The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023602	Mycobacterium tuberculosis strain LE13 chromosome, complete genome	4411412	889032	947597	4411412	transposase,protease,tRNA,bacteriocin	Burkholderia_virus(16.67%)	53	NA	NA
WP_087902221.1|889032_890293_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890348_891443_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891432_892230_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892226_893234_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893278_894580_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894591_894939_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894932_895589_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895780_898045_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898041_898671_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898791_899748_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899692_901291_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901595_901985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902071_903655_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903685_904780_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904865_905048_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905194_906301_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906383_907253_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907298_907979_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908141_908444_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908445_909279_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909571_909994_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909990_910803_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910932_911700_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911696_912644_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912686_913463_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913518_914160_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914217_916272_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916437_917607_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917694_918711_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918872_919514_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919594_920650_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920701_921094_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921151_921574_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921535_921826_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921930_922836_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922854_923670_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927797_930437_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930904_931549_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931529_932081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932230_932884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932954_933983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934671_935442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935528_936341_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936408_937269_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937544_937787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938063_939356_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939339_940344_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940407_941058_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003404392.1|942632_944147_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944295_944688_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944890_946009_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|946008_947268_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947264_947597_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023602	Mycobacterium tuberculosis strain LE13 chromosome, complete genome	4411412	2941088	2976454	4411412	tRNA,terminase,integrase,protease,capsid,transposase,head	Tupanvirus(11.11%)	41	2969889:2969916	2980871:2980898
WP_003413486.1|2941088_2943167_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943275_2943503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873952.1|2943499_2944885_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945229_2945730_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945746_2946187_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946333_2947011_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946995_2947349_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947361_2947787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947783_2948458_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948535_2949357_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949492_2950386_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950388_2951207_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951221_2952403_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952461_2952893_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953406_2954648_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954957_2955320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955666_2956791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956792_2957332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957471_2958770_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958808_2959090_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959234_2959720_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959746_2960004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960004_2962341_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962369_2962612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962612_2963290_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963485_2964142_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964304_2964751_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964925_2965258_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965377_2965737_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965838_2966297_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966432_2966813_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966809_2968306_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968495_2968732_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968804_2968978_+	hypothetical protein	NA	NA	NA	NA	NA
2969889:2969916	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970022_2970454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970450_2971449_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971462_2971927_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972059_2973320_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973694_2975134_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975141_2975675_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975827_2976454_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980871:2980898	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
