The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023772	Lactiplantibacillus plantarum strain PC520 chromosome, complete genome	3342669	655544	757842	3342669	tRNA,protease,bacteriocin,transposase	Staphylococcus_phage(14.29%)	96	NA	NA
WP_013355162.1|655544_656807_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003643745.1|657091_658408_-	MFS transporter	NA	NA	NA	NA	NA
WP_003643746.1|658577_659480_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_013355164.1|659492_659693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355165.1|660375_661788_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003641910.1|661853_662099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643749.1|662227_662791_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_013355166.1|662828_663800_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027821525.1|663796_664111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355168.1|664271_665447_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011100969.1|665622_666789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641920.1|667383_668199_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003641921.1|668211_669303_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	7.2e-18
WP_003641922.1|669681_669954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100970.1|670180_670723_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011100971.1|670719_672165_+	MFS transporter	NA	NA	NA	NA	NA
WP_011100972.1|672494_673811_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.6	3.3e-33
WP_011100973.1|674305_675265_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003641927.1|675367_675637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643762.1|675867_676431_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_013355171.1|676624_677293_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_013355172.1|677450_678956_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013355173.1|679220_679589_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|679701_680211_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_013355174.1|680241_681438_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|681547_682018_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|682036_682492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355176.1|682595_683168_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_013355177.1|683333_684254_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_013355178.1|684390_685302_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003646442.1|686048_686495_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003641940.1|686732_688259_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641941.1|688259_689231_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003646444.1|689308_690640_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|691105_692623_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003641944.1|692637_694467_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_080477006.1|694481_695204_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	1.9e-30
WP_013355180.1|695786_699470_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_041161944.1|699471_701271_+	pre-toxin TG domain-containing protein	NA	NA	NA	NA	NA
WP_003641948.1|701267_702185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641949.1|702228_702492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641950.1|702603_702882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641952.1|703261_703648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641954.1|704097_704289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114071742.1|704491_704638_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_003641956.1|704714_705122_+	immunity 63 family protein	NA	NA	NA	NA	NA
WP_003641960.1|706392_706668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641962.1|707049_707667_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003641963.1|707670_708825_-	MFS transporter	NA	NA	NA	NA	NA
WP_011100993.1|708828_709620_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|709690_710563_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641966.1|710722_711538_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011100994.1|712063_713440_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|713484_714669_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003641969.1|715053_715257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641971.1|715668_716337_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641972.1|716333_716507_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641973.1|716537_716705_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641974.1|717566_717767_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641975.1|717894_718062_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641976.1|718179_719379_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641977.1|719409_720156_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_065980438.1|721033_721180_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011100998.1|721370_722699_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011100999.1|722699_723443_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003641982.1|723561_724305_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003646470.1|724609_725383_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|725481_725640_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|725664_725835_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_065980437.1|726101_728252_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	3.0e-44
WP_003641987.1|728267_729644_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003641990.1|730490_731159_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|731245_731926_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641992.1|732019_732706_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641993.1|732843_733047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641994.1|733141_735451_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003643814.1|735709_736486_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003643815.1|736924_737941_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003641997.1|738348_739059_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641998.1|739131_740493_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|740499_740688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642000.1|740677_741100_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643816.1|741322_742678_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642002.1|742695_744132_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003642003.1|744252_745149_+	ROK family protein	NA	NA	NA	NA	NA
WP_003642004.1|745298_746045_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643818.1|746157_747171_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642006.1|747624_748758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643820.1|748762_749557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642008.1|749725_750643_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003642009.1|750688_751963_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642010.1|751955_752915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642011.1|752936_753641_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642012.1|753640_754483_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646492.1|755079_755469_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003643823.1|755790_757842_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
>prophage 2
NZ_CP023772	Lactiplantibacillus plantarum strain PC520 chromosome, complete genome	3342669	904724	955973	3342669	terminase,portal,tRNA,integrase,holin,capsid,tail	Lactobacillus_phage(59.38%)	69	913566:913583	953108:953125
WP_003640932.1|904724_906215_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013355229.1|906492_907905_+|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	27.7	1.5e-44
WP_003640934.1|907906_908317_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003640935.1|908288_909074_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003640936.1|909075_909621_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_065980380.1|910127_910730_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003637768.1|910791_910941_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003640939.1|910952_911138_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_013355230.1|911242_911791_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_022638154.1|911818_912706_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003640942.1|912807_913233_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003640943.1|913333_914023_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
913566:913583	attL	TTGCTAAGGGTGACAAGG	NA	NA	NA	NA
WP_003643933.1|914221_914725_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003637775.1|914786_915155_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_045353238.1|915306_916509_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.5	2.0e-37
WP_065980382.1|916934_917552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065980383.1|917825_918359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065980384.1|918445_919309_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_065980385.1|919362_919794_-	hypothetical protein	NA	O03904	Lactobacillus_phage	94.4	2.5e-75
WP_065980386.1|919802_920201_-	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	62.9	2.9e-41
WP_063722752.1|920365_920626_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065980387.1|920782_921064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065980388.1|921378_921798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060417488.1|921876_922059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980389.1|922119_922674_+	hypothetical protein	NA	O03909	Lactobacillus_phage	99.5	7.9e-98
WP_065980390.1|922679_922967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063096777.1|923216_923504_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	48.9	1.6e-22
WP_161313448.1|923808_924312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980391.1|924308_925208_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	1.3e-62
WP_161313449.1|925239_925992_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.6	8.6e-71
WP_065980393.1|926072_926981_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_065980394.1|926977_927265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980395.1|927261_927984_+	phage antirepressor KilAC domain-containing protein	NA	A0A141E1D3	Streptococcus_phage	46.8	4.2e-51
WP_065980396.1|927988_928507_+	hypothetical protein	NA	O03915	Lactobacillus_phage	67.1	1.1e-53
WP_003642802.1|928503_928878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980397.1|928880_929192_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	88.3	3.0e-46
WP_024971545.1|929195_929390_+	hypothetical protein	NA	A0A2P0ZLB7	Lactobacillus_phage	71.4	4.5e-16
WP_164915002.1|929382_929523_+	hypothetical protein	NA	E9LUN8	Lactobacillus_phage	96.3	1.5e-05
WP_003642805.1|929600_930062_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_015380624.1|931113_931311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072533559.1|931288_931465_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	57.4	9.1e-08
WP_064522742.1|931433_931691_+	hypothetical protein	NA	A0A0N9SKC5	Staphylococcus_phage	47.6	1.3e-15
WP_065980398.1|931744_932416_+	helix-turn-helix domain-containing protein	NA	A0A1S5SAA7	Streptococcus_phage	53.3	1.2e-44
WP_065980399.1|932390_933716_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	56.0	2.6e-139
WP_065980400.1|933763_935314_+|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	38.6	8.2e-84
WP_065980401.1|935306_936203_+	hypothetical protein	NA	A0A1Z1LZL3	Bacillus_phage	35.3	5.9e-18
WP_065980402.1|936454_937054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060684041.1|937067_938015_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.5	2.3e-89
WP_065980403.1|938103_938364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980404.1|938374_938779_+	hypothetical protein	NA	A5GYM1	Lactococcus_phage	26.7	3.4e-05
WP_065980405.1|938779_939169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980406.1|939165_939567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380612.1|939566_939992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486493.1|940009_940627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980407.1|940745_941264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980408.1|941260_941902_+	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	28.1	3.0e-08
WP_065980409.1|941917_947566_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	26.1	7.0e-24
WP_065980410.1|947566_948385_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_050339419.1|948396_949524_+|tail	phage tail protein	tail	O03938	Lactobacillus_phage	42.6	1.1e-72
WP_065980411.1|949516_949738_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_065980412.1|949734_950025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176714641.1|950025_952185_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	33.7	8.6e-39
WP_065980413.1|952196_952508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096641375.1|952507_952657_+	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	59.1	1.6e-05
WP_065980414.1|952674_953772_+	collagen-like protein	NA	A0A1I9KKB6	Lactobacillus_phage	57.4	1.8e-37
953108:953125	attR	TTGCTAAGGGTGACAAGG	NA	NA	NA	NA
WP_015380465.1|953768_953981_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	80.3	2.0e-17
WP_065980415.1|953992_955165_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	87.4	4.6e-196
WP_065980416.1|955164_955428_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	97.7	6.3e-37
WP_065980417.1|955439_955973_+|holin	holin	holin	E9LUS0	Lactobacillus_phage	95.7	8.0e-39
>prophage 3
NZ_CP023772	Lactiplantibacillus plantarum strain PC520 chromosome, complete genome	3342669	1181318	1227842	3342669	integrase,protease,transposase	Staphylococcus_virus(23.08%)	40	1182985:1183001	1206607:1206623
WP_013355290.1|1181318_1182875_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.8	6.6e-17
WP_013355291.1|1182940_1184632_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	1.1e-92
1182985:1183001	attL	AAGAGGCTGTGACATAA	NA	NA	NA	NA
WP_013355292.1|1184813_1185989_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5C3	Streptococcus_phage	30.5	2.6e-37
WP_033098994.1|1185994_1186180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355293.1|1186294_1187161_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	57.5	8.1e-81
WP_049787978.1|1187419_1188349_-	DUF4428 domain-containing protein	NA	O48432	Lactobacillus_phage	31.2	3.1e-22
WP_049787979.1|1188385_1189522_-	DUF4428 domain-containing protein	NA	O48432	Lactobacillus_phage	26.3	4.1e-16
WP_154813574.1|1189567_1189708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355295.1|1189970_1190312_-	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	53.9	6.9e-20
WP_114403795.1|1190476_1190692_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157771631.1|1190642_1191890_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_013355297.1|1192128_1192722_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003641164.1|1193198_1193567_-	membrane protein	NA	NA	NA	NA	NA
WP_003641165.1|1193800_1194169_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	5.9e-17
WP_013355298.1|1194706_1197670_+	DNA2/NAM7 family helicase	NA	NA	NA	NA	NA
WP_011101204.1|1197971_1198664_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013355299.1|1198883_1199228_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101206.1|1199359_1200658_-	MFS transporter	NA	NA	NA	NA	NA
WP_013355300.1|1200931_1203436_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021355861.1|1203567_1203882_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
WP_013355302.1|1204044_1206618_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_082225633.1|1206758_1208534_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	2.5e-92
1206607:1206623	attR	AAGAGGCTGTGACATAA	NA	NA	NA	NA
WP_033098993.1|1208568_1209159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033098992.1|1209158_1210226_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_013355305.1|1210292_1210649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101208.1|1211243_1211627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641171.1|1211616_1213464_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.3	4.5e-20
WP_003641172.1|1213704_1213959_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003641173.1|1213970_1214516_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641174.1|1214528_1214711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644046.1|1214725_1215148_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641176.1|1215208_1215649_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_016511031.1|1215852_1216653_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013355308.1|1216784_1217795_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003644049.1|1218156_1218489_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003641180.1|1218594_1219167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355309.1|1219348_1221883_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	9.3e-69
WP_013355310.1|1222105_1224979_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_033098990.1|1226575_1226830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355080.1|1226918_1227842_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-32
>prophage 4
NZ_CP023772	Lactiplantibacillus plantarum strain PC520 chromosome, complete genome	3342669	1602125	1688950	3342669	terminase,head,portal,protease,integrase,capsid,tail	Lactobacillus_phage(88.06%)	89	1610757:1610811	1650604:1650658
WP_003645251.1|1602125_1602812_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643149.1|1603483_1603960_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013355446.1|1604076_1604589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643147.1|1604703_1604991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638033.1|1605055_1607323_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.4	2.0e-118
WP_062688388.1|1607969_1609106_-|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	97.6	1.4e-210
WP_062688390.1|1609851_1610202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062688392.1|1610198_1610642_-	hypothetical protein	NA	NA	NA	NA	NA
1610757:1610811	attL	TGTTCTACCGTTGAACTACGCTCGCATGTTGCCCGCTAGGCTGGTAGTGGGCGAG	NA	NA	NA	NA
WP_016511000.1|1611186_1612065_-	HIRAN domain-containing protein	NA	A0A2H4J549	uncultured_Caudovirales_phage	34.8	3.0e-06
WP_003641360.1|1612127_1612517_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
WP_062689671.1|1612547_1612874_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	9.0e-17
WP_003644552.1|1613130_1613346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486293.1|1613428_1614166_+	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	46.2	3.7e-50
WP_062689665.1|1614329_1615049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062689663.1|1615141_1615471_+	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	85.3	1.9e-51
WP_062689660.1|1615560_1615809_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	83.0	7.2e-35
WP_062689658.1|1615811_1616012_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	97.0	8.1e-29
WP_172794814.1|1616295_1616466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486285.1|1616466_1616772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062689657.1|1616791_1617484_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	88.3	9.5e-117
WP_046947735.1|1617533_1618331_+	hypothetical protein	NA	Q9AZA0	Lactobacillus_prophage	68.3	9.5e-52
WP_062689654.1|1618330_1619116_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.0	1.6e-131
WP_065980378.1|1619251_1619560_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	87.3	5.6e-45
WP_141686194.1|1619552_1619720_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	83.6	2.1e-14
WP_154698934.1|1619722_1619896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062689648.1|1619976_1620345_+	hypothetical protein	NA	O03921	Lactobacillus_phage	54.1	2.7e-25
WP_062689645.1|1620341_1620692_+	hypothetical protein	NA	A0A142F1A4	Bacillus_phage	45.7	1.3e-13
WP_072535789.1|1620684_1620852_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	89.4	8.1e-14
WP_033608385.1|1621033_1621459_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	86.5	2.1e-66
WP_062689642.1|1622553_1623477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098817304.1|1623749_1624220_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	72.5	2.7e-62
WP_062689636.1|1624222_1624762_+	HNH endonuclease	NA	A0A2D1GPF4	Lactobacillus_phage	48.4	6.9e-30
WP_062689634.1|1624940_1625399_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	8.0e-80
WP_062689632.1|1625401_1627300_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.4	0.0e+00
WP_062689630.1|1627289_1627484_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	98.4	9.7e-27
WP_062689628.1|1627486_1628680_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	99.0	4.1e-224
WP_062689625.1|1628657_1629416_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	94.4	1.9e-126
WP_062689623.1|1629415_1630648_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	87.0	4.7e-199
WP_062689621.1|1630720_1631059_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	94.6	2.1e-53
WP_062689618.1|1631042_1631405_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	97.5	1.7e-64
WP_016058331.1|1631394_1631835_+	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	100.0	2.2e-79
WP_062689616.1|1631831_1632215_+	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	96.9	4.7e-65
WP_062689614.1|1632215_1632854_+|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	94.8	7.2e-111
WP_016058334.1|1633055_1633439_+	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	100.0	3.9e-64
WP_016058335.1|1633435_1633627_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_063486287.1|1633639_1638862_+	hypothetical protein	NA	E9LUR1	Lactobacillus_phage	77.7	0.0e+00
WP_080453350.1|1639002_1640712_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.3	1.1e-291
WP_062689605.1|1643194_1645450_+	hypothetical protein	NA	A0A2K9VDD0	Lactobacillus_phage	91.7	1.3e-167
WP_062689603.1|1645442_1645685_+	hypothetical protein	NA	A0A2P0ZLG3	Lactobacillus_phage	98.8	3.4e-29
WP_171030852.1|1645688_1645850_+	hypothetical protein	NA	E9LUR6	Lactobacillus_phage	98.1	2.8e-19
WP_062689601.1|1645833_1646193_+	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	76.5	4.3e-44
WP_003644510.1|1647223_1647487_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_016058344.1|1647499_1648030_+	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	100.0	2.9e-41
WP_062688388.1|1648870_1650007_-|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	97.6	1.4e-210
WP_062688390.1|1650752_1651103_-	hypothetical protein	NA	NA	NA	NA	NA
1650604:1650658	attR	TGTTCTACCGTTGAACTACGCTCGCATGTTGCCCGCTAGGCTGGTAGTGGGCGAG	NA	NA	NA	NA
WP_062688392.1|1651099_1651543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016511000.1|1652087_1652966_-	HIRAN domain-containing protein	NA	A0A2H4J549	uncultured_Caudovirales_phage	34.8	3.0e-06
WP_003641360.1|1653028_1653418_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
WP_062689671.1|1653448_1653775_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	9.0e-17
WP_003644552.1|1654031_1654247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486293.1|1654329_1655067_+	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	46.2	3.7e-50
WP_062689665.1|1655230_1655950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062689663.1|1656042_1656372_+	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	85.3	1.9e-51
WP_062689660.1|1656461_1656710_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	83.0	7.2e-35
WP_062689658.1|1656712_1656913_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	97.0	8.1e-29
WP_172794814.1|1657196_1657367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486285.1|1657367_1657673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062689657.1|1657692_1658385_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	88.3	9.5e-117
WP_046947735.1|1658434_1659232_+	hypothetical protein	NA	Q9AZA0	Lactobacillus_prophage	68.3	9.5e-52
WP_065980378.1|1660153_1660462_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	87.3	5.6e-45
WP_141686194.1|1660454_1660622_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	83.6	2.1e-14
WP_154698934.1|1660624_1660798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187344742.1|1661158_1661248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771635.1|1661244_1661388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072535789.1|1661586_1661754_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	89.4	8.1e-14
WP_033608385.1|1661934_1662360_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	86.5	2.1e-66
WP_157771636.1|1663560_1664382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098817298.1|1665125_1665350_+	hypothetical protein	NA	L0P6F5	Lactobacillus_phage	51.5	4.3e-10
WP_187344743.1|1665291_1665504_+	HNH endonuclease	NA	A0A2D1GPF4	Lactobacillus_phage	66.0	1.3e-11
WP_062689630.1|1668196_1668391_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	98.4	9.7e-27
WP_062689616.1|1672749_1673133_+	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	96.9	4.7e-65
WP_016058335.1|1674356_1674548_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_080453350.1|1679922_1681632_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.3	1.1e-291
WP_062689605.1|1684114_1686370_+	hypothetical protein	NA	A0A2K9VDD0	Lactobacillus_phage	91.7	1.3e-167
WP_062689603.1|1686362_1686605_+	hypothetical protein	NA	A0A2P0ZLG3	Lactobacillus_phage	98.8	3.4e-29
WP_171030852.1|1686608_1686770_+	hypothetical protein	NA	E9LUR6	Lactobacillus_phage	98.1	2.8e-19
WP_062689601.1|1686753_1687113_+	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	76.5	4.3e-44
WP_003644510.1|1688143_1688407_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_016058344.1|1688419_1688950_+	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	100.0	2.9e-41
>prophage 5
NZ_CP023772	Lactiplantibacillus plantarum strain PC520 chromosome, complete genome	3342669	1737366	1750144	3342669		Lactobacillus_phage(70.0%)	11	NA	NA
WP_013355467.1|1737366_1738605_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	98.7	2.4e-219
WP_013355468.1|1738695_1739667_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	3.5e-181
WP_003643099.1|1739852_1740800_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1741142_1741757_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_022638021.1|1741759_1744198_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_013355469.1|1744285_1744846_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.4	6.5e-100
WP_013355470.1|1744916_1745357_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
WP_022638019.1|1745747_1747115_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	3.4e-25
WP_021356352.1|1747107_1747800_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_013355473.1|1748509_1749175_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013355474.1|1749199_1750144_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.5	2.0e-72
>prophage 6
NZ_CP023772	Lactiplantibacillus plantarum strain PC520 chromosome, complete genome	3342669	2585427	2624350	3342669	terminase,head,protease,portal,holin,capsid,tail	Lactobacillus_phage(36.36%)	50	NA	NA
WP_013355720.1|2585427_2586330_+	hypothetical protein	NA	A0A0B5CYL8	Listeria_phage	51.4	3.2e-80
WP_080009510.1|2586377_2586536_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	61.7	2.4e-07
WP_013355721.1|2587253_2587637_-|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	58.8	7.1e-13
WP_013355722.1|2587623_2587920_-	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	75.5	4.9e-38
WP_013355723.1|2587920_2589036_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	64.2	1.7e-46
WP_003642832.1|2589214_2589649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642831.1|2589651_2590101_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	40.5	6.1e-24
WP_013355724.1|2590107_2595273_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.4	2.1e-144
WP_099739626.1|2595287_2595620_-	hypothetical protein	NA	V5UQS8	Oenococcus_phage	73.4	2.2e-42
WP_013355726.1|2595663_2601495_-|tail	tail protein	tail	V5URV5	Oenococcus_phage	40.9	5.0e-227
WP_031275283.1|2601510_2601774_-	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
WP_003642826.1|2601881_2602280_-	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
WP_080477005.1|2602379_2602856_-|tail	phage tail protein	tail	Q6SE73	Lactobacillus_prophage	58.7	1.5e-44
WP_013355729.1|2602864_2603230_-	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_013355730.1|2603229_2603781_-	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	2.0e-64
WP_003642822.1|2603782_2604130_-	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_013355731.1|2604129_2604462_-|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642820.1|2604473_2604650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642819.1|2604662_2605685_-|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_013355732.1|2605704_2606052_-	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.4e-30
WP_013355733.1|2606066_2606744_-	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	6.0e-15
WP_013355734.1|2606916_2607123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642815.1|2607174_2607453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355736.1|2607427_2609113_-|capsid	minor capsid protein	capsid	V5US81	Oenococcus_phage	58.0	6.5e-119
WP_024971552.1|2609259_2609556_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_013355738.1|2609485_2610994_-|portal	phage portal protein	portal	V5US18	Oenococcus_phage	52.0	1.8e-136
WP_033098955.1|2611005_2612244_-|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.3	1.9e-139
WP_013355739.1|2612233_2612761_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	75.7	4.5e-58
WP_013355740.1|2612994_2613201_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.5	7.6e-06
WP_013355741.1|2613328_2614105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033098953.1|2614395_2614605_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_013355742.1|2614601_2614769_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_003642805.1|2614992_2615454_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_013355743.1|2615664_2616045_-	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_013355744.1|2616041_2616560_-	hypothetical protein	NA	O03915	Lactobacillus_phage	69.1	4.5e-55
WP_011101096.1|2616556_2617087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355745.1|2617083_2617371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033098952.1|2617367_2618276_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_013355747.1|2618354_2619107_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.6	2.3e-71
WP_013355748.1|2619138_2620038_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	6.0e-63
WP_080009504.1|2620034_2620421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355751.1|2620791_2621304_-	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	1.4e-27
WP_013355752.1|2621371_2621677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642792.1|2621688_2621859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101086.1|2622017_2622218_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101085.1|2622364_2622601_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_013355753.1|2622638_2622953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033099030.1|2623009_2623264_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013355754.1|2623409_2623913_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	42.6	1.7e-22
WP_013355755.1|2623927_2624350_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	35.1	3.0e-12
>prophage 1
NZ_CP023773	Lactiplantibacillus plantarum strain PC520 plasmid p1, complete sequence	56675	5016	30252	56675	transposase,integrase	Staphylococcus_phage(23.08%)	27	399:413	37826:37840
399:413	attL	GTCAATATTTTGGTC	NA	NA	NA	NA
WP_012660357.1|5016_5604_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	33.2	1.8e-20
WP_065980470.1|5616_5952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980469.1|6323_6596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046811164.1|7190_9095_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.7	2.6e-95
WP_046811165.1|9244_9997_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	31.2	1.4e-28
WP_096641391.1|10450_10789_-	PbsX family transcriptional regulator	NA	NA	NA	NA	NA
WP_005691113.1|11001_11322_+	thioredoxin family protein	NA	A0A1J0GW78	Streptomyces_phage	36.3	6.1e-10
WP_046811166.1|11339_11609_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_005691111.1|11821_12025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046811168.1|12151_12703_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_046811169.1|12715_12934_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_013355080.1|13066_13990_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-32
WP_046811126.1|14197_15796_-	APC family permease	NA	NA	NA	NA	NA
WP_065980487.1|16163_17192_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	1.4e-36
WP_046811125.1|17303_17891_-	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.4	5.9e-19
WP_056988651.1|18093_18480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065980486.1|18530_21296_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	37.5	4.8e-159
WP_046811122.1|21416_21695_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003589709.1|21696_22056_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	33.7	3.5e-06
WP_052748126.1|22449_22668_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.5	3.3e-07
WP_012881110.1|22671_23853_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	2.5e-101
WP_157771639.1|24105_24666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_173425725.1|24787_26107_-	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_046811121.1|26099_26960_-	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_098817306.1|27105_28020_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.2	3.4e-29
WP_046811120.1|28183_28759_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157771640.1|29793_30252_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.8	1.5e-22
37826:37840	attR	GTCAATATTTTGGTC	NA	NA	NA	NA
>prophage 1
NZ_CP023774	Lactiplantibacillus plantarum strain PC520 plasmid p2, complete sequence	53560	10515	18219	53560	transposase	Enterococcus_phage(28.57%)	7	NA	NA
WP_087613290.1|10515_11291_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_013356283.1|11398_12301_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	6.3e-52
WP_013356284.1|12387_13020_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	4.7e-14
WP_114602643.1|13133_13946_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.0	2.5e-15
WP_033098914.1|14073_15024_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	5.5e-99
WP_013356287.1|15038_15965_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P8A9	Corynebacterium_phage	32.4	2.0e-37
WP_033098919.1|16071_18219_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.5	2.1e-255
