The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	582570	625255	4991140	portal,holin,integrase,lysis,coat,tail,transposase	Salmonella_phage(53.23%)	65	582511:582556	625519:625564
582511:582556	attL	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCAT	NA	NA	NA	NA
WP_097362077.1|582570_583734_-|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	96.9	2.0e-223
WP_097362078.1|583963_584308_-	hypothetical protein	NA	A0A2I6PID6	Escherichia_phage	97.4	7.6e-59
WP_097363118.1|584380_584761_-	DUF551 domain-containing protein	NA	A0A2H4FNA9	Salmonella_phage	67.2	9.4e-42
WP_097362079.1|585105_585495_-	hypothetical protein	NA	A0A1U9HZ41	Salmonella_phage	45.0	4.2e-29
WP_097362080.1|585497_586208_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	52.0	1.0e-36
WP_097362081.1|586204_586606_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	97.0	4.6e-71
WP_097362082.1|586602_587199_-	hypothetical protein	NA	A0A2R3UAL4	Myoviridae_environmental_samples	53.4	1.4e-20
WP_097362083.1|587195_587888_-	HNH endonuclease	NA	C6ZR31	Salmonella_phage	96.5	1.1e-125
WP_072222367.1|587884_588055_-	DUF2737 family protein	NA	E7C9P7	Salmonella_phage	96.4	1.3e-24
WP_000799344.1|588071_588386_-	hypothetical protein	NA	A0A0M4R304	Salmonella_phage	98.1	8.6e-49
WP_000041323.1|588397_588880_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	7.9e-78
WP_097362084.1|588863_589766_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	87.8	7.5e-146
WP_097362085.1|589762_590071_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	5.6e-53
WP_001191777.1|590155_590308_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_000983400.1|590292_590427_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	68.2	1.4e-08
WP_000776962.1|590510_590825_-	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	100.0	1.9e-56
WP_001748038.1|591100_591379_-	hypothetical protein	NA	C6ZR42	Salmonella_phage	100.0	1.3e-45
WP_097362086.1|591412_591913_-	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	43.9	4.0e-32
WP_097362087.1|592105_592684_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	94.3	2.5e-86
WP_097362088.1|592704_593067_-	antitermination protein	NA	C6ZR44	Salmonella_phage	95.0	1.5e-57
WP_000834175.1|593397_593601_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_001749906.1|593736_594048_-	hypothetical protein	NA	C6ZR45	Salmonella_phage	99.0	1.7e-44
WP_097362089.1|594034_594505_-	hypothetical protein	NA	B9UDH1	Salmonella_phage	96.2	1.1e-79
WP_023241112.1|594504_595158_-	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	99.5	3.0e-128
WP_001059982.1|595267_595477_+	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
WP_000424166.1|595609_595888_+	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
WP_001125981.1|595922_596069_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_097362090.1|596061_596961_+	DNA replication protein	NA	E7C9R4	Salmonella_phage	98.0	1.4e-152
WP_097362091.1|596950_598387_+	AAA family ATPase	NA	K7P7N4	Enterobacteria_phage	91.2	5.9e-254
WP_001748045.1|598502_598766_+	hypothetical protein	NA	I6R992	Salmonella_phage	63.2	2.7e-24
WP_070802366.1|598768_599008_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	88.6	8.5e-33
WP_097362092.1|599021_599468_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	8.6e-79
WP_023230553.1|599464_599641_+	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	98.3	1.5e-26
WP_000566850.1|599637_599817_+	protein ninF	NA	I6R994	Salmonella_phage	94.9	1.1e-27
WP_097362093.1|599791_600400_+	protein NinG	NA	I6S604	Salmonella_phage	68.3	9.7e-57
WP_080187657.1|600396_600600_+	protein ninH	NA	Q5G8R8	Enterobacteria_phage	97.0	4.0e-31
WP_023167457.1|600580_600760_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	1.6e-23
WP_097362094.1|600756_601275_+	DUF1133 family protein	NA	A0A1R3Y5U9	Salmonella_virus	97.1	7.2e-93
WP_000738703.1|601732_602059_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_097362095.1|602042_602480_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	3.1e-73
WP_097362096.1|602476_602914_+|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	91.7	1.8e-68
WP_079896692.1|603114_603642_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	54.1	3.2e-48
WP_097362097.1|603906_604149_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	1.4e-35
WP_097362098.1|604151_604556_+	Decoration protein	NA	C6ZR73	Salmonella_phage	94.8	1.6e-63
WP_097362099.1|604568_605072_+	DNA packaging protein	NA	A0A2K8HN72	Pseudomonas_phage	47.8	4.3e-26
WP_097362100.1|605040_606489_+	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	71.1	1.3e-205
WP_097362101.1|606488_608666_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	98.1	0.0e+00
WP_097362102.1|608679_609591_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.8e-160
WP_097362103.1|609590_610883_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	99.3	1.8e-241
WP_000684729.1|610921_611131_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|611114_611615_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_097362104.1|611574_612993_+	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	90.2	2.1e-251
WP_097362105.1|613014_613560_+	endodeoxyribonuclease	NA	A0A2H4FQU5	Salmonella_phage	55.0	4.1e-46
WP_097362106.1|613552_614191_+|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	93.9	6.3e-83
WP_097362107.1|614190_614649_+	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	95.4	4.3e-81
WP_079827525.1|614657_615338_+	DNA transfer protein	NA	A0A192Y6A3	Salmonella_phage	90.9	4.1e-96
WP_079827526.1|615348_616692_+	acyltransferase	NA	A0A0M5M1J8	Salmonella_phage	95.7	1.6e-224
WP_069720947.1|618752_619076_-	hypothetical protein	NA	A0A0M3ULJ1	Salmonella_phage	94.4	6.6e-28
WP_001461300.1|619232_620219_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	47.6	2.7e-72
WP_042100707.1|620234_620486_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	7.6e-08
WP_047668238.1|620600_620753_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_047668240.1|620749_620932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361819.1|621660_622863_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_097362108.1|622905_623202_+	hypothetical protein	NA	Q8VNP5	Enterobacteria_phage	97.8	1.6e-49
WP_097362109.1|623401_625255_+|tail	phage tail protein	tail	I6S5Y0	Salmonella_phage	58.3	8.0e-187
625519:625564	attR	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCAT	NA	NA	NA	NA
>prophage 2
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	950378	1039447	4991140	portal,holin,integrase,protease,terminase,capsid,plate,tRNA,tail,transposase	Vibrio_phage(22.95%)	96	944837:944853	1047711:1047727
944837:944853	attL	GCTTTATTACCTTTTTC	NA	NA	NA	NA
WP_000027186.1|950378_951107_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
WP_001270726.1|951335_951851_-	lipoprotein	NA	NA	NA	NA	NA
WP_082324019.1|951946_953272_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	64.8	3.6e-165
WP_070789913.1|953297_953540_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.4	1.1e-22
WP_157764451.1|953547_953697_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	81.2	1.4e-17
WP_097362172.1|953693_953879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687971.1|954375_954600_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	67.1	2.5e-18
WP_097362173.1|954596_955163_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.8	4.8e-26
WP_097362174.1|955159_956065_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	79.3	5.8e-130
WP_000886591.1|956019_956415_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	73.9	3.3e-50
WP_000603102.1|956404_956641_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	62.9	2.4e-19
WP_077918404.1|956640_957018_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	53.9	4.2e-26
WP_023246559.1|956980_957190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228515.1|957377_957563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023237654.1|957559_957754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023246560.1|957746_958064_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	51.0	1.8e-17
WP_038807287.1|958243_958939_-	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	67.1	9.6e-85
WP_023237655.1|959051_959306_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	52.9	5.7e-11
WP_097362175.1|959987_961619_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	86.6	9.0e-283
WP_097362176.1|961615_962584_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	94.7	1.0e-177
WP_097362177.1|962583_963444_+	helix-turn-helix domain containing protein	NA	A0A1B5FPA6	Escherichia_phage	82.8	2.6e-132
WP_097362178.1|963440_964223_+	antitermination protein	NA	F1C595	Cronobacter_phage	72.2	4.0e-103
WP_097362179.1|964537_964750_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_005127641.1|965289_965502_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	80.9	3.2e-23
WP_097362180.1|965910_966099_+	cold-shock protein	NA	NA	NA	NA	NA
WP_097362181.1|967110_967281_-	DUF2116 family Zn-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_097362182.1|967484_967820_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	83.5	2.1e-45
WP_097362183.1|967822_968440_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.8	1.1e-95
WP_097362184.1|968436_968982_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	52.1	6.8e-09
WP_000501908.1|969159_969447_+	TonB family protein	NA	H6WZK5	Escherichia_phage	50.0	7.6e-20
WP_001292891.1|969523_969826_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	97.0	5.1e-51
WP_097362185.1|969895_970183_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.4e-29
WP_097362186.1|970272_970992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362187.1|971012_972182_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	87.9	2.7e-188
WP_097362188.1|972238_972664_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	1.8e-25
WP_097362189.1|973260_973851_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	54.4	2.4e-36
WP_020844527.1|973850_974396_+	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	37.2	2.6e-16
WP_097362190.1|974401_976261_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	63.0	7.0e-231
WP_021000635.1|976272_976512_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	6.8e-14
WP_097362191.1|976508_978071_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	63.4	1.6e-188
WP_097362192.1|978063_979128_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.4	2.6e-81
WP_097362193.1|979138_979525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071645722.1|979540_980584_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	45.2	6.3e-72
WP_097362194.1|980584_980818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362195.1|980824_981169_+	sugar transporter	NA	A0A067ZJA6	Vibrio_phage	43.9	2.7e-19
WP_097362196.1|981165_981651_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	40.0	1.1e-18
WP_097362197.1|981650_981950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362198.1|981949_983419_+|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	54.7	2.0e-148
WP_080179065.1|983431_983953_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	52.6	2.1e-47
WP_097362199.1|983962_984244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097363124.1|984950_986855_+|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	26.5	2.8e-41
WP_021000622.1|986847_987066_+	hypothetical protein	NA	A0A0C5AEF4	Bacteriophage	50.0	1.4e-10
WP_001623396.1|987055_988057_+	phage late control D	NA	A0A0C5AJ59	Bacteriophage	36.3	1.8e-55
WP_097362200.1|988057_988678_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	7.6e-33
WP_024145350.1|988674_989142_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_021000619.1|989138_989462_+	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	41.3	6.0e-13
WP_097362201.1|989458_990583_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.7	9.4e-90
WP_097362202.1|990575_991157_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	33.3	6.5e-18
WP_097362203.1|993019_993589_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.8	2.4e-94
WP_139760136.1|993624_993738_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	94.6	1.4e-09
WP_057395147.1|994330_994603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097363125.1|994599_995514_-	pyocin	NA	NA	NA	NA	NA
WP_097362188.1|995971_996397_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	1.8e-25
WP_097362187.1|996453_997623_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	87.9	2.7e-188
WP_157764452.1|997643_998489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362205.1|999116_1000013_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_001160725.1|1000955_1001279_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001202296.1|1001275_1002106_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
WP_000866907.1|1002102_1003116_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_097362206.1|1003211_1004645_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_097362207.1|1004655_1005657_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_097362208.1|1005695_1007414_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	2.2e-29
WP_000178698.1|1007571_1008540_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458785.1|1008551_1010204_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491118.1|1010347_1011247_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000599770.1|1011447_1013106_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001528818.1|1013102_1014053_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_001201743.1|1014198_1015317_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_097362209.1|1015313_1017260_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1017389_1017611_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1017934_1018255_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_097362210.1|1018285_1020562_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.4e-164
WP_000097893.1|1022138_1022816_-	hydrolase	NA	NA	NA	NA	NA
WP_097362211.1|1022835_1023696_-	pirin family protein	NA	NA	NA	NA	NA
WP_000597923.1|1023804_1024716_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001040187.1|1024806_1025025_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_097362212.1|1024952_1025336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001241643.1|1025336_1026041_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202249.1|1026085_1027807_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.3	1.9e-12
WP_001044531.1|1027807_1029574_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
WP_000537406.1|1029688_1030657_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
WP_000228469.1|1031203_1031698_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_097362213.1|1031832_1035789_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.8e-88
WP_001519746.1|1035931_1036543_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067787.1|1036552_1037896_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	4.8e-80
WP_000886699.1|1038154_1039447_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	7.3e-94
1047711:1047727	attR	GAAAAAGGTAATAAAGC	NA	NA	NA	NA
>prophage 3
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	1274278	1291118	4991140	integrase,transposase	Salmonella_phage(60.0%)	20	1264505:1264518	1277626:1277639
1264505:1264518	attL	GATTTCAGCGGTAA	NA	NA	NA	NA
WP_000444508.1|1274278_1275529_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_097362260.1|1275640_1276768_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	59.2	3.9e-120
WP_000939947.1|1276748_1276994_-	excisionase	NA	NA	NA	NA	NA
WP_057515690.1|1277357_1278185_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	99.3	1.1e-151
1277626:1277639	attR	TTACCGCTGAAATC	NA	NA	NA	NA
WP_000997190.1|1278242_1278614_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_097362261.1|1279426_1280122_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.1	2.3e-126
WP_097363128.1|1280218_1280443_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	95.9	6.8e-32
WP_000509733.1|1280471_1281026_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	2.0e-101
WP_097362262.1|1281189_1281369_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.1	1.6e-15
WP_097362263.1|1281358_1282333_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	79.9	1.6e-117
WP_023171062.1|1282334_1282817_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_097362264.1|1282816_1283470_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	87.6	2.3e-112
WP_001529171.1|1283466_1283856_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	86.8	9.2e-61
WP_097362265.1|1283872_1284673_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	70.4	5.1e-106
WP_097363129.1|1284680_1285676_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	96.4	4.6e-189
WP_097362266.1|1285697_1286387_+	antitermination protein	NA	NA	NA	NA	NA
WP_097362267.1|1286570_1287278_+	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_023196868.1|1287592_1287781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|1287968_1288427_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_097362457.1|1288547_1291118_+	shikimate transporter	NA	S4TP62	Salmonella_phage	65.6	8.4e-126
>prophage 4
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	1302876	1307296	4991140		Escherichia_phage(50.0%)	7	NA	NA
WP_000275698.1|1302876_1303290_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
WP_000733298.1|1303306_1304035_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
WP_000158843.1|1304227_1304770_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_097362273.1|1304917_1305295_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_001529135.1|1305367_1306177_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001036547.1|1306674_1306839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497451.1|1307056_1307296_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 5
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	1570533	1623171	4991140	terminase,tRNA,head,transposase	uncultured_virus(15.38%)	59	NA	NA
WP_000502119.1|1570533_1570992_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_097361819.1|1571227_1572430_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_097362339.1|1572454_1572979_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000776348.1|1573405_1573798_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000901531.1|1574144_1574240_-	protein MgtS	NA	NA	NA	NA	NA
WP_001068056.1|1574487_1575675_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000987753.1|1575902_1576805_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000783049.1|1576922_1577138_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091194.1|1577166_1577550_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843434.1|1577569_1578004_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000968968.1|1578262_1578928_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_097362340.1|1578974_1580165_-	sugar transporter	NA	NA	NA	NA	NA
WP_000366541.1|1580280_1581153_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_097362341.1|1581255_1582644_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000090081.1|1582716_1583643_+	glutaminase B	NA	NA	NA	NA	NA
WP_000992449.1|1583642_1584002_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000217098.1|1584224_1585172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000513122.1|1585227_1585770_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000758333.1|1586486_1587605_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	2.1e-113
WP_000544772.1|1587745_1588087_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_097362342.1|1588099_1588975_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_023212742.1|1588962_1590024_-	hydrogenase-1 operon protein HyaF2	NA	NA	NA	NA	NA
WP_000155977.1|1590041_1590452_-	hydrogenase	NA	NA	NA	NA	NA
WP_000334904.1|1590448_1590748_-	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_000852663.1|1590747_1591356_-	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_097362343.1|1591361_1592105_-	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000331201.1|1592055_1593858_-	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001194450.1|1593860_1594964_-	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_000976505.1|1595391_1596483_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_001518759.1|1596528_1597320_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502119.1|1597440_1597899_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_097362344.1|1598089_1599115_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000824227.1|1599089_1600376_-	MFS transporter	NA	NA	NA	NA	NA
WP_097362345.1|1600552_1602109_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_097362346.1|1602178_1603408_-	MFS transporter	NA	NA	NA	NA	NA
WP_097362347.1|1603992_1605072_+|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
WP_000233103.1|1605123_1605408_-	RidA family protein	NA	NA	NA	NA	NA
WP_157764453.1|1605302_1606541_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.6e-77
WP_097362348.1|1607026_1607560_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_097363133.1|1607556_1608087_-	lysozyme	NA	Q7Y3V3	Yersinia_phage	79.8	2.4e-80
WP_001223638.1|1608076_1608352_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	50.0	6.4e-08
WP_023248403.1|1608352_1608691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023248404.1|1608690_1609305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095471748.1|1609374_1609611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362349.1|1609617_1611660_-	tape measure protein	NA	I6NKY8	Burkholderia_phage	25.5	2.6e-13
WP_023248407.1|1611787_1612273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229605.1|1612265_1612694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362350.1|1612696_1614055_-	DUF3383 family protein	NA	A0A142IDK3	Pseudomonas_phage	20.5	2.2e-08
WP_023248410.1|1614055_1614838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024160233.1|1614837_1615191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362351.1|1615187_1615661_-	hypothetical protein	NA	A0A291LCI6	Klebsiella_phage	31.4	2.3e-05
WP_023229610.1|1615783_1616143_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_023229611.1|1616152_1616407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047641913.1|1616410_1617349_-	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	30.8	2.9e-28
WP_047658565.1|1617366_1618158_-	Ig-like domain-containing protein	NA	H6X4V3	Enterobacteria_phage	52.4	8.3e-08
WP_069722114.1|1618157_1619168_-	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	34.8	3.4e-14
WP_097362352.1|1619145_1620501_-|head	phage head morphogenesis protein	head	NA	NA	NA	NA
WP_097362353.1|1620487_1621816_-	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_097362354.1|1621812_1623171_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	35.1	7.2e-68
>prophage 6
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	1825179	1831924	4991140	integrase	Salmonella_phage(28.57%)	10	1824938:1824951	1829233:1829246
1824938:1824951	attL	TATGCCTTACGATA	NA	NA	NA	NA
WP_097362415.1|1825179_1825494_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	85.1	2.1e-39
WP_097362416.1|1825872_1826298_-	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_097362417.1|1826224_1826524_-	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	55.7	1.1e-13
WP_097362418.1|1826562_1826703_-	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	5.0e-09
WP_097362419.1|1826952_1827135_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	76.1	3.0e-22
WP_097362420.1|1827441_1828329_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.1	7.3e-37
WP_157764476.1|1828708_1829110_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	M9NZA5	Enterobacteria_phage	61.2	1.1e-32
WP_097362421.1|1829233_1830124_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
1829233:1829246	attR	TATGCCTTACGATA	NA	NA	NA	NA
WP_001128869.1|1830123_1831116_+	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_000230462.1|1831117_1831924_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 7
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	1984504	2069760	4991140	portal,holin,integrase,lysis,protease,terminase,capsid,head,tail,transposase	Enterobacteria_phage(32.73%)	94	2010039:2010054	2077742:2077757
WP_000502119.1|1984504_1984963_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000984498.1|1985155_1986037_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|1986229_1988278_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|1988297_1988984_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|1989081_1989666_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207293.1|1989707_1990991_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001521100.1|1990959_1993593_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001633706.1|1993670_1995110_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_000978523.1|1995224_1995464_+	YebV family protein	NA	NA	NA	NA	NA
WP_000457838.1|1995574_1995766_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986166.1|1995784_1996435_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	8.5e-59
WP_001134848.1|1996659_1996824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088523926.1|1997108_1997831_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422887.1|1998514_1998910_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
WP_076166090.1|1999238_1999715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000143844.1|2001304_2001589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076737135.1|2001772_2001976_+	fimbrial protein	NA	NA	NA	NA	NA
WP_097362452.1|2002672_2003686_+	acyltransferase	NA	NA	NA	NA	NA
WP_072274730.1|2006364_2006523_+	lipopolysaccharide 1,2-N-acetylglucosaminetransferase	NA	NA	NA	NA	NA
WP_000354410.1|2006758_2007178_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000007801.1|2007306_2007507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001611547.1|2007546_2007816_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	2.6e-06
WP_001604859.1|2007981_2008122_+	hypothetical protein	NA	NA	NA	NA	NA
2010039:2010054	attL	CCTGGCTCAACAAGGG	NA	NA	NA	NA
WP_001233453.1|2010322_2011237_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2011369_2011528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362453.1|2011537_2012152_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_097362454.1|2013000_2014163_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.4	9.6e-53
WP_097362455.1|2014601_2015732_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_097362456.1|2016860_2017205_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	47.3	6.3e-21
WP_000480002.1|2018190_2018892_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	29.2	1.3e-15
WP_079844650.1|2019351_2019507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093795.1|2020121_2020334_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	92.9	1.6e-27
WP_000842530.1|2020330_2020732_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	89.7	4.7e-60
WP_125468752.1|2020803_2020917_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	91.9	1.8e-09
WP_000836776.1|2020990_2021224_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	97.4	1.4e-35
WP_023204696.1|2021498_2022140_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001555470.1|2022310_2022829_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	3.5e-47
WP_097362457.1|2022843_2025414_-	shikimate transporter	NA	S4TP62	Salmonella_phage	65.6	8.4e-126
WP_000178851.1|2025469_2025712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362458.1|2025750_2029113_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.2	0.0e+00
WP_023197193.1|2029175_2029823_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	79.1	4.2e-90
WP_097362459.1|2029720_2030458_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.2	1.3e-127
WP_001534642.1|2030464_2031163_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	3.2e-104
WP_064240006.1|2031172_2031502_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	2.1e-42
WP_097362460.1|2031504_2034600_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.4	1.0e-274
WP_097362461.1|2034571_2034910_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	61.5	2.3e-31
WP_000479607.1|2034906_2035302_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_023261793.1|2035352_2036096_-|tail	major tail-like protein	tail	A0A291AWU6	Escherichia_phage	76.9	4.3e-99
WP_097362462.1|2036106_2036508_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	1.8e-51
WP_000677088.1|2036504_2037083_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
WP_097362463.1|2037069_2037447_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.2e-28
WP_023240757.1|2037457_2037817_-	gifsy-1 prophage DNA packaging protein gp9	NA	NA	NA	NA	NA
WP_000522566.1|2037874_2038903_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_097362464.1|2038957_2039305_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	3.2e-20
WP_023241368.1|2039317_2040814_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	7.4e-98
WP_097362465.1|2040803_2042384_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	1.2e-188
WP_000201415.1|2042380_2042584_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_097362466.1|2042567_2044499_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.8e-258
WP_001102153.1|2044470_2045016_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669689.1|2045301_2045703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097363136.1|2045929_2046376_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.6	5.8e-67
WP_000984586.1|2046393_2046846_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2046829_2047159_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2047434_2048121_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798706.1|2048481_2048931_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|2049066_2049192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2049425_2049950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2050046_2050736_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2050865_2051093_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_097362467.1|2051089_2051689_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.4	1.6e-96
WP_157764477.1|2051752_2052058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157764459.1|2052329_2053022_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	46.8	2.4e-19
WP_097362471.1|2053260_2053656_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	38.8	1.4e-19
WP_157764460.1|2053669_2054128_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.5	1.1e-65
WP_157764478.1|2054120_2054630_-	prepilin peptidase	NA	A0A0U2RT81	Escherichia_phage	69.6	1.4e-61
WP_097361819.1|2054760_2055963_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_001534383.1|2056479_2056974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033909.1|2056960_2057215_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_023165607.1|2057311_2057737_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
WP_001669535.1|2058188_2058503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362473.1|2058934_2059219_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_097362474.1|2059293_2059650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362476.1|2060484_2063175_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.3	1.7e-116
WP_076735565.1|2063167_2063998_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	8.5e-104
WP_001033921.1|2064033_2064354_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_047598971.1|2064346_2064679_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	74.2	3.8e-15
WP_000276802.1|2065289_2065469_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_077907363.1|2065759_2065996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038390080.1|2066056_2066329_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
WP_058661598.1|2066309_2067389_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.0e-101
WP_000722368.1|2067771_2068125_-	YebY family protein	NA	NA	NA	NA	NA
WP_001633680.1|2068141_2069017_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2069017_2069392_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856225.1|2069529_2069760_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
2077742:2077757	attR	CCCTTGTTGAGCCAGG	NA	NA	NA	NA
>prophage 8
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	2279686	2290193	4991140		Enterobacteria_phage(37.5%)	10	NA	NA
WP_097362520.1|2279686_2281000_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_097362521.1|2281026_2282106_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	2.3e-16
WP_000648783.1|2282110_2282884_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_097362522.1|2282899_2283874_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_097362523.1|2283879_2284431_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.9e-52
WP_097362524.1|2284431_2285310_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	6.6e-107
WP_001023664.1|2285357_2286257_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_094915008.1|2286256_2287342_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.6e-102
WP_000981469.1|2287718_2288612_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_097362525.1|2288789_2290193_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.8e-21
>prophage 9
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	2359025	2368196	4991140	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
WP_097362540.1|2359025_2361059_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703136.1|2361299_2361758_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_097362541.1|2361929_2362460_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	33.1	7.2e-16
WP_000950412.1|2362516_2362984_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
WP_000598637.1|2363030_2363750_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2363746_2365432_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2365654_2366386_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2366445_2366553_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2366533_2367265_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2367248_2368196_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 10
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	2443140	2459330	4991140	tRNA	Escherichia_phage(18.18%)	17	NA	NA
WP_097362554.1|2443140_2443719_+	Rha family transcriptional regulator	NA	A0A1X9SFL9	Acinetobacter_phage	51.9	2.2e-18
WP_097362555.1|2443785_2443983_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	37.7	1.2e-05
WP_097362556.1|2444215_2444434_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_157764461.1|2444474_2444660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362558.1|2444652_2444865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075912582.1|2444851_2445040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362559.1|2445044_2445389_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097362560.1|2445385_2446027_+	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	47.3	3.0e-24
WP_097362561.1|2446037_2448176_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	54.0	4.2e-179
WP_097362562.1|2448891_2449611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362563.1|2449620_2450733_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	32.0	1.4e-37
WP_097362564.1|2451046_2453521_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.1	0.0e+00
WP_097362565.1|2453524_2455333_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	70.9	5.7e-238
WP_097363138.1|2455329_2457645_-	transglycosylase SLT domain-containing protein	NA	A0A193GYI3	Enterobacter_phage	35.0	6.0e-107
WP_097362566.1|2458073_2458373_+	hypothetical protein	NA	A0A2H4JEE3	uncultured_Caudovirales_phage	40.3	7.4e-10
WP_097362567.1|2458435_2458945_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	41.8	6.1e-20
WP_097363139.1|2459084_2459330_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	46.5	3.6e-10
>prophage 11
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	2652318	2716341	4991140	portal,holin,integrase,lysis,terminase,capsid,tRNA,head,tail,transposase	Cronobacter_phage(29.73%)	75	2654509:2654526	2721883:2721900
WP_000695623.1|2652318_2653734_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
2654509:2654526	attL	CGTAGGCCGGATAAGACG	NA	NA	NA	NA
WP_097362599.1|2654753_2655638_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000658727.1|2655689_2655848_-	DUF1427 family protein	NA	NA	NA	NA	NA
WP_097362600.1|2655906_2657163_-	nucleoside permease	NA	NA	NA	NA	NA
WP_080084751.1|2657217_2658051_-	xanthosine phosphorylase	NA	NA	NA	NA	NA
WP_097362601.1|2658306_2659068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079846664.1|2659133_2660060_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.0e-09
WP_000765570.1|2660149_2661148_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_097362602.1|2661144_2661363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023201637.1|2661364_2663380_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.8	3.4e-146
WP_000983114.1|2663451_2664438_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000255004.1|2664669_2665431_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_097362603.1|2665741_2666713_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	9.7e-75
WP_000487600.1|2667096_2667354_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_097362604.1|2667402_2669130_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_000522253.1|2669170_2669680_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000844541.1|2669843_2670083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362605.1|2670079_2670946_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_097362606.1|2671028_2672321_+	transcriptional regulator PtsJ	NA	NA	NA	NA	NA
WP_097362607.1|2672335_2673055_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000710732.1|2673113_2673497_+	YfeK family protein	NA	NA	NA	NA	NA
WP_097361819.1|2673658_2674861_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_023215014.1|2674901_2675510_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_079962028.1|2675761_2676673_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	3.5e-58
WP_000021063.1|2676793_2677891_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	32.7	2.1e-25
WP_000852705.1|2677880_2678756_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000881746.1|2678755_2679589_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_097362608.1|2679588_2680605_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517460.1|2680762_2681554_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
WP_000502119.1|2681774_2682233_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000084583.1|2682503_2683403_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
WP_079957152.1|2683516_2684524_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	75.2	5.2e-148
WP_079957158.1|2684587_2684890_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.8	2.4e-32
WP_024154184.1|2684995_2685403_+	hypothetical protein	NA	A0A0A7NPS5	Enterobacteria_phage	61.7	1.2e-39
WP_154706498.1|2685405_2685582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362609.1|2685614_2685830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362610.1|2685842_2686565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058215087.1|2686644_2686887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070809214.1|2686892_2687096_+	LapA family protein	NA	NA	NA	NA	NA
WP_020844111.1|2687065_2687257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362611.1|2687332_2687773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023207951.1|2687769_2688027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362612.1|2688014_2688548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362613.1|2688544_2688784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362614.1|2688780_2689764_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B2IE38	Erwinia_phage	43.4	1.7e-55
WP_079966317.1|2689763_2690069_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	58.6	8.7e-22
WP_079966318.1|2690065_2690623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362615.1|2690619_2691738_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	66.3	1.2e-137
WP_097362616.1|2691734_2694239_+	replication protein	NA	A0A0M4RTM8	Salmonella_phage	47.3	4.6e-177
WP_079942877.1|2694231_2694642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362617.1|2694744_2695020_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	45.6	5.6e-12
WP_097363142.1|2695063_2696128_-|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	43.7	2.1e-83
WP_097362618.1|2696124_2697927_-|terminase	terminase	terminase	Q94MZ6	Haemophilus_virus	51.3	1.1e-172
WP_097362619.1|2698014_2699262_+	hypothetical protein	NA	R9TRS3	Vibrio_phage	35.4	1.3e-23
WP_097363143.1|2699315_2700371_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	53.0	7.8e-86
WP_080162609.1|2700392_2701094_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	48.1	7.3e-56
WP_097362620.1|2701192_2701693_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	36.4	1.8e-24
WP_097362621.1|2701697_2702180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362622.1|2702176_2702920_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	40.2	9.5e-38
WP_097362623.1|2702923_2704048_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	51.7	4.5e-100
WP_079957232.1|2704051_2704513_+	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	57.5	3.0e-42
WP_080162602.1|2704521_2704860_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_097362624.1|2704856_2705300_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.9	3.6e-45
WP_097362625.1|2705306_2705771_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.2	1.3e-32
WP_097362626.1|2705824_2706097_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	59.3	1.8e-18
WP_157764462.1|2706147_2706285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362627.1|2706284_2708366_+|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	38.0	3.6e-103
WP_080162597.1|2708369_2708708_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	58.0	5.3e-28
WP_080162596.1|2708697_2709876_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	61.6	2.2e-137
WP_097362628.1|2709868_2710441_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	55.7	3.5e-56
WP_080162593.1|2712283_2712997_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	71.8	2.6e-45
WP_080162592.1|2713004_2713385_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.6	6.8e-16
WP_080162608.1|2713450_2714131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362629.1|2714093_2714669_+	DNA-binding protein	NA	F1BUJ9	Cronobacter_phage	42.2	1.5e-22
WP_097363144.1|2714700_2716341_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	39.4	9.8e-104
2721883:2721900	attR	CGTAGGCCGGATAAGACG	NA	NA	NA	NA
>prophage 12
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	3118047	3162839	4991140	holin,integrase,lysis,head,tail,transposase	Salmonella_phage(60.98%)	55	3121774:3121793	3163005:3163024
WP_000081498.1|3118047_3119040_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_097362702.1|3119102_3120236_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_097362703.1|3120411_3121038_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
WP_001221538.1|3121031_3121793_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.8	1.4e-57
3121774:3121793	attL	TTACTCAGCAATATGCGCAT	NA	NA	NA	NA
WP_157764465.1|3122206_3122380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024154044.1|3122489_3122906_-|tail	tail assembly protein	tail	S5FXM8	Shigella_phage	36.6	3.0e-17
WP_097362704.1|3122909_3124151_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	93.5	8.9e-73
WP_097362705.1|3124150_3124831_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	1.4e-128
WP_080089348.1|3124827_3126027_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	3.2e-213
WP_023239325.1|3126027_3126381_-	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	96.6	3.5e-59
WP_000301078.1|3126380_3127133_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000027041.1|3127192_3127573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023221857.1|3127569_3128343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362706.1|3128484_3128826_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	87.0	1.1e-33
WP_097362707.1|3128829_3129891_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	92.7	7.4e-177
WP_097362708.1|3129893_3130196_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	97.0	1.8e-51
WP_097362709.1|3130195_3130771_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	92.7	1.5e-91
WP_097362710.1|3130770_3132852_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	61.0	2.2e-225
WP_085397674.1|3133029_3133455_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.7	2.7e-37
WP_000257261.1|3133458_3133899_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_097362711.1|3133910_3135056_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.6	4.1e-165
WP_097362712.1|3135059_3135623_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	77.0	9.5e-83
WP_097362713.1|3135597_3135987_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	97.7	7.8e-68
WP_023200782.1|3135973_3136522_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.5	1.1e-78
WP_097362714.1|3136518_3136926_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.1	3.7e-68
WP_097362715.1|3136891_3137281_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	64.3	1.5e-34
WP_000627463.1|3137322_3138264_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_012664449.1|3138275_3138752_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	100.0	7.3e-84
WP_097362717.1|3139359_3139833_-	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	64.1	1.4e-47
WP_097362718.1|3139917_3140622_-	peptidase M41 family protein	NA	NA	NA	NA	NA
WP_097362719.1|3140778_3140973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362720.1|3140979_3141543_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_097362721.1|3142142_3144914_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.3	1.5e-285
WP_097362722.1|3144924_3145551_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	42.3	8.8e-37
WP_097362723.1|3145547_3145763_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097362724.1|3145774_3145978_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	51.6	3.2e-12
WP_097362725.1|3145995_3146196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362726.1|3146404_3147280_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_097362727.1|3147272_3147545_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_097363147.1|3147857_3148925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080072959.1|3149098_3149380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080072958.1|3149408_3149744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702604.1|3149883_3150096_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_097362728.1|3150237_3151467_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	38.1	2.4e-70
WP_097362729.1|3151682_3152915_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	96.6	2.6e-226
WP_138010671.1|3152929_3153667_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_097362730.1|3153551_3155021_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	9.9e-281
WP_001130808.1|3155020_3156643_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_097362731.1|3156645_3157275_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.6	1.9e-108
WP_097363148.1|3157781_3158225_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	82.8	2.7e-56
WP_097362732.1|3158257_3158872_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	5.9e-110
WP_070802519.1|3158874_3159222_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	81.3	3.4e-46
WP_097362733.1|3159454_3159952_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	53.3	8.2e-38
WP_097361819.1|3160423_3161626_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_157764466.1|3161672_3162839_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.5	1.4e-72
3163005:3163024	attR	TTACTCAGCAATATGCGCAT	NA	NA	NA	NA
>prophage 13
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	3486848	3528473	4991140	portal,lysis,integrase,terminase,capsid,plate,tRNA,head,tail	Salmonella_phage(77.27%)	51	3484544:3484564	3534387:3534407
3484544:3484564	attL	CCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_001264396.1|3486848_3487862_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	6.3e-109
WP_001144069.1|3488089_3488305_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_097362803.1|3488540_3490286_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3490435_3492283_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3492406_3492913_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_024146528.1|3493250_3493469_-	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	75.0	4.9e-27
WP_097362804.1|3493538_3494639_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	1.7e-184
WP_097362805.1|3494635_3495121_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	94.4	1.7e-72
WP_097362806.1|3495117_3498192_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	82.2	0.0e+00
WP_023206368.1|3498184_3498304_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	5.7e-14
WP_032636603.1|3498318_3498621_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	97.0	1.4e-43
WP_024552851.1|3498675_3499191_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	5.1e-91
WP_023226484.1|3499200_3500373_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	5.0e-211
WP_097362807.1|3500509_3501106_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.9	5.6e-49
WP_097362808.1|3501105_3502365_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	50.7	1.8e-126
WP_033146262.1|3502361_3502967_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	94.5	1.1e-111
WP_097362809.1|3502959_3503868_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
WP_023306992.1|3503854_3504214_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	93.3	8.3e-56
WP_058657798.1|3504210_3504789_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	1.1e-105
WP_097362810.1|3504857_3505304_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.7	2.1e-64
WP_058111945.1|3505296_3505728_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
WP_097362812.1|3505823_3506249_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.2	5.5e-67
WP_010835207.1|3506248_3506626_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	97.6	1.5e-60
WP_097362813.1|3506630_3507140_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	6.4e-94
WP_000171565.1|3507120_3507336_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_069914526.1|3507339_3507543_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	1.5e-33
WP_063144838.1|3507542_3508007_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	97.4	3.2e-84
WP_097362814.1|3508100_3508751_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	7.1e-114
WP_097362815.1|3508754_3509816_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.2	1.0e-194
WP_097362816.1|3509832_3510666_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	96.4	2.1e-126
WP_097362817.1|3510808_3512575_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.6	0.0e+00
WP_097362818.1|3512574_3513300_+|terminase	terminase-like family protein	terminase	Q9ZXM5	Pseudomonas_virus	41.7	2.9e-23
WP_045307532.1|3513296_3514352_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	1.8e-175
WP_097363150.1|3514654_3516235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362819.1|3516322_3516871_-	3'-5' exoribonuclease	NA	A0A2I7R2S7	Vibrio_phage	41.8	2.0e-32
WP_001217561.1|3517041_3517275_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154443.1|3517287_3517476_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_097362820.1|3517637_3520046_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.6	0.0e+00
WP_097362821.1|3520036_3520897_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	82.5	3.4e-132
WP_097362822.1|3520893_3521121_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.3e-35
WP_001744223.1|3521120_3521354_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_013098807.1|3521421_3521763_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	7.6e-51
WP_015386352.1|3521726_3521927_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_023206291.1|3521934_3522444_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.7e-83
WP_015386350.1|3522478_3522715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362823.1|3522816_3523431_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.9	1.7e-37
WP_023223462.1|3523455_3524004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023223463.1|3524009_3525023_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.5	9.7e-118
WP_000213762.1|3525261_3526029_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_001582501.1|3526260_3526908_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478462.1|3526904_3528473_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
3534387:3534407	attR	CCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
>prophage 14
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	3649294	3754604	4991140	portal,holin,integrase,protease,terminase,capsid,plate,tRNA,head,tail	Salmonella_phage(41.86%)	107	3650693:3650720	3759030:3759057
WP_000366112.1|3649294_3649795_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
WP_097362847.1|3649800_3650439_-	stringent starvation protein A	NA	NA	NA	NA	NA
3650693:3650720	attL	ATAAAAAAACCCGCCGAAGCGGGTTTTT	NA	NA	NA	NA
WP_000829815.1|3650752_3651145_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|3651160_3651589_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_097362848.1|3651890_3653015_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001519074.1|3653207_3653606_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_000716690.1|3653762_3655130_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
WP_000497705.1|3655222_3656293_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_097362849.1|3656326_3657025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362850.1|3657077_3658379_-	oxalacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_097362851.1|3658391_3660167_-	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_080167297.1|3660182_3660425_-	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_097362852.1|3660581_3661199_-	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000045349.1|3661198_3662098_-	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000433390.1|3662130_3663399_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
WP_001171581.1|3663609_3664275_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000723776.1|3664261_3664891_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000861586.1|3665010_3665949_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257852.1|3666363_3666834_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695693.1|3667198_3667462_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_097362853.1|3667565_3667832_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001103887.1|3667891_3668164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510913.1|3668335_3670303_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000855138.1|3670308_3671241_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051840.1|3671248_3671452_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440300.1|3671633_3672563_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055936.1|3672684_3674130_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_097362854.1|3674274_3678075_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123188.1|3678185_3679655_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000210306.1|3679644_3680238_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000226619.1|3680246_3680738_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802538.1|3680737_3681790_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|3681854_3682898_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241381.1|3683205_3685146_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148254.1|3685349_3686324_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000723876.1|3686436_3687441_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240053.1|3687441_3688041_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000354628.1|3688433_3688904_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884627.1|3688914_3690264_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000340017.1|3690372_3690615_+	YhdT family protein	NA	NA	NA	NA	NA
WP_001175684.1|3690604_3692056_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_001145849.1|3692067_3692949_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219664.1|3693609_3694575_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_097362855.1|3694600_3694897_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_097362856.1|3696346_3696601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362857.1|3697233_3697650_-|tail	phage tail protein	tail	A0A1B0V844	Salmonella_phage	43.5	2.9e-20
WP_097362858.1|3697653_3698766_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	96.3	5.7e-55
WP_024154071.1|3698752_3699340_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	4.1e-113
WP_097362859.1|3699342_3700422_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	96.1	3.1e-199
WP_000605053.1|3700414_3700828_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	94.9	3.3e-72
WP_097362860.1|3700832_3701366_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.3	6.0e-95
WP_097362861.1|3701365_3702424_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	96.9	1.3e-197
WP_097362862.1|3702420_3703761_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	98.9	2.6e-248
WP_097362863.1|3703794_3705723_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.5	0.0e+00
WP_000588852.1|3705807_3706134_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|3706130_3706487_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_097362864.1|3706486_3707983_-|tail	phage tail protein	tail	A0A192Y7L1	Salmonella_phage	99.2	1.2e-276
WP_000497739.1|3707972_3708137_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_097362865.1|3708140_3708701_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	96.2	9.1e-102
WP_097362866.1|3708697_3709210_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	97.1	9.6e-90
WP_097362867.1|3709181_3709595_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	87.4	8.3e-60
WP_000886224.1|3709608_3709932_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_157764468.1|3709938_3710322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362869.1|3710226_3711444_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.6	3.5e-199
WP_085386035.1|3711453_3712302_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.9	1.2e-132
WP_085386036.1|3712315_3713620_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	89.2	7.6e-224
WP_085386037.1|3713619_3715362_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	6.5e-138
WP_097362870.1|3715315_3715780_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	9.7e-49
WP_024134785.1|3715911_3716256_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	74.8	1.8e-47
WP_001252717.1|3716323_3716827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362871.1|3716929_3717472_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_097362872.1|3717468_3718083_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	2.9e-109
WP_001527046.1|3718085_3718430_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_097362873.1|3719753_3720158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362874.1|3720273_3721110_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	76.1	5.3e-122
WP_097363155.1|3721106_3721985_-	helix-turn-helix domain containing protein	NA	F1C596	Cronobacter_phage	74.2	4.3e-122
WP_070801493.1|3722133_3722529_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_097362875.1|3722525_3724667_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.8	1.0e-193
WP_097362876.1|3724677_3725325_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	42.8	1.9e-34
WP_023228479.1|3725317_3725701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080206327.1|3725790_3726096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097362877.1|3726092_3726863_-	transcriptional regulator	NA	B6SD51	Bacteriophage	29.4	2.9e-13
WP_097362878.1|3726855_3727209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080171046.1|3727201_3727429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080171044.1|3727584_3727983_-	DNA primase	NA	A0A286SGR4	Klebsiella_phage	55.9	8.1e-12
WP_157764469.1|3728129_3728417_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	46.8	2.1e-17
WP_097362880.1|3728610_3728943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097362881.1|3729007_3729658_-	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	47.1	7.0e-21
WP_097362882.1|3729678_3729963_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_097362883.1|3730123_3731029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097363156.1|3731121_3732354_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	61.7	1.7e-156
WP_000642611.1|3732817_3733702_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
WP_000620015.1|3733784_3733949_+	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
WP_001145337.1|3734098_3736198_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
WP_001085721.1|3736200_3736863_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_058111907.1|3737275_3738433_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000825645.1|3741795_3742017_+	membrane protein	NA	NA	NA	NA	NA
WP_000795911.1|3748411_3748564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285635.1|3748677_3749232_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_001070577.1|3749207_3749465_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_097363157.1|3749461_3750280_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001063621.1|3750284_3750857_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	27.2	2.9e-10
WP_001129708.1|3750861_3751404_-	DNA topoisomerase	NA	NA	NA	NA	NA
WP_000460663.1|3751430_3751904_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_097362884.1|3751875_3753000_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000114987.1|3753131_3753641_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_097362885.1|3753656_3754604_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
3759030:3759057	attR	ATAAAAAAACCCGCCGAAGCGGGTTTTT	NA	NA	NA	NA
>prophage 15
NZ_CP022663	Salmonella enterica subsp. enterica strain RM11065 chromosome, complete genome	4991140	4880702	4889642	4991140	integrase	Enterobacteria_phage(83.33%)	9	4876586:4876599	4888449:4888462
4876586:4876599	attL	CAGCGCTTACGCGC	NA	NA	NA	NA
WP_000772664.1|4880702_4881971_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
WP_097363090.1|4882456_4883398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097363091.1|4883836_4884403_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	1.0e-60
WP_000984205.1|4884418_4884664_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	1.6e-31
WP_001527419.1|4884660_4885398_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	2.6e-80
WP_031619085.1|4886201_4886753_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.7	5.0e-28
WP_001527194.1|4886749_4886977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472077.1|4886973_4887294_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_097363092.1|4887308_4889642_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.8	0.0e+00
4888449:4888462	attR	CAGCGCTTACGCGC	NA	NA	NA	NA
>prophage 1
NZ_CP022661	Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-1, complete sequence	143770	92772	131477	143770	transposase,integrase	Escherichia_phage(27.27%)	28	109446:109459	135160:135173
WP_097361910.1|92772_93720_+|integrase	site-specific integrase	integrase	A0A166YH27	Gordonia_phage	29.4	2.5e-06
WP_097361872.1|93730_95866_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_097361873.1|96998_97388_-	plasmid stability protein	NA	A0A222YWJ6	Escherichia_phage	36.4	9.4e-05
WP_097361874.1|97392_98367_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	43.8	6.7e-68
WP_080077575.1|98650_99049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042313791.1|99051_99681_-	ParA family protein	NA	A0A0K1Y6H3	Rhodobacter_phage	41.5	1.4e-29
WP_097361875.1|100100_100352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361876.1|100959_101151_+	glycogen synthase	NA	NA	NA	NA	NA
WP_080077616.1|101373_102030_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	46.2	3.5e-20
WP_097361877.1|102486_103485_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A0B5A2A5	Yersinia_phage	42.6	1.5e-22
WP_097361878.1|103636_104344_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.1	1.4e-19
WP_097361879.1|104376_105678_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_097361880.1|105700_106699_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_097361881.1|106737_108288_+	gluconate permease	NA	NA	NA	NA	NA
WP_097361882.1|108501_109284_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	6.0e-51
WP_097361883.1|109280_109715_-	hypothetical protein	NA	NA	NA	NA	NA
109446:109459	attL	AGGAAAAATAATGC	NA	NA	NA	NA
WP_097361884.1|109811_110093_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_097361885.1|110094_110400_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_097361886.1|110401_110620_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_097361887.1|111185_111800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361888.1|114164_114569_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	94.0	8.4e-65
WP_097361889.1|115670_116609_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_097361890.1|116707_120832_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_157764437.1|120927_126342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157764438.1|127223_127376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361895.1|129119_129374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361896.1|129559_130432_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	9.9e-71
WP_097361897.1|130709_131477_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.5	3.8e-50
135160:135173	attR	AGGAAAAATAATGC	NA	NA	NA	NA
