067_1941895_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	94.5	2.3e-125
WP_001099210.1|1941938_1942688_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	96.0	1.7e-135
WP_000586688.1|1942684_1943254_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	6.8e-28
WP_000457720.1|1943377_1943620_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	83.8	3.1e-30
WP_001030131.1|1943623_1943770_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	7.0e-22
WP_000528720.1|1943778_1943976_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.2	3.7e-26
WP_000747032.1|1943950_1945119_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000905997.1|1945348_1945699_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_000252980.1|1945751_1946147_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|1946187_1946931_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564755.1|1946927_1947899_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001229399.1|1948063_1950493_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214308.1|1950517_1951618_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|1952005_1952752_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005048653.1|1952765_1953332_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025295.1|1953547_1955281_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_005063152.1|1955457_1955946_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259572.1|1957425_1957764_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000455174.1|1961216_1961675_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_001103659.1|1962918_1963314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134796931.1|1963365_1964521_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
>prophage 11
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	2035204	2063168	4584634	holin,integrase,tail,transposase	Shigella_phage(23.08%)	21	2044403:2044418	2075140:2075155
WP_094081536.1|2035204_2036352_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.5e-146
WP_111778310.1|2037190_2038419_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	9.8e-173
WP_001347103.1|2040975_2041647_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|2041779_2042193_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001240061.1|2043306_2043942_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007781.1|2044199_2044850_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
2044403:2044418	attL	ACTGCAAAGTGGCAAA	NA	NA	NA	NA
WP_000937511.1|2045927_2046197_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_000239881.1|2046253_2046922_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_134800209.1|2047237_2048881_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000839572.1|2051494_2051710_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_005049343.1|2052510_2053194_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_000140020.1|2053190_2053556_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	7.1e-39
WP_001265248.1|2053556_2054615_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.6e-89
WP_011069426.1|2054616_2054895_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.0	4.5e-09
WP_001302544.1|2054835_2055021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935258.1|2055062_2055275_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_005069274.1|2055869_2056286_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
WP_000533619.1|2056452_2057478_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001325918.1|2057713_2058511_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_005063096.1|2061447_2061951_+	MFS transporter	NA	NA	NA	NA	NA
WP_094081533.1|2062012_2063168_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
2075140:2075155	attR	TTTGCCACTTTGCAGT	NA	NA	NA	NA
>prophage 12
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	2077170	2083154	4584634	integrase,holin	Escherichia_phage(37.5%)	9	2076885:2076944	2093901:2094170
2076885:2076944	attL	GAATCGGGCAATGGCCATGCGATACCGGATGCAAGAAATCGCTGAAAAAGCGTATGTATT	NA	NA	NA	NA
WP_000839572.1|2077170_2077386_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_005049343.1|2078186_2078870_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_000140020.1|2078866_2079232_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	7.1e-39
WP_001265248.1|2079232_2080291_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.6e-89
WP_011069426.1|2080292_2080571_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.0	4.5e-09
WP_001302544.1|2080511_2080697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935258.1|2080738_2080951_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_005069274.1|2081545_2081962_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
WP_000533619.1|2082128_2083154_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
2093901:2094170	attR	GAATCGGGCAATGGCCATGCGATACCGGATGCAAGAAATCGCTGAAAAAGCGTATGTATTGTGGAATGACTGAGACCCAGACGCTGAGCGATGGCCCGGATGGTCAGTTTATCTTCAAATCTTAAACGCAGGGCATCAGGCAAATAAGAACGGAAGCAGGGAATATCTTTTGTTGTCTGGGAATTCATCGTTCGTGTCCATCAATATAGATGGGCGCGATTGTTGCCAGACAGGACAATTTTCACAAGACGTCGCTGATGGGGCGCTTAC	NA	NA	NA	NA
>prophage 13
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	2122029	2128336	4584634		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100804.1|2122029_2122575_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
WP_000857516.1|2122579_2123458_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
WP_001023623.1|2123516_2124416_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	4.4e-29
WP_000699406.1|2124415_2125501_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	4.4e-100
WP_000183041.1|2125873_2126767_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_001116126.1|2126941_2128336_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.8e-18
>prophage 14
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	2156057	2236948	4584634	tail,transposase,tRNA	Enterobacteria_phage(50.0%)	54	NA	NA
WP_134796937.1|2156057_2157254_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000003197.1|2157687_2158347_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000119071.1|2158343_2159105_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_025745239.1|2159101_2160625_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000489605.1|2160820_2161042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000275665.1|2162539_2163388_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_134796937.1|2166616_2167813_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000667591.1|2171989_2175055_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_128882016.1|2175055_2176471_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675144.1|2176467_2177871_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137862.1|2177867_2178590_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	3.7e-31
WP_005049106.1|2179258_2180620_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	7.1e-217
WP_001295425.1|2180961_2181279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807346.1|2181684_2182584_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
WP_000178554.1|2182665_2183445_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844250.1|2183544_2184585_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490707.1|2184632_2185988_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823288.1|2185991_2186276_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182919.1|2186306_2186759_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853873.1|2186768_2188031_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_005049088.1|2188059_2188914_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129574.1|2189221_2190274_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858519.1|2190530_2191808_+	MFS transporter	NA	NA	NA	NA	NA
WP_000011982.1|2192804_2193770_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2193743_2194490_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005049077.1|2194537_2195359_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	36.2	1.4e-21
WP_000822271.1|2195423_2196224_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195611.1|2196220_2197009_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000134566.1|2197625_2197955_+	nickel/cobalt efflux transporter RcnA	NA	NA	NA	NA	NA
WP_000546035.1|2197982_2198465_+	nickel/cobalt efflux transporter RcnA	NA	NA	NA	NA	NA
WP_000153074.1|2198683_2199022_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000945432.1|2200152_2202633_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677404.1|2202648_2203323_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830460.1|2203403_2203928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011110605.1|2204220_2204502_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2204763_2205873_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_005049047.1|2206004_2208038_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
WP_094081509.1|2208433_2209589_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_000636931.1|2217731_2218139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2218680_2219769_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294429.1|2219779_2222059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005063396.1|2222051_2223188_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.2e-162
WP_001087240.1|2223184_2225188_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_128882122.1|2226088_2226550_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	4.6e-75
WP_005063442.1|2226590_2227061_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	98.7	2.6e-81
WP_128882121.1|2227107_2227827_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2227823_2229509_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000483772.1|2229716_2231063_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001261936.1|2231460_2231709_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	97.6	4.1e-38
WP_000937511.1|2231824_2232094_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_000239881.1|2232150_2232819_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_134800210.1|2233134_2234778_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000551130.1|2234958_2235582_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.0	1.1e-79
WP_134796941.1|2235532_2236948_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	53.4	2.0e-76
>prophage 15
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	2255325	2325734	4584634	lysis,integrase,transposase,tRNA	Vibrio_phage(18.75%)	59	2287473:2287489	2334738:2334754
WP_005085206.1|2255325_2256273_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_005063605.1|2256511_2256910_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|2256906_2257602_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553555.1|2257731_2258616_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_001336068.1|2258763_2259471_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000383096.1|2259473_2259713_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_025745331.1|2259906_2261145_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_001275115.1|2262386_2263397_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_134797311.1|2263412_2264933_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.4	2.0e-10
WP_001036964.1|2264993_2265992_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628659.1|2266271_2267312_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_000440870.1|2267453_2268530_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139613.1|2268546_2269215_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000489228.1|2270339_2272331_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000534384.1|2272622_2274092_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548291.1|2274297_2275179_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096965748.1|2275277_2276327_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873892.1|2276400_2277258_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.1e-24
WP_001064964.1|2277260_2278349_+	sugar kinase	NA	NA	NA	NA	NA
WP_000382951.1|2278404_2279655_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_128881998.1|2279754_2280696_-	ribosylpyrimidine nucleosidase	NA	NA	NA	NA	NA
WP_000353886.1|2281591_2282842_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_001292479.1|2282935_2283874_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_001208129.1|2283861_2284803_-	pseudouridine kinase	NA	NA	NA	NA	NA
WP_000854472.1|2285226_2286918_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091263.1|2286934_2287873_-	1-phosphofructokinase	NA	NA	NA	NA	NA
2287473:2287489	attL	ATATCGAACTGACCGAG	NA	NA	NA	NA
WP_000487263.1|2287872_2289003_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551975.1|2289370_2290549_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_000389030.1|2291324_2291579_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136824.1|2291733_2292306_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_134800211.1|2292528_2293890_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	26.3	4.6e-30
WP_000198822.1|2294007_2294994_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_005063524.1|2295032_2295746_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|2296157_2296724_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000470574.1|2296904_2298461_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_005108109.1|2298542_2300357_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501600.1|2300357_2301452_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_000088916.1|2301451_2302477_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000194911.1|2302478_2304068_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.9e-19
WP_000202798.1|2304071_2304416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213401.1|2304748_2305939_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.3	1.7e-20
WP_001234850.1|2305966_2306662_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578068.1|2306811_2308572_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	9.3e-100
WP_000494183.1|2308696_2308981_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|2309119_2310127_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135673.1|2310308_2310536_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256188.1|2310555_2312316_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_075332750.1|2312673_2313918_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	5.0e-100
WP_001201667.1|2314192_2314384_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012421496.1|2315029_2315218_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000919326.1|2315210_2315396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865382.1|2315435_2315735_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000817013.1|2315731_2317867_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.3	2.0e-173
WP_077900767.1|2318103_2318313_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_087933729.1|2318374_2319485_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	26.1	2.2e-06
WP_128881948.1|2320023_2320374_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	4.0e-39
WP_001254932.1|2320293_2321445_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_128832263.1|2322607_2324116_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.5	3.1e-43
WP_038989268.1|2324657_2325734_+|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
2334738:2334754	attR	ATATCGAACTGACCGAG	NA	NA	NA	NA
>prophage 16
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	2638742	2646211	4584634	transposase	Escherichia_phage(66.67%)	7	NA	NA
WP_128599156.1|2638742_2639898_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_000017552.1|2641258_2641411_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2641428_2641620_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000975306.1|2641930_2642449_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755178.1|2642464_2643004_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138258.1|2643098_2644676_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|2644744_2646211_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 17
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	2850008	2859905	4584634	transposase	Pseudomonas_phage(42.86%)	7	NA	NA
WP_001272883.1|2850008_2852570_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_005051483.1|2853378_2854146_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.8e-69
WP_000847961.1|2854341_2855250_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	6.6e-118
WP_134796952.1|2855531_2856687_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	5.2e-67
WP_001192434.1|2856827_2858924_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	48.7	1.2e-173
WP_001249841.1|2858925_2859177_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	53.0	1.1e-17
WP_001224023.1|2859341_2859905_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	55.8	1.1e-35
>prophage 18
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	3856385	3915586	4584634	transposase,tRNA	Stx2-converting_phage(27.27%)	48	NA	NA
WP_001282349.1|3856385_3857750_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_011069570.1|3858767_3858842_+	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_001295247.1|3859062_3860478_+	tryptophanase	NA	NA	NA	NA	NA
WP_000131907.1|3860568_3861816_+	low affinity tryptophan permease TnaB	NA	NA	NA	NA	NA
WP_000085985.1|3861947_3863123_+	multidrug efflux MFS transporter MdtL	NA	NA	NA	NA	NA
WP_094081509.1|3863789_3864946_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_000938777.1|3865024_3865324_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000190670.1|3865480_3866230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291268.1|3866251_3866818_+	class I chromate reductase YieF	NA	NA	NA	NA	NA
WP_005081549.1|3866871_3868209_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	4.5e-62
WP_000086484.1|3868373_3869030_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000116772.1|3869096_3869570_+	protein CbrB	NA	NA	NA	NA	NA
WP_005108682.1|3869737_3870412_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	29.3	1.7e-09
WP_005048975.1|3870408_3870759_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_134796839.1|3870755_3872357_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.6e-146
WP_045178171.1|3872411_3872948_+	CbrC family protein	NA	NA	NA	NA	NA
WP_000766898.1|3873009_3873732_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_128882080.1|3874931_3876548_-	carbohydrate-specific porin BglH	NA	NA	NA	NA	NA
WP_000643221.1|3876633_3878028_-	6-phospho-beta-glucosidase BglB	NA	NA	NA	NA	NA
WP_000137305.1|3878046_3879924_-	PTS beta-glucoside transporter subunit IIABC	NA	NA	NA	NA	NA
WP_128882079.1|3880057_3880879_-	transcriptional antiterminator BglG	NA	NA	NA	NA	NA
WP_000377786.1|3881165_3881891_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000063125.1|3881905_3882679_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
WP_001251991.1|3882770_3883661_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3883660_3884620_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3884706_3885747_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_094081542.1|3890524_3891752_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000827814.1|3892518_3893091_-	long polar fimbria major subunit LpfA-O113	NA	NA	NA	NA	NA
WP_171763977.1|3893382_3894729_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000334086.1|3894831_3896661_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933743.1|3896822_3898193_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_001251965.1|3898543_3898963_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_000190506.1|3898983_3900366_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_000896498.1|3900392_3901256_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_001176745.1|3901306_3902848_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_001288592.1|3902860_3903394_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_001052219.1|3903408_3903879_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000429386.1|3903940_3904180_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_000135623.1|3904226_3905042_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000116695.1|3905050_3905431_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000932839.1|3906047_3906671_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000499813.1|3906734_3908624_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000763759.1|3909002_3909446_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_000432970.1|3909535_3909994_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_000845131.1|3910145_3911138_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	3.4e-51
WP_000956608.1|3911142_3912594_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_005097542.1|3912587_3914084_-	ATPase RavA	NA	NA	NA	NA	NA
WP_171763977.1|3914239_3915586_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP020753	Shigella flexneri 1c strain Y394 chromosome, complete genome	4584634	4304447	4374576	4584634	integrase,transposase,tRNA	Stx2-converting_phage(30.77%)	56	4352703:4352723	4381797:4381817
WP_005050598.1|4304447_4305485_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005108686.1|4307927_4308443_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030593.1|4308484_4308694_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005108685.1|4308809_4310135_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|4310207_4310816_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|4310925_4311294_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_005050606.1|4311464_4313888_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455241.1|4314042_4314915_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001295693.1|4314927_4315425_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000783447.1|4317456_4318377_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973658.1|4318528_4319869_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_005050616.1|4319940_4321056_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	32.2	1.1e-18
WP_000695390.1|4321420_4322611_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_001297290.1|4322764_4324309_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252058.1|4324323_4325214_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_001097282.1|4325585_4327061_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_000202902.1|4327104_4327515_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000487766.1|4327640_4327784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295279.1|4327784_4328063_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000745743.1|4328109_4330206_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001341739.1|4330928_4331567_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757324.1|4331680_4331923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789974.1|4332384_4334034_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001290322.1|4334558_4335908_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_134796839.1|4336073_4337675_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.6e-146
WP_005048975.1|4337671_4338022_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_005108682.1|4338018_4338693_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	29.3	1.7e-09
WP_171763967.1|4338852_4340080_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_011069602.1|4340279_4340966_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	1.1e-37
WP_005065417.1|4341113_4341797_+	YjiH family protein	NA	NA	NA	NA	NA
WP_000211962.1|4341793_4342255_+	membrane protein	NA	NA	NA	NA	NA
WP_000568430.1|4342267_4343440_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340749.1|4343504_4344416_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986206.1|4344408_4344801_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4344797_4344881_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_000062539.1|4346250_4347081_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000844159.1|4347221_4347995_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208166.1|4348209_4349670_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	2.1e-49
WP_000438582.1|4349750_4350935_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000558239.1|4351274_4352618_+	gluconate permease GntP	NA	NA	NA	NA	NA
4352703:4352723	attL	GGGAGAGGGTTAGGGTGAGGG	NA	NA	NA	NA
WP_000816511.1|4352868_4353771_-	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000870598.1|4353790_4354294_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244836.1|4354306_4354837_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000120997.1|4354846_4357483_-	fimbrial usher FimD	NA	NA	NA	NA	NA
WP_000066552.1|4357549_4358275_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000824103.1|4358311_4358851_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000695529.1|4358915_4359464_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000044711.1|4359944_4360541_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_001295734.1|4363074_4363791_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_005048917.1|4363810_4364917_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991455.1|4364981_4365962_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	7.9e-101
WP_050597212.1|4367177_4367918_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_134797283.1|4368740_4369896_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_071829150.1|4370823_4371060_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000747032.1|4372221_4373389_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_001218324.1|4373364_4374576_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.3	2.0e-77
4381797:4381817	attR	CCCTCACCCTAACCCTCTCCC	NA	NA	NA	NA
>prophage 1
NZ_CP030773	Shigella flexneri 1c strain Y394 plasmid pINV-Y394, complete sequence	221293	990	101712	221293	transposase,protease	Escherichia_phage(38.89%)	52	NA	NA
WP_005061047.1|990_1938_+|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
WP_000165219.1|1906_2074_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	91.4	7.1e-10
WP_001046939.1|3484_4351_+	type 3 secretion system effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	32.7	9.4e-29
WP_000850660.1|4679_5420_+	PAP2 family phosphatase PhoN2	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.9	2.6e-11
WP_025745429.1|8052_8403_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.0	2.8e-08
WP_005061014.1|9742_11452_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_001121867.1|11883_12603_-	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_000868563.1|13634_14213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338649.1|15534_15720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171767122.1|16177_17524_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000622995.1|17967_18315_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	3.4e-46
WP_000026470.1|21202_21880_+	type 3 secretion system effector OspD1	NA	NA	NA	NA	NA
WP_011114726.1|22391_22706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901798.1|22987_23554_+	type III secretion effector IpgB2	NA	NA	NA	NA	NA
WP_005064872.1|26124_27318_-|transposase	IS4-like element ISSfl1 family transposase	transposase	S5FM71	Shigella_phage	62.5	2.0e-138
WP_011114728.1|27750_28533_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	8.5e-138
WP_000200287.1|29259_30459_+	AAA family ATPase	NA	Q71TL9	Escherichia_phage	75.1	2.0e-175
WP_000431558.1|30458_31439_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	58.2	5.0e-95
WP_075332577.1|32468_33647_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.1	1.3e-28
WP_000957853.1|36066_36255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072075159.1|38388_38811_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	98.1	7.7e-53
WP_005116773.1|38752_39541_-	AraC family invasion system transcriptional regulator VirF	NA	NA	NA	NA	NA
WP_000957712.1|40552_40819_+	type 3 secretion system effector OspE2	NA	NA	NA	NA	NA
WP_005049126.1|41966_43163_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005038443.1|43413_43887_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094085526.1|43975_44840_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	6.7e-19
WP_010921643.1|46180_47593_+	type 3 secretion system effector OspC1	NA	NA	NA	NA	NA
WP_010921642.1|47921_49619_+	type III secretion system effector OspD3	NA	NA	NA	NA	NA
WP_000019158.1|50021_50294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072056208.1|51857_52556_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.1	7.3e-125
WP_077901500.1|55164_56529_-	MFS transporter	NA	NA	NA	NA	NA
WP_010921638.1|58792_60517_-	T3SS effector E3 ubiquitin-protein ligase IpaH4.5	NA	NA	NA	NA	NA
WP_010921637.1|60942_62640_-	T3SS effector E3 ubiquitin-protein ligase IpaH7.8	NA	NA	NA	NA	NA
WP_004998488.1|64048_65080_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000957853.1|67423_67612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034121.1|68013_72108_+|protease	serine protease autotransporter toxin SepA	protease	Q9LA58	Enterobacterial_phage	42.3	7.3e-281
WP_075332747.1|75658_77113_+	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_000019158.1|78749_79022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010921625.1|79293_79596_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000405245.1|79586_80069_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149528155.1|81962_83654_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_094081542.1|83872_85101_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_128882125.1|86892_87378_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011114751.1|87365_87650_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_001346193.1|88551_88716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005048975.1|90568_90919_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_001088287.1|90915_91590_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_094169927.1|92161_93616_+	T3SS effector OspC family protein	NA	NA	NA	NA	NA
WP_134798317.1|97187_98384_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_128882030.1|98575_99580_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	97.5	3.4e-184
WP_001102512.1|100195_100333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005059304.1|100932_101712_+|protease	type III secretion system effector cysteine protease IpaJ	protease	NA	NA	NA	NA
>prophage 2
NZ_CP030773	Shigella flexneri 1c strain Y394 plasmid pINV-Y394, complete sequence	221293	144775	185735	221293	transposase,protease	Stx2-converting_phage(45.45%)	29	NA	NA
WP_001195004.1|144775_145978_-|protease	alpha-tubulin-specific protease	protease	NA	NA	NA	NA
WP_128882073.1|146506_149815_+	outer membrane autotransporter IcsA	NA	A0A2L1IV18	Escherichia_phage	28.8	6.7e-75
WP_000612525.1|151999_153652_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_128861100.1|154158_154572_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_094081542.1|154645_155873_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000828661.1|157285_158035_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_094081568.1|158204_159049_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	2.2e-22
WP_005015412.1|159094_159475_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_000445929.1|159657_160053_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000921952.1|160052_161012_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	40.9	1.4e-62
WP_128567749.1|161451_162354_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_031942478.1|162350_162662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086135.1|162725_163409_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	2.3e-30
WP_001104887.1|163409_163631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001006196.1|164121_164892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149528156.1|165958_167560_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	7.8e-146
WP_005048975.1|167556_167907_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_004967157.1|167903_168578_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000607008.1|170171_170810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004967157.1|171637_172312_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_005048975.1|172308_172659_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_134798364.1|173264_174420_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_024260696.1|176828_177113_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421262.1|177112_177388_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000813626.1|179855_180074_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159860.1|180075_180381_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000936806.1|180773_182411_+	T3SS effector E3 ubiquitin-protein ligase IpaH9.8	NA	NA	NA	NA	NA
WP_000705601.1|183139_183730_+	type III secretion system effector protein kinase OspG	NA	NA	NA	NA	NA
WP_064753708.1|184415_185735_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
