The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023706	Edwardsiella tarda strain KC-Pc-HB1 chromosome, complete genome	3638764	16138	59736	3638764	terminase,head,capsid,lysis,tail,portal	Enterobacteria_phage(42.86%)	53	NA	NA
WP_097363877.1|16138_16726_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	84.0	6.0e-88
WP_157757856.1|16755_17607_+	hypothetical protein	NA	K7P7Q7	Enterobacteria_phage	39.2	3.2e-13
WP_097363879.1|17606_18188_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	44.8	2.9e-34
WP_097363880.1|18217_18745_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	43.5	3.6e-31
WP_097363881.1|18744_21462_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q1MVL8	Enterobacteria_phage	40.6	6.6e-121
WP_097363882.1|21534_22197_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	29.6	4.7e-12
WP_097363883.1|22249_23251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097363884.1|23247_26367_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	57.5	0.0e+00
WP_097363885.1|26440_27091_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.3	9.7e-71
WP_097363886.1|26988_27726_-	C40 family peptidase	NA	S5MQI8	Escherichia_phage	71.6	1.2e-104
WP_097363887.1|27731_28433_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	67.2	7.7e-90
WP_005293572.1|28659_28989_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	59.6	4.0e-33
WP_097363888.1|28988_31832_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	36.5	5.3e-81
WP_097363889.1|31821_32145_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	40.6	2.3e-12
WP_097364682.1|32153_32549_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	35.7	1.5e-05
WP_097363890.1|32611_33382_-|tail	phage tail protein	tail	K7P6G8	Enterobacteria_phage	42.9	1.3e-37
WP_005285669.1|33385_33799_-	hypothetical protein	NA	Q9EYD7	Enterobacteria_phage	36.9	3.0e-17
WP_005293565.1|33795_34371_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_005285665.1|34379_34739_-|tail	tail attachment protein	tail	E4WL27	Enterobacteria_phage	48.7	1.7e-24
WP_068871537.1|34750_35134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005285662.1|35190_36219_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	6.1e-112
WP_005285660.1|36287_36626_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.4	1.4e-20
WP_097363891.1|36658_38146_-	S49 family peptidase	NA	O64320	Escherichia_phage	54.1	5.2e-104
WP_097363892.1|38135_39728_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.3	1.6e-188
WP_097363893.1|39724_39934_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	45.9	3.4e-09
WP_097363894.1|39936_41856_-|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	64.0	6.3e-251
WP_005285642.1|41827_42334_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	50.0	4.9e-38
WP_097364683.1|43068_43473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157757857.1|43576_43834_-	hypothetical protein	NA	Q8SBD8	Shigella_phage	64.3	3.6e-21
WP_097363896.1|44553_45072_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	68.6	4.0e-59
WP_005293540.1|45339_45555_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	56.1	5.0e-16
WP_157757858.1|45587_45830_-	hypothetical protein	NA	K7PKT0	Enterobacteria_phage	34.2	5.8e-05
WP_005285628.1|46028_46568_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	73.7	9.2e-75
WP_116605073.1|46573_46846_-|lysis	lysis protein	lysis	Q7Y3V4	Yersinia_phage	38.9	1.8e-10
WP_097363897.1|47031_47310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097363898.1|48156_48927_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	50.0	2.6e-67
WP_097363899.1|48946_49990_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	40.2	4.8e-64
WP_097363900.1|49989_50208_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	44.1	6.6e-08
WP_097363901.1|50204_50891_-	Rha family transcriptional regulator	NA	A0A1W6DWH5	Salmonella_phage	67.9	9.4e-24
WP_097363902.1|51196_52042_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_097363903.1|52071_52440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_097363905.1|52794_53532_-	DNA replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	46.5	1.1e-46
WP_097363906.1|53528_54437_-	conserved phage C-terminal domain-containing protein	NA	A0A1V0E8B1	Vibrio_phage	45.5	7.1e-11
WP_097363907.1|54433_54613_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097363908.1|54799_55342_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.4	6.1e-26
WP_078000140.1|55435_55666_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	65.8	9.4e-21
WP_097363909.1|55767_56439_+	LexA family transcriptional repressor	NA	A0A077KGZ5	Edwardsiella_phage	78.3	5.7e-74
WP_097364684.1|56446_56878_+	hypothetical protein	NA	C6ZR46	Salmonella_phage	84.1	7.6e-64
WP_097363910.1|56864_57203_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	72.3	8.1e-29
WP_097363911.1|57838_58066_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_097363912.1|58078_58624_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_097363913.1|58975_59326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157757859.1|59511_59736_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	64.4	5.2e-08
>prophage 2
NZ_CP023706	Edwardsiella tarda strain KC-Pc-HB1 chromosome, complete genome	3638764	474947	481378	3638764		Escherichia_phage(50.0%)	7	NA	NA
WP_097364009.1|474947_476012_-	glycoside hydrolase family 99-like domain-containing protein	NA	A0A1V0SDW6	Indivirus	28.5	6.1e-30
WP_097364690.1|476001_476511_-	CatB-related O-acetyltransferase	NA	A0A1J0F9G1	Only_Syngen_Nebraska_virus	59.5	2.2e-06
WP_097364010.1|476686_477889_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_097364011.1|477885_478434_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	62.1	1.0e-57
WP_097364012.1|478477_479359_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.1	6.9e-104
WP_077999255.1|479399_480290_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.1	3.7e-28
WP_097364013.1|480289_481378_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.3	4.1e-98
>prophage 3
NZ_CP023706	Edwardsiella tarda strain KC-Pc-HB1 chromosome, complete genome	3638764	797839	808409	3638764	integrase,transposase	Enterobacteria_phage(85.71%)	12	799644:799657	815852:815865
WP_097364082.1|797839_798534_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	88.3	1.9e-120
WP_097364083.1|799020_801357_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	80.1	0.0e+00
799644:799657	attL	CATCCCCGCCGGTA	NA	NA	NA	NA
WP_097364084.1|801371_801692_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_045425703.1|801688_801916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097364085.1|801912_802464_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	5.2e-33
WP_097364086.1|802460_802727_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	8.9e-31
WP_097364087.1|803299_804052_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	43.8	1.4e-44
WP_071881907.1|804048_804291_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.5	3.8e-20
WP_097364088.1|804305_804881_+	phage polarity suppression protein	NA	NA	NA	NA	NA
WP_097364695.1|805197_806307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157757867.1|806311_807229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097364089.1|807233_808409_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.0	1.1e-144
815852:815865	attR	TACCGGCGGGGATG	NA	NA	NA	NA
>prophage 4
NZ_CP023706	Edwardsiella tarda strain KC-Pc-HB1 chromosome, complete genome	3638764	1179532	1243137	3638764	terminase,head,capsid,integrase,plate,tRNA,tail,holin,portal	Cronobacter_phage(43.24%)	65	1185753:1185803	1216659:1216709
WP_047060505.1|1179532_1180558_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	6.6e-106
WP_005295814.1|1180771_1180987_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_035597148.1|1181177_1182926_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.7	2.7e-75
WP_005281642.1|1183161_1185003_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_068871231.1|1185091_1185586_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
1185753:1185803	attL	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
WP_097364147.1|1186404_1188144_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	50.1	1.6e-120
WP_097364148.1|1188121_1188706_-	hypothetical protein	NA	A5X9J7	Aeromonas_virus	52.2	3.2e-33
WP_097364149.1|1188702_1189572_-	hypothetical protein	NA	Q94MX8	Haemophilus_virus	33.5	7.0e-24
WP_097364150.1|1189579_1190026_-|tail	tail fiber assembly protein	tail	A0A2P1JUG3	Erwinia_phage	59.0	1.8e-15
WP_097364151.1|1192427_1193033_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	56.1	2.7e-59
WP_097364152.1|1193025_1194213_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	62.3	9.8e-138
WP_077999975.1|1194209_1194545_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	58.7	1.6e-29
WP_097364153.1|1194541_1196677_-|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	28.4	2.6e-64
WP_077999977.1|1196871_1197141_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	54.2	1.3e-13
WP_097364155.1|1197249_1197645_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	38.2	2.0e-10
WP_097364156.1|1197644_1197986_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	77.2	1.0e-39
WP_015460863.1|1197982_1198273_-|holin	holin	holin	C7BGD7	Burkholderia_phage	47.9	3.0e-16
WP_097364157.1|1198285_1198741_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	62.9	5.6e-49
WP_097364158.1|1198740_1199892_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	60.5	7.8e-124
WP_097364159.1|1199892_1200633_-	phage virion morphogenesis protein	NA	F1BUL6	Cronobacter_phage	36.6	4.2e-30
WP_157757869.1|1200616_1201117_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	42.9	1.1e-29
WP_077999984.1|1201137_1201629_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	57.8	5.5e-42
WP_097364161.1|1201686_1202385_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	56.2	5.5e-64
WP_097364162.1|1202389_1203439_-|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	47.8	7.7e-86
WP_097364163.1|1203447_1204347_-|capsid	GPO family capsid scaffolding protein	capsid	R9TRS3	Vibrio_phage	37.2	1.5e-34
WP_097364700.1|1204536_1206309_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	58.6	2.9e-202
WP_097364164.1|1206308_1207358_+|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	55.9	8.5e-101
WP_097364165.1|1207354_1207678_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	75.2	5.9e-37
WP_097364166.1|1207689_1207860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097364167.1|1207975_1210027_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	62.6	3.7e-241
WP_097364168.1|1210023_1210314_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_097364169.1|1210306_1211119_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	60.5	1.7e-88
WP_097364170.1|1211109_1212006_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	66.3	4.1e-120
WP_097364171.1|1211996_1212227_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_097364172.1|1212304_1212700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077999995.1|1212717_1213071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077999997.1|1213272_1213779_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	61.0	5.4e-45
WP_097364174.1|1214172_1214748_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	39.2	5.1e-31
WP_097364175.1|1214766_1215522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097364176.1|1215523_1216585_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.8e-114
WP_097364177.1|1216900_1217563_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	29.0	2.9e-22
1216659:1216709	attR	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
WP_035594207.1|1217707_1218607_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_097364178.1|1218611_1221044_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	1.8e-08
WP_005281507.1|1221101_1221500_-	YgiW/YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_005295876.1|1221713_1222373_+	two-component system response regulator QseB	NA	NA	NA	NA	NA
WP_097364179.1|1222372_1223737_+	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
WP_005281498.1|1223747_1224908_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A142C026	Faustovirus	26.0	1.3e-14
WP_097364180.1|1225069_1226227_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_005295882.1|1226303_1226807_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_097364181.1|1226862_1227843_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_035597119.1|1227856_1228774_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005281478.1|1229179_1230148_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.8	8.8e-36
WP_005281471.1|1230496_1231738_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_005281469.1|1231785_1232310_-	YgjV family protein	NA	NA	NA	NA	NA
WP_097364701.1|1232371_1233862_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_097364182.1|1233880_1235359_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_005281461.1|1235458_1236868_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_035597115.1|1237386_1238682_+	MFS transporter	NA	NA	NA	NA	NA
WP_005281457.1|1238863_1239631_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_005281452.1|1239910_1240300_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	34.8	3.5e-07
WP_005281448.1|1240491_1240956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005281444.1|1241057_1241738_+	DedA family protein	NA	NA	NA	NA	NA
WP_035594201.1|1241790_1242153_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_005281437.1|1242427_1242733_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_005281434.1|1242732_1243137_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 5
NZ_CP023706	Edwardsiella tarda strain KC-Pc-HB1 chromosome, complete genome	3638764	3383884	3444333	3638764	capsid,integrase,tail,holin,portal	Escherichia_phage(22.86%)	60	3381144:3381158	3409334:3409348
3381144:3381158	attL	CGCAACTTTTCGCGG	NA	NA	NA	NA
WP_097364598.1|3383884_3385021_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	42.9	2.5e-66
WP_097364599.1|3385007_3385253_-	excisionase	NA	NA	NA	NA	NA
WP_035599856.1|3385328_3385610_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_097364729.1|3385759_3386728_-	Rha family transcriptional regulator	NA	A0A1U9GXD3	Vibrio_phage	45.0	3.1e-41
WP_097364600.1|3387399_3388317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097364601.1|3389674_3390142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097364602.1|3390171_3390321_-	potassium transporter 7	NA	NA	NA	NA	NA
WP_097364603.1|3390389_3390695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097364604.1|3391793_3394271_-	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	52.9	2.9e-91
WP_097364605.1|3395225_3396068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097364606.1|3396345_3396642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097364730.1|3397064_3399572_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_097364607.1|3399588_3400575_-	ATP-binding protein	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	30.4	8.2e-13
WP_097364608.1|3400815_3401445_-	helix-turn-helix domain-containing protein	NA	A0A0N7BTS4	Escherichia_phage	57.9	1.8e-66
WP_073382248.1|3401586_3401796_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	50.8	1.6e-11
WP_097364609.1|3401860_3402217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005286423.1|3402213_3402447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005286420.1|3402478_3402730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097364611.1|3402932_3403871_+	helix-turn-helix domain-containing protein	NA	Q76H52	Enterobacteria_phage	66.3	1.2e-29
WP_097364612.1|3403867_3405250_+	AAA family ATPase	NA	A0A2H4FQW0	Salmonella_phage	66.0	2.7e-163
WP_097364613.1|3405277_3405625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097364614.1|3405734_3406379_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	31.2	6.1e-17
WP_035603599.1|3406381_3406687_+	DUF1364 domain-containing protein	NA	A0A2K8HR56	Pseudomonas_phage	46.7	7.8e-15
WP_146196788.1|3406748_3407078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157757877.1|3407101_3407374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097364615.1|3407486_3407999_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_005286394.1|3408093_3408402_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	89.2	2.0e-42
WP_015871332.1|3408391_3408721_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	88.5	1.3e-39
WP_097364616.1|3409165_3409936_+	Rha family transcriptional regulator	NA	A0A0P0ZGC2	Escherichia_phage	55.5	5.6e-25
3409334:3409348	attR	CGCAACTTTTCGCGG	NA	NA	NA	NA
WP_157757878.1|3410117_3411413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097364618.1|3411534_3412353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157757879.1|3412586_3412985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015871327.1|3413101_3413332_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_035603613.1|3413306_3413636_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_097364619.1|3413726_3414065_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	48.6	2.1e-24
WP_097364620.1|3414067_3414619_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	71.9	8.8e-73
WP_097364621.1|3414709_3415582_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	48.7	1.5e-21
WP_097364622.1|3415756_3416299_+	DUF2514 family protein	NA	A0A193GYI0	Enterobacter_phage	32.6	2.0e-08
WP_005286367.1|3416379_3417156_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	57.8	5.8e-06
WP_005294233.1|3417133_3418810_+	hypothetical protein	NA	B0FEF1	Escherichia_phage	70.8	1.1e-232
WP_097364623.1|3418806_3420921_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	63.6	2.5e-229
WP_097364624.1|3420992_3421274_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	2.4e-18
WP_005286352.1|3421263_3421515_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_097364625.1|3421793_3422792_+	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	39.1	1.7e-34
WP_097364626.1|3422809_3424054_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	72.0	8.1e-167
WP_097364627.1|3424109_3424514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097364628.1|3424555_3425026_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	53.4	6.0e-22
WP_097364629.1|3425012_3425594_+	hypothetical protein	NA	A0A1I9KFD5	Aeromonas_phage	37.9	1.4e-20
WP_077999886.1|3425593_3426256_+	hypothetical protein	NA	Q08J85	Stx2-converting_phage	55.3	2.0e-63
WP_097364630.1|3426252_3429210_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	47.1	3.8e-29
WP_097364631.1|3429211_3429829_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	38.1	4.8e-27
WP_157757880.1|3429951_3430125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097364632.1|3430139_3431744_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	55.3	6.1e-167
WP_097364633.1|3431740_3433297_+	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	45.8	1.0e-81
WP_097364634.1|3433304_3433676_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	40.9	7.8e-17
WP_097364635.1|3433686_3434262_+	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	52.2	2.3e-44
WP_097364636.1|3434298_3434679_+	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	49.2	8.0e-25
WP_005286316.1|3434680_3434941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097364637.1|3434953_3436405_+	cytokinesis protein SepA	NA	A0A1I9KFD9	Aeromonas_phage	22.0	5.8e-15
WP_097364638.1|3436503_3444333_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	48.3	1.4e-232
>prophage 6
NZ_CP023706	Edwardsiella tarda strain KC-Pc-HB1 chromosome, complete genome	3638764	3616717	3626039	3638764	tRNA	Brazilian_cedratvirus(16.67%)	11	NA	NA
WP_077999467.1|3616717_3617485_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	8.9e-07
WP_097364732.1|3617477_3618503_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_005285820.1|3618489_3618693_-	protein DsrB	NA	NA	NA	NA	NA
WP_005285818.1|3618782_3619079_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	2.4e-13
WP_077999470.1|3619083_3621471_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.7	2.4e-05
WP_005293646.1|3621485_3622469_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
WP_106120997.1|3622657_3622702_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005285808.1|3622870_3623227_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005293643.1|3623270_3623468_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071523971.1|3623564_3624107_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.8	3.3e-16
WP_005293637.1|3624110_3626039_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	1.1e-127
