The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023605	Mycobacterium tuberculosis strain LE79 chromosome, complete genome	4411475	889030	947594	4411475	transposase,bacteriocin,tRNA,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889030_890291_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890346_891441_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891430_892228_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892224_893232_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893276_894578_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894589_894937_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894930_895587_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895778_898043_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898039_898669_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898789_899746_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899690_901289_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901593_901983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902069_903653_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903683_904778_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904863_905046_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905192_906299_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906381_907251_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907296_907977_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908139_908442_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908443_909277_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909569_909992_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909988_910801_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910930_911698_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911694_912642_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912684_913461_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913516_914158_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914215_916270_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916435_917605_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917692_918709_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918870_919512_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919592_920648_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920699_921092_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921149_921572_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921533_921824_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921928_922834_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922852_923668_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927795_930435_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930902_931547_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931527_932079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932228_932882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932952_933981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934669_935440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935526_936339_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936406_937267_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937542_937785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938061_939354_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939337_940342_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940405_941056_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941139_942417_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942629_944144_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944292_944685_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944887_946006_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|946005_947265_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947261_947594_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023605	Mycobacterium tuberculosis strain LE79 chromosome, complete genome	4411475	2941140	2976506	4411475	transposase,head,terminase,tRNA,integrase,capsid,protease	Tupanvirus(11.11%)	41	2969941:2969968	2980923:2980950
WP_003413486.1|2941140_2943219_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943327_2943555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943551_2944937_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945281_2945782_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945798_2946239_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946385_2947063_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947047_2947401_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947413_2947839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947835_2948510_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948587_2949409_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949544_2950438_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950440_2951259_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951273_2952455_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952513_2952945_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953458_2954700_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2955009_2955372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955718_2956843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956844_2957384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957523_2958822_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958860_2959142_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959286_2959772_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959798_2960056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960056_2962393_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962421_2962664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962664_2963342_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963537_2964194_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964356_2964803_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964977_2965310_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965429_2965789_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965890_2966349_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966484_2966865_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966861_2968358_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968547_2968784_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968856_2969030_+	hypothetical protein	NA	NA	NA	NA	NA
2969941:2969968	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970074_2970506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970502_2971501_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971514_2971979_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972111_2973372_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973746_2975186_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975193_2975727_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975879_2976506_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980923:2980950	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
