The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023591	Mycobacterium tuberculosis strain TBV5365 chromosome, complete genome	4411398	889006	947570	4411398	transposase,bacteriocin,tRNA,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889006_890267_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_096871945.1|890322_891417_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891406_892204_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892200_893208_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893252_894554_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894565_894913_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894906_895563_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096872517.1|895754_898019_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.1e-273
WP_003404117.1|898015_898645_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898765_899722_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899666_901265_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901569_901959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871947.1|902045_903629_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903659_904754_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904839_905022_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905168_906275_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906357_907227_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_096871949.1|907272_907953_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908115_908418_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908419_909253_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_096871951.1|909545_909968_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909964_910777_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910906_911674_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911670_912618_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912660_913437_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913492_914134_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914191_916246_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916411_917581_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917668_918685_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_096865426.1|918846_919488_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919568_920624_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920675_921068_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921125_921548_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921509_921800_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921904_922810_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922828_923644_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927771_930411_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930878_931523_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931503_932055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932204_932858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932928_933957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934645_935416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935502_936315_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936382_937243_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937518_937761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938037_939330_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939313_940318_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940381_941032_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941115_942393_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942605_944120_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944268_944661_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944863_945982_+	S-sulfocysteine synthase CysK2	NA	NA	NA	NA	NA
WP_003404402.1|945981_947241_+	MFS transporter	NA	NA	NA	NA	NA
WP_096872519.1|947237_947570_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023591	Mycobacterium tuberculosis strain TBV5365 chromosome, complete genome	4411398	2941083	2976449	4411398	head,protease,tRNA,transposase,terminase,integrase,capsid	Tupanvirus(11.11%)	41	2969884:2969911	2980866:2980893
WP_003413486.1|2941083_2943162_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943270_2943498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943494_2944880_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945224_2945725_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945741_2946182_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946328_2947006_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946990_2947344_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947356_2947782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096872255.1|2947778_2948453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948530_2949352_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949487_2950381_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950383_2951202_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951216_2952398_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952456_2952888_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953401_2954643_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954952_2955315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955661_2956786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956787_2957327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096872257.1|2957466_2958765_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	2.9e-90
WP_003413619.1|2958803_2959085_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959229_2959715_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959741_2959999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959999_2962336_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962364_2962607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962607_2963285_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963480_2964137_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964299_2964746_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964920_2965253_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965372_2965732_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965833_2966292_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966427_2966808_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966804_2968301_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968490_2968727_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968799_2968973_+	hypothetical protein	NA	NA	NA	NA	NA
2969884:2969911	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970017_2970449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096872259.1|2970445_2971444_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.5	6.3e-61
WP_003900539.1|2971457_2971922_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972054_2973315_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973689_2975129_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975136_2975670_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975822_2976449_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980866:2980893	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
