The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023818	Aeromonas sp. CA23 chromosome, complete genome	5099209	176945	186902	5099209	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_080741190.1|176945_178811_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
WP_043142101.1|179024_180812_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.6	8.0e-75
WP_098980691.1|180900_181344_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.0e-26
WP_005309452.1|181359_181575_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_043142105.1|181754_182768_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	9.1e-108
WP_042872653.1|182856_183840_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	9.9e-35
WP_098980692.1|183887_184931_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	37.1	5.1e-13
WP_172955193.1|184940_185522_-	DedA family protein	NA	NA	NA	NA	NA
WP_043142113.1|185518_186136_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
WP_098980693.1|186140_186902_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	2.8e-69
>prophage 2
NZ_CP023818	Aeromonas sp. CA23 chromosome, complete genome	5099209	1465010	1514435	5099209	protease,transposase,integrase	Vibrio_phage(40.0%)	30	1453961:1453977	1495898:1495914
1453961:1453977	attL	AGCAGGGGCTGAAAGGC	NA	NA	NA	NA
WP_098981773.1|1465010_1465982_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_098981775.1|1466086_1466911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098981778.1|1468877_1469231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098981781.1|1469701_1471006_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_098985017.1|1471807_1472803_+	OmpA family protein	NA	NA	NA	NA	NA
WP_098985018.1|1473536_1474238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098981786.1|1474579_1475881_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_098981788.1|1476578_1477496_-|transposase	IS5-like element ISAs15 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.5	3.0e-94
WP_098981790.1|1478076_1478370_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	42.4	1.6e-12
WP_098981792.1|1478442_1478901_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_098981795.1|1479539_1480004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098981797.1|1479991_1481869_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_098985019.1|1481872_1483204_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_098981800.1|1483440_1484760_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_043556077.1|1484915_1485494_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	59.2	1.6e-53
WP_098981803.1|1486025_1486685_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172955259.1|1489751_1491437_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.8	4.5e-19
WP_042865943.1|1491883_1492495_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_043141408.1|1492714_1494694_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.1	1.6e-23
WP_098981805.1|1494702_1496187_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1495898:1495914	attR	AGCAGGGGCTGAAAGGC	NA	NA	NA	NA
WP_098981808.1|1496250_1497051_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021140731.1|1497379_1498276_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_065402590.1|1498343_1499408_-	DUF3103 family protein	NA	NA	NA	NA	NA
WP_098981811.1|1499557_1500709_-	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_172955260.1|1500830_1501406_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_098981813.1|1501416_1502613_-	NnrS family protein	NA	NA	NA	NA	NA
WP_042868369.1|1508747_1509065_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_098981816.1|1509282_1512366_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_043140024.1|1512453_1512999_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_043140022.1|1513091_1514435_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP023818	Aeromonas sp. CA23 chromosome, complete genome	5099209	1738765	1810445	5099209	head,terminase,plate,portal,integrase,tRNA,capsid,holin,transposase,tail	Aeromonas_virus(75.51%)	69	1755563:1755621	1811755:1811813
WP_098982140.1|1738765_1741390_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.7	1.1e-77
WP_042866547.1|1741406_1742654_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005315760.1|1742747_1742936_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	5.0e-12
WP_098982142.1|1744126_1744954_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_043139871.1|1745092_1745758_-	DedA family protein	NA	NA	NA	NA	NA
WP_043139868.1|1745778_1747071_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_098982147.1|1747257_1750110_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.2e-138
WP_043139863.1|1750175_1750631_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_098982150.1|1750794_1752303_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.8	1.3e-49
WP_172955270.1|1752475_1753588_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_098982153.1|1753729_1754800_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_172955271.1|1754867_1755389_-	RDD family protein	NA	NA	NA	NA	NA
1755563:1755621	attL	GATTCAAAATCCGCCGATGAATAATCGTGTCGGTTCGAGTCCGACCCCGGGCACCATCA	NA	NA	NA	NA
WP_098982158.1|1756372_1757983_-	hypothetical protein	NA	A5X9J8	Aeromonas_virus	75.8	1.4e-243
WP_098982161.1|1757979_1758540_-	hypothetical protein	NA	A5X9J7	Aeromonas_virus	75.8	1.8e-65
WP_098985038.1|1758536_1758986_-	hypothetical protein	NA	A5X9J6	Aeromonas_virus	60.4	5.2e-39
WP_098982164.1|1759269_1761189_-|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	57.0	9.1e-101
WP_098982166.1|1761185_1761869_-|tail	phage tail protein	tail	A5X9J2	Aeromonas_virus	74.0	1.1e-85
WP_098982168.1|1761861_1763049_-|plate	baseplate J/gp47 family protein	plate	A5X9J1	Aeromonas_virus	82.1	5.0e-182
WP_005892386.1|1763045_1763369_-	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	89.7	8.0e-50
WP_098982171.1|1763368_1765252_-|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	68.8	6.8e-234
WP_098982173.1|1765443_1765704_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	87.2	1.1e-36
WP_098982176.1|1765827_1766271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098982178.1|1766267_1766747_-	TIGR02594 family protein	NA	A0A1I9KFD8	Aeromonas_phage	72.3	1.8e-66
WP_042654648.1|1766748_1767060_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	58.4	3.5e-26
WP_005892365.1|1767085_1767295_-	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	72.7	2.5e-20
WP_098982181.1|1767298_1767754_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	86.1	3.0e-71
WP_098982183.1|1767757_1768882_-	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	84.0	6.8e-181
WP_098982185.1|1768886_1769573_-	phage virion morphogenesis protein	NA	A5X9H9	Aeromonas_virus	91.7	2.2e-113
WP_172955272.1|1769569_1770094_-|tail	phage tail protein	tail	A5X9H8	Aeromonas_virus	85.4	7.3e-85
WP_098982190.1|1770090_1770552_-|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	91.5	1.4e-68
WP_098982193.1|1770722_1771451_-|terminase	terminase endonuclease subunit	terminase	A5X9H6	Aeromonas_virus	97.5	1.8e-134
WP_098982196.1|1771454_1772504_-|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	90.7	2.2e-181
WP_096117862.1|1772514_1773384_-|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	63.0	1.0e-99
WP_098982198.1|1773560_1775381_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	91.4	0.0e+00
WP_098982201.1|1775377_1776151_+|terminase	terminase	terminase	A5X9H2	Aeromonas_virus	87.9	5.1e-135
WP_098982204.1|1776147_1777161_+|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	90.8	4.3e-182
WP_098982207.1|1777226_1777478_+	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	88.0	4.6e-37
WP_098982209.1|1777512_1777944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141249386.1|1778416_1778704_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_098982211.1|1779234_1779567_-	hypothetical protein	NA	A0A219YA08	Aeromonas_phage	39.4	3.2e-14
WP_098982213.1|1779566_1780043_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.7	1.2e-09
WP_098982215.1|1780027_1780258_-	hypothetical protein	NA	A5X9G7	Aeromonas_virus	75.0	3.1e-24
WP_098982217.1|1780254_1780500_-	hypothetical protein	NA	A5X9G6	Aeromonas_virus	93.8	5.3e-38
WP_098985039.1|1780502_1780997_-	hypothetical protein	NA	A5X9G5	Aeromonas_virus	87.8	1.1e-77
WP_172955273.1|1780999_1783324_-	replication endonuclease	NA	A5X9G4	Aeromonas_virus	93.2	0.0e+00
WP_098982219.1|1783320_1783578_-	hypothetical protein	NA	A5X9G3	Aeromonas_virus	97.6	1.3e-39
WP_098982221.1|1783574_1783871_-	hypothetical protein	NA	A5X9G2	Aeromonas_virus	45.7	2.1e-17
WP_098982224.1|1783867_1784404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059112496.1|1784400_1784610_-	hypothetical protein	NA	A5X9G1	Aeromonas_virus	87.0	2.8e-24
WP_059112495.1|1784606_1784798_-	hypothetical protein	NA	A5X9G0	Aeromonas_virus	81.0	1.6e-21
WP_098985041.1|1784794_1784998_-	hypothetical protein	NA	A5X9F9	Aeromonas_virus	88.1	2.3e-26
WP_098982227.1|1785208_1785664_-	hypothetical protein	NA	A5X9F8	Aeromonas_virus	76.0	3.5e-59
WP_098982229.1|1785674_1786184_-	phage regulatory CII family protein	NA	A5X9F7	Aeromonas_virus	83.4	4.3e-74
WP_098982231.1|1786210_1786429_-	hypothetical protein	NA	A5X9F6	Aeromonas_virus	87.3	8.3e-27
WP_098985042.1|1786571_1787285_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	73.5	3.3e-96
WP_098982233.1|1787355_1788426_+|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	84.5	3.8e-173
WP_098982235.1|1788662_1789679_+|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	27.8	2.2e-21
WP_098982239.1|1790855_1791110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098982241.1|1791441_1793262_+	DUF3987 domain-containing protein	NA	S5MA01	Pseudoalteromonas_phage	29.4	1.0e-45
WP_098985043.1|1794081_1794480_+|terminase	terminase	terminase	A0A2K8HN72	Pseudomonas_phage	62.0	6.2e-36
WP_098982243.1|1794880_1798699_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_098982245.1|1798916_1799471_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.3	2.7e-21
WP_098982247.1|1799607_1800600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098982249.1|1800618_1803690_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_098982251.1|1804327_1804699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098982253.1|1804798_1805839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098982255.1|1805849_1806980_+	caspase family protein	NA	NA	NA	NA	NA
WP_098982257.1|1806969_1808946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098982260.1|1809293_1810445_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.7	9.5e-45
1811755:1811813	attR	GATTCAAAATCCGCCGATGAATAATCGTGTCGGTTCGAGTCCGACCCCGGGCACCATCA	NA	NA	NA	NA
>prophage 4
NZ_CP023818	Aeromonas sp. CA23 chromosome, complete genome	5099209	2741751	2851728	5099209	head,terminase,plate,portal,integrase,tRNA,capsid,holin,lysis,tail	Aeromonas_virus(67.44%)	109	2792335:2792356	2827294:2827315
WP_098983524.1|2741751_2742312_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_043556646.1|2742515_2744753_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_098983526.1|2744803_2746453_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_043137469.1|2746644_2747463_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	1.2e-14
WP_042036494.1|2747646_2748357_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_043137467.1|2748549_2749869_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_172955303.1|2749887_2750427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098985081.1|2750733_2751636_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_098983529.1|2751645_2753046_+	amino acid permease	NA	NA	NA	NA	NA
WP_172955304.1|2753122_2753962_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_098983535.1|2754232_2754595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042870747.1|2754683_2755427_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	2.0e-35
WP_172955305.1|2755516_2756476_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_042870751.1|2756570_2757359_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_098983543.1|2757858_2758992_+	GGDEF domain-containing protein	NA	A0A2D0WBV8	Bordetella_phage	42.7	2.2e-06
WP_098983547.1|2758996_2760340_-	MFS transporter	NA	NA	NA	NA	NA
WP_098983549.1|2760364_2761885_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_042036506.1|2761881_2762472_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_042036507.1|2762687_2763083_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_172955306.1|2763312_2764047_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_098983554.1|2764127_2764811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172955307.1|2764866_2766258_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_098983559.1|2766281_2767673_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_042870767.1|2768004_2768955_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_157774617.1|2769184_2769358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983562.1|2769394_2770543_+	MFS transporter	NA	NA	NA	NA	NA
WP_098983564.1|2770704_2771613_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	25.0	9.2e-11
WP_043137423.1|2771689_2772349_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_043137422.1|2772523_2774596_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.6	5.5e-43
WP_098983567.1|2774978_2776034_+	porin	NA	NA	NA	NA	NA
WP_172955308.1|2776266_2777208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983569.1|2777367_2778558_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_098983571.1|2778746_2780249_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	46.1	1.1e-85
WP_098983574.1|2780387_2780882_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_043137408.1|2780875_2781394_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_172955309.1|2781421_2783689_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_043137406.1|2783958_2785728_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	2.3e-58
WP_098983576.1|2785727_2786723_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_042036532.1|2786890_2787079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983579.1|2787075_2787837_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011706579.1|2788049_2788694_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_098983582.1|2788823_2790677_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_042036538.1|2791226_2791781_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2792335:2792356	attL	AAGTGGCGACAGAGTGGCGACA	NA	NA	NA	NA
WP_005320072.1|2792436_2792769_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_029303943.1|2792770_2793055_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_098983584.1|2793716_2795330_-	hypothetical protein	NA	A5X9J8	Aeromonas_virus	90.9	7.5e-290
WP_098983586.1|2795326_2795869_-	hypothetical protein	NA	A5X9J7	Aeromonas_virus	90.7	6.0e-82
WP_098983588.1|2795865_2796747_-	hypothetical protein	NA	A5X9J6	Aeromonas_virus	77.1	8.7e-123
WP_098983591.1|2796743_2797169_-|tail	tail fiber assembly protein	tail	A5X9J5	Aeromonas_virus	49.7	3.2e-30
WP_098983594.1|2797184_2799272_-|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	69.8	2.0e-282
WP_098983596.1|2799268_2799871_-|tail	phage tail protein	tail	A5X9J2	Aeromonas_virus	92.5	1.6e-107
WP_098983599.1|2799863_2801051_-|plate	baseplate J/gp47 family protein	plate	A5X9J1	Aeromonas_virus	91.5	9.7e-202
WP_043145185.1|2801047_2801371_-	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	94.4	4.2e-51
WP_098983601.1|2801385_2803437_-|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	63.9	2.6e-226
WP_098983604.1|2803631_2803895_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	67.8	4.2e-25
WP_098983605.1|2804018_2804453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098983606.1|2804449_2804911_-	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	85.0	9.2e-76
WP_043144985.1|2804897_2805224_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	59.4	6.2e-26
WP_098983607.1|2805247_2805457_-	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	79.7	1.8e-26
WP_011898576.1|2805466_2805922_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	90.7	7.7e-75
WP_098983608.1|2805925_2807062_-	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	86.0	1.1e-189
WP_098983609.1|2807066_2807753_-	phage virion morphogenesis protein	NA	A5X9H9	Aeromonas_virus	84.1	3.5e-103
WP_098983610.1|2807755_2808274_-|tail	phage tail protein	tail	A5X9H8	Aeromonas_virus	90.1	5.7e-90
WP_098983611.1|2808270_2808732_-|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	89.5	7.8e-67
WP_098983612.1|2808847_2809576_-|terminase	terminase endonuclease subunit	terminase	A5X9H6	Aeromonas_virus	94.6	1.2e-130
WP_098983613.1|2809579_2810632_-|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	84.7	1.9e-169
WP_098983614.1|2810641_2811514_-|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	69.6	1.7e-110
WP_098983615.1|2811691_2813512_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	90.4	0.0e+00
WP_098983616.1|2813508_2814525_+|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	92.3	1.3e-183
WP_098983617.1|2814583_2814835_+	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	77.1	5.8e-32
WP_098985084.1|2814842_2815214_-	QacE	NA	NA	NA	NA	NA
WP_098983619.1|2819956_2820214_-	hypothetical protein	NA	A5X9G3	Aeromonas_virus	42.0	5.8e-11
WP_098983620.1|2820210_2820516_-	hypothetical protein	NA	A5X9G2	Aeromonas_virus	66.7	3.6e-28
WP_098983621.1|2820512_2820722_-	hypothetical protein	NA	A5X9G1	Aeromonas_virus	84.1	2.8e-24
WP_098983622.1|2820792_2821056_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162829731.1|2821070_2821247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098983623.1|2821314_2821767_-	hypothetical protein	NA	A5X9F8	Aeromonas_virus	80.6	3.7e-61
WP_098983624.1|2821783_2822305_-	phage regulatory CII family protein	NA	A5X9F7	Aeromonas_virus	71.1	2.7e-63
WP_098983625.1|2822309_2822567_-	regulator	NA	Q1I116	Pasteurella_virus	43.3	7.8e-08
WP_098985085.1|2822590_2822779_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_098985086.1|2822896_2823559_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.6	1.6e-44
WP_157774618.1|2823655_2824537_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_098983627.1|2824533_2825160_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_098983628.1|2825152_2825467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983629.1|2825816_2826872_+|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	56.7	7.2e-108
WP_098983630.1|2826930_2827293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157774619.1|2828679_2829177_-	hypothetical protein	NA	NA	NA	NA	NA
2827294:2827315	attR	AAGTGGCGACAGAGTGGCGACA	NA	NA	NA	NA
WP_098983631.1|2829133_2829865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157774680.1|2830105_2830525_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	83.3	2.6e-08
WP_157774620.1|2831183_2831969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098983632.1|2832531_2833002_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	51.1	4.4e-33
WP_098983633.1|2833115_2833553_-|lysis	phage lysis regulatory protein LysB	lysis	E5G6N2	Salmonella_phage	34.1	1.6e-08
WP_098983635.1|2835324_2836119_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_098985088.1|2836170_2837172_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_098983636.1|2837201_2838134_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_098983637.1|2838238_2838682_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080741165.1|2838992_2839169_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_172955310.1|2839340_2839511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983638.1|2839645_2841637_-	MtrB/PioB family decaheme-associated outer membrane protein	NA	NA	NA	NA	NA
WP_042866040.1|2841648_2842623_-	DmsE family decaheme c-type cytochrome	NA	NA	NA	NA	NA
WP_098983639.1|2842676_2844791_-	OmcA/MtrC family decaheme c-type cytochrome	NA	NA	NA	NA	NA
WP_098983640.1|2845038_2845650_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_098983641.1|2845811_2846447_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_098983642.1|2846443_2847112_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_098983643.1|2847160_2848114_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_098983644.1|2848223_2848961_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_098983645.1|2848957_2849638_-	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_042866052.1|2849627_2850125_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_098983646.1|2850351_2851728_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.9	1.0e-45
>prophage 5
NZ_CP023818	Aeromonas sp. CA23 chromosome, complete genome	5099209	3064397	3080688	5099209	transposase,integrase	Vibrio_phage(27.27%)	23	3054481:3054497	3083901:3083917
3054481:3054497	attL	GCCCCCCCAGCACCAGC	NA	NA	NA	NA
WP_098983769.1|3064397_3066611_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M4U788	Ralstonia_phage	32.8	2.4e-36
WP_065402762.1|3066652_3067375_+	ATP-binding protein	NA	M4SPU5	Rhodobacter_phage	26.9	1.3e-20
WP_157774627.1|3067419_3068037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983771.1|3068020_3068581_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_098983772.1|3068638_3068881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005906330.1|3068891_3069071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983773.1|3069081_3069702_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	59.4	7.8e-62
WP_005906326.1|3069714_3069930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983774.1|3070037_3070274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157774628.1|3070260_3070449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983775.1|3070426_3071053_+	regulatory protein GemA	NA	A0A2I7S9B8	Vibrio_phage	36.8	1.7e-24
WP_098985099.1|3071042_3071477_+	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	42.5	1.3e-23
WP_157774629.1|3071549_3072173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098985100.1|3072228_3073272_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.8	4.9e-32
WP_098983777.1|3073351_3073936_+	peptidoglycan-binding protein	NA	B0ZSJ3	Halomonas_phage	32.1	3.6e-16
WP_098983778.1|3073932_3074277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983779.1|3074269_3074491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083195381.1|3074523_3074751_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_083195382.1|3074731_3075046_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_098983780.1|3075042_3075339_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	57.0	2.1e-17
WP_098983781.1|3075449_3076025_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	67.9	2.6e-59
WP_172955435.1|3076078_3077596_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	62.2	7.8e-164
WP_098983782.1|3079197_3080688_+	F protein	NA	A0A2H4IYU7	uncultured_Caudovirales_phage	52.7	3.1e-64
3083901:3083917	attR	GCCCCCCCAGCACCAGC	NA	NA	NA	NA
>prophage 6
NZ_CP023818	Aeromonas sp. CA23 chromosome, complete genome	5099209	3206795	3237270	5099209	protease,plate	Cronobacter_phage(12.5%)	22	NA	NA
WP_098983851.1|3206795_3207227_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_098983852.1|3207230_3209000_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_098985110.1|3208963_3209962_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_098983853.1|3210002_3211241_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_042869816.1|3211240_3211756_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_098983854.1|3211758_3213093_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_043135905.1|3213115_3213895_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_098983855.1|3213916_3216559_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.3	1.1e-93
WP_098983856.1|3216561_3218100_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_098983857.1|3218099_3218729_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_098985112.1|3218737_3220168_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_098983858.1|3220209_3223707_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_098983859.1|3223751_3225182_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_042869831.1|3225473_3225761_+	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	38.3	3.0e-08
WP_098983860.1|3225772_3227821_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.1	6.7e-33
WP_157774634.1|3227860_3230548_+	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	33.6	8.2e-07
WP_156995020.1|3230553_3230952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157774635.1|3231239_3231755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098983861.1|3233217_3234081_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.2	6.7e-27
WP_005300025.1|3234191_3234410_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005310725.1|3234639_3234957_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	5.3e-14
WP_043556842.1|3235017_3237270_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.4	1.2e-168
>prophage 7
NZ_CP023818	Aeromonas sp. CA23 chromosome, complete genome	5099209	3518015	3529159	5099209	tRNA	Tupanvirus(16.67%)	8	NA	NA
WP_043135382.1|3518015_3519944_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.0	2.2e-126
WP_098984015.1|3519947_3520496_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.9	2.8e-15
WP_005315535.1|3520581_3520779_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005300683.1|3520793_3521150_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_042866463.1|3521470_3522454_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.2	5.3e-36
WP_098984016.1|3522466_3524854_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.5	1.1e-05
WP_005300715.1|3524857_3525154_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
WP_172955345.1|3525190_3529159_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	36.8	4.4e-33
>prophage 8
NZ_CP023818	Aeromonas sp. CA23 chromosome, complete genome	5099209	4682316	4740141	5099209	holin,integrase	uncultured_Caudovirales_phage(14.29%)	55	4700577:4700591	4742156:4742170
WP_157774660.1|4682316_4683771_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J185	uncultured_Caudovirales_phage	27.7	1.1e-24
WP_157774661.1|4683790_4684378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157774662.1|4684374_4686285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157774663.1|4686281_4687319_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157774664.1|4687352_4687748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098984654.1|4688078_4690367_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_172955389.1|4690353_4691160_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_098984656.1|4691321_4692227_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172955390.1|4692640_4693213_+	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	31.8	6.4e-10
WP_098984658.1|4693234_4694044_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172955391.1|4694043_4694559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098984660.1|4695297_4695576_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_098984661.1|4695592_4695877_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_098984662.1|4695890_4696169_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_098984663.1|4696222_4697809_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_098984664.1|4697835_4698093_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_098984665.1|4698108_4699263_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_098984666.1|4699288_4702675_+|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
4700577:4700591	attL	ATACCATGAGCACCC	NA	NA	NA	NA
WP_172955392.1|4702776_4703736_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_098984668.1|4703748_4704201_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_098984669.1|4704197_4704818_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_098984670.1|4704829_4705522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098984671.1|4705541_4705955_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_098984672.1|4705972_4706302_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_098984673.1|4707112_4708030_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_098984674.1|4708060_4709059_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_043554068.1|4709197_4709917_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_098984675.1|4710185_4711142_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_043554066.1|4711292_4711781_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	42.1	1.5e-15
WP_098984677.1|4712056_4712779_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_098984678.1|4712775_4713624_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005334342.1|4713765_4714008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098984679.1|4714233_4714887_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.1	4.0e-40
WP_043134635.1|4715355_4716192_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.1	3.1e-13
WP_098984680.1|4716276_4717539_-	DUF945 family protein	NA	NA	NA	NA	NA
WP_098984681.1|4717634_4719116_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_026080151.1|4719213_4719756_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_052449139.1|4719760_4720201_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172955393.1|4720215_4720362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098984684.1|4720676_4721840_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_172955394.1|4722033_4723431_+	alpha-amylase	NA	NA	NA	NA	NA
WP_172955447.1|4723588_4724344_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	59.5	3.4e-27
WP_098985203.1|4724463_4725150_-	aquaporin Z	NA	NA	NA	NA	NA
WP_043134627.1|4725488_4726010_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_098984687.1|4726282_4727194_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_098984688.1|4727485_4728016_+	DinB family protein	NA	NA	NA	NA	NA
WP_098984689.1|4728012_4728453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098984690.1|4728528_4728744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157774665.1|4729143_4729383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157774666.1|4729393_4729981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098984691.1|4730184_4731876_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_098985204.1|4732016_4734410_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	68.0	2.5e-100
WP_098984692.1|4735289_4736495_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_098984693.1|4736491_4738234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098984694.1|4738236_4740141_+|integrase	integrase	integrase	NA	NA	NA	NA
4742156:4742170	attR	ATACCATGAGCACCC	NA	NA	NA	NA
