The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023610	Mycobacterium tuberculosis strain LN317 chromosome, complete genome	4411340	888941	947505	4411340	tRNA,bacteriocin,protease,transposase	Burkholderia_virus(16.67%)	52	NA	NA
WP_087902221.1|888941_890202_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890257_891352_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891341_892139_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892135_893143_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893187_894489_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894500_894848_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894841_895498_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096872517.1|895689_897954_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.1e-273
WP_003404117.1|897950_898580_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898700_899657_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899601_901200_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901504_901894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|901980_903564_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903594_904689_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904774_904957_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905103_906210_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906292_907162_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907207_907888_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908050_908353_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908354_909188_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909480_909903_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909899_910712_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910841_911609_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911605_912553_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912595_913372_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913427_914069_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914126_916181_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916346_917516_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917603_918620_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_096879320.1|918781_919423_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919503_920559_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920610_921003_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921060_921483_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921444_921735_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921839_922745_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922763_923579_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_003404362.1|930814_931459_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931439_931991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932140_932794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932864_933893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934581_935352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935438_936251_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936318_937179_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937454_937697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|937973_939266_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939249_940254_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940317_940968_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941051_942329_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942541_944056_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944204_944597_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944799_945918_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404404.1|947172_947505_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023610	Mycobacterium tuberculosis strain LN317 chromosome, complete genome	4411340	2941058	2976424	4411340	tRNA,terminase,capsid,protease,integrase,head,transposase	Tupanvirus(11.11%)	41	2969859:2969886	2980841:2980868
WP_003413486.1|2941058_2943137_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943245_2943473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943469_2944855_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945199_2945700_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945716_2946157_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_096879593.1|2946303_2946981_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946965_2947319_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947331_2947757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947753_2948428_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096879444.1|2948496_2949327_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949462_2950356_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950358_2951177_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951191_2952373_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952431_2952863_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953376_2954618_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954927_2955290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955636_2956761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956762_2957302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096872257.1|2957441_2958740_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	2.9e-90
WP_003413619.1|2958778_2959060_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959204_2959690_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959716_2959974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096879445.1|2959974_2962311_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962339_2962582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962582_2963260_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963455_2964112_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964274_2964721_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964895_2965228_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965347_2965707_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965808_2966267_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966402_2966783_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966779_2968276_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968465_2968702_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_157770955.1|2968774_2968948_+	hypothetical protein	NA	NA	NA	NA	NA
2969859:2969886	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969992_2970424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970420_2971419_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971432_2971897_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972029_2973290_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973664_2975104_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975111_2975645_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975797_2976424_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980841:2980868	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
