The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023582	Mycobacterium tuberculosis strain LN3756 chromosome, complete genome	4411315	889005	947560	4411315	tRNA,protease,bacteriocin,transposase	Burkholderia_virus(16.67%)	53	NA	NA
WP_087902221.1|889005_890266_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890321_891416_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891405_892203_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892199_893207_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_031658839.1|893251_894553_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894564_894912_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894905_895562_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895753_898018_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|898014_898644_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898764_899721_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899665_901264_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901568_901958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902044_903628_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903658_904753_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904838_905021_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905167_906274_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906356_907226_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907271_907952_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908114_908417_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908418_909252_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909544_909967_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909963_910776_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910905_911673_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911669_912617_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912659_913436_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913491_914133_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914190_916245_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916410_917580_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917667_918684_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918845_919487_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919568_920624_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920675_921068_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921125_921548_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921509_921800_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921904_922810_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922828_923644_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_031658840.1|927771_930402_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930869_931514_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931494_932046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932195_932849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932919_933948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934636_935407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935493_936306_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936373_937234_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937509_937752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938028_939321_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939304_940309_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940372_941023_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941106_942384_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942596_944111_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944259_944652_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944854_945973_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404404.1|947227_947560_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023582	Mycobacterium tuberculosis strain LN3756 chromosome, complete genome	4411315	2941039	2976405	4411315	integrase,protease,transposase,capsid,head,terminase,tRNA	Tupanvirus(11.11%)	41	2969840:2969867	2980822:2980849
WP_003413486.1|2941039_2943118_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943226_2943454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096865846.1|2943450_2944836_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945180_2945681_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945697_2946138_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946284_2946962_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946946_2947300_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947312_2947738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947734_2948409_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948486_2949308_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949443_2950337_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950339_2951158_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951172_2952354_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952412_2952844_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953357_2954599_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954908_2955271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955617_2956742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956743_2957283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957422_2958721_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958759_2959041_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959185_2959671_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959697_2959955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959955_2962292_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962320_2962563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962563_2963241_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963436_2964093_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964255_2964702_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964876_2965209_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965328_2965688_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965789_2966248_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966383_2966764_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966760_2968257_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968446_2968683_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968755_2968929_+	hypothetical protein	NA	NA	NA	NA	NA
2969840:2969867	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969973_2970405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970401_2971400_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971413_2971878_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096868035.1|2972010_2973271_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973645_2975085_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975092_2975626_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975778_2976405_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980822:2980849	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
