The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023600	Mycobacterium tuberculosis strain CSV3611 chromosome, complete genome	4411439	889009	947564	4411439	transposase,tRNA,protease,bacteriocin	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889009_890270_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890325_891420_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891409_892207_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892203_893211_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893255_894557_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894568_894916_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894909_895566_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096877833.1|895757_898022_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	2.8e-274
WP_003404117.1|898018_898648_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898768_899725_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899669_901268_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901572_901962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902048_903632_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903662_904757_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904842_905025_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905171_906278_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906360_907230_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907275_907956_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908118_908421_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908422_909256_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909548_909971_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909967_910780_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910909_911677_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911673_912621_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912663_913440_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913495_914137_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914194_916249_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916414_917584_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917653_918670_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918831_919473_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919553_920609_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920660_921053_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921110_921533_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921494_921785_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921889_922795_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922813_923629_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010886090.1|927756_930405_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930872_931517_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931497_932049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932198_932852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932922_933951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934639_935410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935496_936309_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936376_937237_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937512_937755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938031_939324_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939307_940312_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940375_941026_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941109_942387_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942599_944114_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944262_944655_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_023637361.1|944857_945976_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945975_947235_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947231_947564_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023600	Mycobacterium tuberculosis strain CSV3611 chromosome, complete genome	4411439	2941116	2976458	4411439	head,tRNA,protease,transposase,integrase,terminase,capsid	Tupanvirus(11.11%)	41	2969891:2969918	2980875:2980902
WP_003413486.1|2941116_2943195_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943303_2943531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943527_2944913_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945257_2945758_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945774_2946215_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946361_2947039_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947023_2947377_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947389_2947815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947811_2948486_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948563_2949385_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949520_2950414_+	universal stress protein	NA	NA	NA	NA	NA
WP_078441640.1|2950416_2951217_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951223_2952405_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952463_2952895_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953408_2954650_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954959_2955322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955668_2956793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956794_2957334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957473_2958772_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958810_2959092_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959236_2959722_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959748_2960006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960006_2962343_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962371_2962614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962614_2963292_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963487_2964144_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964306_2964753_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964927_2965260_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965379_2965739_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965840_2966299_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966434_2966815_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023637465.1|2966811_2968308_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968497_2968734_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968806_2968980_+	hypothetical protein	NA	NA	NA	NA	NA
2969891:2969918	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970024_2970456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970452_2971451_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971464_2971929_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972061_2973322_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973698_2975138_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975145_2975679_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975831_2976458_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980875:2980902	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
