The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	348320	381575	5484708	head,protease,tail,terminase,tRNA,portal,capsid,integrase	uncultured_Caudovirales_phage(75.0%)	34	365925:365942	381920:381937
WP_002919147.1|348320_349268_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|349282_349792_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|349920_351045_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|351016_351490_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|351515_352058_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|352062_352635_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|352638_353457_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|353453_353711_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|353686_354241_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|360033_360255_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|360548_363659_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|363671_364811_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|365189_365840_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
365925:365942	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|366115_367342_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|367434_368376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|368557_368842_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|368852_369632_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|370083_370353_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|370345_370534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|370526_370841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|370837_371206_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|371202_371568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|371567_373703_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|374045_374381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|374429_374942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|375205_376372_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|376423_376984_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|376985_378227_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|378223_378559_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|378555_378855_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|378854_379298_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|379290_379443_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|379573_379930_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|379913_381575_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
381920:381937	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	1139442	1188586	5484708	head,lysis,transposase,terminase,tail,tRNA,portal,capsid,plate,integrase	Salmonella_phage(80.0%)	62	1138857:1138903	1177212:1177258
1138857:1138903	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000019473.1|1139442_1140423_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1140468_1141467_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1141469_1142099_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1142221_1142464_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1142496_1143006_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1143013_1143214_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1143177_1143516_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1143583_1143817_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1143816_1144044_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1144040_1144892_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1144888_1147273_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004178082.1|1147750_1149238_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1149345_1149534_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1149545_1149779_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1149874_1150558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1150544_1151624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1151623_1152625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1153146_1153416_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1153472_1154516_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1154515_1156279_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1156419_1157253_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1157269_1158322_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1158325_1158979_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1159074_1159539_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1159538_1159742_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1159745_1159961_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1159941_1160451_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1160455_1160839_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1160835_1161264_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1161238_1161397_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1161359_1161782_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1161774_1162221_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1162243_1163110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1163204_1163777_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1163773_1164136_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1164122_1165031_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1165023_1165695_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1165696_1167646_+	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1167655_1168774_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1168825_1169899_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1170047_1171220_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1171229_1171745_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1171797_1172097_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1172111_1172231_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1172457_1174854_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1174850_1175336_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1175332_1176427_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1176493_1176712_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1176739_1177117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1177720_1178203_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1177212:1177258	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1178313_1178790_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1178779_1179070_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1179136_1179478_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1179625_1181287_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1181373_1182252_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1182376_1182967_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1183086_1184373_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1184392_1185184_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1185347_1186712_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1186971_1187220_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1187238_1187787_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1187818_1188586_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	1293302	1346045	5484708	holin,transposase,tail,terminase,integrase	Salmonella_phage(39.22%)	58	1286637:1286651	1316742:1316756
1286637:1286651	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1293302_1294769_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1294836_1296414_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1296605_1297856_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1297798_1298041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1298037_1298631_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1298627_1299290_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1299286_1299445_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1299437_1299731_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1299840_1300089_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1300137_1301019_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1301015_1301837_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1301833_1302133_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1302129_1302279_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004144290.1|1302499_1303081_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1303235_1303469_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1303615_1303825_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1303824_1304592_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1304588_1305374_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1305493_1305841_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1306033_1306444_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1306427_1306619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1306615_1307260_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1307553_1308021_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1308020_1308314_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1308310_1308931_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1308930_1309134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1309126_1309465_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004178082.1|1309561_1311049_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032418540.1|1311449_1311707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1311784_1312369_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1312365_1313841_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1313884_1314256_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004141368.1|1315009_1315216_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1315230_1316913_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1316742:1316756	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1316909_1317206_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1317208_1317889_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1317903_1318890_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1318943_1319381_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1319391_1319733_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1319783_1320107_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1320106_1320712_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1320711_1323189_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1323188_1323653_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1323652_1324192_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1324202_1326737_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1326736_1328647_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1328646_1331403_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955133.1|1331879_1332176_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955131.1|1335003_1335267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153233543.1|1335307_1336573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547080.1|1336554_1337535_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_000608644.1|1338403_1339666_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1340774_1342091_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1342177_1342582_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1342568_1342874_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1342863_1343493_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1343489_1343990_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1344176_1346045_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	1678394	1685299	5484708	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1678394_1679258_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_004180550.1|1679268_1680042_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1680282_1681179_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1681421_1682783_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1683101_1683824_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1683820_1685299_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	1728644	1740319	5484708	transposase	Escherichia_phage(33.33%)	10	NA	NA
WP_000043543.1|1728644_1730051_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1730277_1731693_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1731714_1733085_+	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1733239_1734304_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1734317_1735187_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1735218_1736109_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1736123_1736678_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1736857_1738024_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_158208765.1|1738416_1739298_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000019473.1|1739338_1740319_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 6
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	2733029	2743916	5484708		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2733029_2736137_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2736191_2737457_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2737487_2738576_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2738662_2738923_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2739220_2740081_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2740101_2740863_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2741123_2742026_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2742037_2743303_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2743295_2743916_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	2927318	3000015	5484708	holin,transposase,terminase,plate,integrase	uncultured_Caudovirales_phage(33.33%)	84	2991128:2991142	2997137:2997151
WP_002902268.1|2927318_2928404_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2928367_2930122_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2931793_2935219_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|2935202_2936342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2936338_2936596_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|2936640_2939058_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|2939045_2939576_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2939643_2940174_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2940242_2940773_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2940840_2941371_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|2941439_2941970_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|2942033_2942813_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|2942813_2945183_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|2945184_2947839_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|2948103_2948595_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151602.1|2948599_2950306_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|2950302_2950992_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|2950988_2952332_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|2952341_2953886_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|2953928_2954420_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000019473.1|2954889_2955870_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002902136.1|2956465_2956714_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|2956936_2957221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2957325_2957535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171482183.1|2957531_2957906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|2958273_2959002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|2961352_2961550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|2961549_2962416_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2962415_2963189_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2963185_2964382_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2964381_2964735_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2964736_2965390_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2965443_2966010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|2966052_2966235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|2966284_2966626_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|2966625_2967648_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|2967650_2967878_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|2967953_2968553_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2968552_2970556_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|2970545_2970698_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|2970733_2971159_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|2971162_2971603_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|2971613_2972759_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|2972762_2973203_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|2973297_2973684_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|2973683_2974190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2974186_2974606_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|2974574_2974856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|2974895_2975837_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|2975848_2976343_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|2976346_2977549_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|2977600_2978149_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|2978204_2979656_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|2979893_2981294_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|2981244_2981733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|2982098_2982419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|2982653_2983043_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|2983039_2983570_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|2983572_2983821_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152167.1|2984226_2985009_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|2985005_2985482_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|2985478_2986441_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|2986442_2988101_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|2988677_2988899_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|2988996_2989665_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|2989835_2990150_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|2990142_2990331_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|2990500_2990866_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|2990858_2991113_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|2991084_2991303_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
2991128:2991142	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|2991299_2991725_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|2991721_2991916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|2991912_2992740_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|2992844_2993363_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|2993368_2994079_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|2994068_2994293_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|2994289_2994502_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|2994744_2994978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|2995050_2995197_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|2995156_2995399_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|2995379_2996561_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|2996757_2997306_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
2997137:2997151	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|2997504_2999037_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|2999253_3000015_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	3032948	3063992	5484708	integrase,holin,transposase	Enterobacteria_phage(33.33%)	41	3032730:3032745	3061298:3061313
3032730:3032745	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3032948_3033620_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3033806_3034634_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3034709_3035975_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3035976_3036396_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004178082.1|3036475_3037963_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001067855.1|3039872_3040577_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|3041192_3041540_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3041703_3042495_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3043476_3044181_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3044217_3044505_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3044501_3045041_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3045037_3045337_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|3045986_3046676_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3046675_3046816_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3046812_3047451_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3047443_3048112_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3048108_3048276_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3048256_3048724_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243011.1|3048856_3049135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|3049244_3050273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3050480_3050726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3050781_3051084_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3051080_3051929_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3051925_3052786_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3052871_3053093_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3053133_3053361_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3053472_3054171_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|3054458_3055535_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3055616_3055820_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|3056130_3056256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|3056248_3056443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3056531_3056816_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3056831_3057677_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3057673_3057961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3057962_3058643_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3058639_3059068_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3059064_3059727_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151900.1|3059934_3061152_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|3061298_3062189_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3061298:3061313	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3062188_3063181_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3063182_3063992_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 9
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	3191663	3279542	5484708	holin,head,tail,terminase,tRNA,portal,capsid,integrase	Klebsiella_phage(45.24%)	95	3218466:3218480	3277353:3277367
WP_002901088.1|3191663_3192164_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3192280_3192727_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|3192710_3193505_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014343001.1|3193612_3194788_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3194819_3195512_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3195657_3196167_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|3196171_3196510_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150780.1|3196499_3196739_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3197039_3198053_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3198110_3198212_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3198211_3198286_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3198403_3198529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3198588_3198852_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3198982_3199621_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3199710_3200625_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3201286_3202330_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3202632_3203841_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3203914_3205699_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3205705_3206596_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3206716_3208225_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150789.1|3208258_3208423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3208535_3209222_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3209619_3209799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3209838_3210471_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3211037_3211235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3211350_3212361_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3212357_3213764_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3213819_3214707_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3214723_3215230_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3215256_3215751_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3215841_3216027_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3216648_3217842_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3217954_3218182_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004225560.1|3218323_3218500_+	hypothetical protein	NA	NA	NA	NA	NA
3218466:3218480	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3218618_3218942_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3218934_3219327_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3219323_3220037_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3220309_3220462_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3220616_3222113_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3222181_3234886_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3234948_3235542_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3235568_3235991_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3236032_3236743_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3236744_3237500_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3237496_3237835_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3237834_3241170_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_014228914.1|3241402_3241768_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3241825_3242287_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_168895379.1|3242318_3242711_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.8	7.1e-61
WP_017880258.1|3242716_3243106_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3243086_3243425_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3243421_3243739_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3243719_3243980_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3244038_3245325_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3245402_3246323_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3246359_3247619_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3247618_3247798_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3247791_3249513_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3249512_3249947_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3250195_3250627_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3250623_3250947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3250898_3251261_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_162838183.1|3251244_3251409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032749552.1|3251587_3251812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3251850_3252288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3253237_3253588_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3253584_3254082_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3254081_3254297_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3255214_3255364_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3256101_3256305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3256548_3257151_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3257167_3258199_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861428.1|3258398_3258791_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_071531363.1|3258831_3259071_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
WP_025368263.1|3259133_3259367_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004178082.1|3259445_3260933_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062954975.1|3261770_3263132_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3263305_3264019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3264370_3265240_+	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_062954977.1|3265328_3266720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3267068_3267509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165904233.1|3267522_3268194_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	5.9e-63
WP_046622349.1|3269043_3269598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3269600_3269825_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3269913_3270351_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3270672_3270987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3271377_3271572_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3271614_3271959_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3272100_3274239_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3274291_3274537_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3274517_3275645_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|3275762_3277013_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3277253_3277904_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3277353:3277367	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3277920_3278379_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3278435_3279542_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	3389480	3445639	5484708	head,protease,tail,terminase,portal,capsid,plate,integrase	Enterobacteria_phage(40.0%)	62	3387640:3387660	3422164:3422184
3387640:3387660	attL	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
WP_077273873.1|3389480_3390635_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	77.2	6.6e-171
WP_072353964.1|3390786_3391968_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.4	8.0e-156
WP_004187274.1|3391968_3392484_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_072353963.1|3392535_3392835_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	72.7	2.9e-30
WP_050554917.1|3392855_3393008_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.5e-11
WP_072353962.1|3392997_3395733_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	80.6	2.0e-242
WP_072353961.1|3395744_3396233_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	59.9	2.9e-51
WP_072353960.1|3396330_3397407_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	48.3	2.3e-32
WP_064144972.1|3397418_3398162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353959.1|3398167_3400432_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	39.7	5.7e-102
WP_072353958.1|3400433_3401036_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	44.8	1.8e-42
WP_040209819.1|3401028_3401928_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.2	6.2e-92
WP_004187254.1|3401914_3402283_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
WP_072353957.1|3402279_3402864_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.4	8.7e-63
WP_072353956.1|3402863_3403505_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.8	1.4e-45
WP_004187249.1|3403501_3403960_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.8	3.1e-31
WP_072353969.1|3403956_3404220_-	peptidase	NA	NA	NA	NA	NA
WP_117328715.1|3404104_3404500_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_072353955.1|3404496_3405048_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	6.8e-33
WP_004187237.1|3405044_3405326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187236.1|3405316_3405517_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	3.0e-15
WP_032705909.1|3405516_3406014_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	69.7	2.2e-59
WP_072353954.1|3406116_3406977_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	68.4	1.0e-83
WP_060528036.1|3407023_3408073_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.9	2.3e-106
WP_072353953.1|3408096_3408930_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.3	6.5e-96
WP_060528038.1|3409090_3410812_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.5	4.3e-227
WP_072353952.1|3410814_3411867_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.0	2.7e-139
WP_072353968.1|3412274_3412589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353951.1|3412861_3413269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353950.1|3413440_3416035_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.7	1.1e-192
WP_072353949.1|3416027_3417044_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.8	2.4e-92
WP_158413321.1|3417019_3417175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328153.1|3417185_3417359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353948.1|3417345_3418314_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	49.1	3.1e-73
WP_046624144.1|3418322_3418901_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	39.5	2.7e-32
WP_046624145.1|3418897_3419122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187204.1|3419189_3419462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187203.1|3419477_3419864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561575.1|3419880_3420078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328159.1|3420269_3420602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201485.1|3420696_3420999_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	61.0	2.6e-26
WP_072353947.1|3421086_3422094_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.1	7.6e-99
WP_002898698.1|3422190_3423438_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
3422164:3422184	attR	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
WP_002898606.1|3423590_3424040_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150831.1|3424155_3424944_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002898602.1|3424964_3425186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898600.1|3425442_3425565_+	small membrane protein	NA	NA	NA	NA	NA
WP_002898598.1|3425683_3427075_-	APC family permease	NA	NA	NA	NA	NA
WP_002898595.1|3427428_3428850_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_004221445.1|3429075_3429828_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_002898590.1|3429853_3430411_+	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_004150832.1|3430731_3432219_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_062954981.1|3432221_3433502_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004221441.1|3433498_3434461_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002898577.1|3434543_3435629_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_002898574.1|3436133_3437741_+	BCCT family transporter	NA	NA	NA	NA	NA
WP_002898571.1|3437777_3438902_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004150833.1|3438920_3440369_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002898475.1|3440426_3441392_+	oxidoreductase	NA	NA	NA	NA	NA
WP_002898472.1|3441561_3441750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150834.1|3443057_3444710_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|3444979_3445639_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 11
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	3530408	3623359	5484708	head,protease,lysis,tail,terminase,tRNA,portal,capsid,plate,integrase	Salmonella_phage(58.62%)	94	3585934:3585952	3623434:3623452
WP_002898139.1|3530408_3531701_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3531791_3533135_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3533143_3533755_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3533877_3538131_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3538266_3538761_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3539293_3540262_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3540376_3542143_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3542143_3543865_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3543909_3544611_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3544964_3545183_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3545303_3547583_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3547613_3547931_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3548256_3548478_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3548554_3550495_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3550491_3551607_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3551753_3553412_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3553831_3554527_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3554642_3555542_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3555685_3557338_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3557348_3558317_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3558528_3558963_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3559114_3560833_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3560871_3561873_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3561883_3563326_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3563413_3564427_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3564423_3565254_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3565285_3566425_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3567302_3567818_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3568044_3568773_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3568793_3569525_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3569531_3570248_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3570247_3570916_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3571099_3571831_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3571873_3573346_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3573342_3574059_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3574137_3575265_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3575306_3575795_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3575852_3576698_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3576694_3577648_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3577658_3578792_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3578955_3580068_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3580416_3580896_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3580984_3581887_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3582708_3582996_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3583198_3583462_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3583468_3583852_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3584118_3585804_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3585934:3585952	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3586023_3586242_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3586333_3587434_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3587430_3587916_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3587912_3590306_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3590532_3590652_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3590666_3590966_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3591018_3591534_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3591543_3592716_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3592854_3593931_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3593960_3594164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171482189.1|3594160_3594535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3594895_3595630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|3597848_3598448_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3598440_3599349_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3599335_3599698_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3599694_3600267_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3600361_3601054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3601050_3601497_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3601489_3601921_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3601883_3602030_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3602016_3602445_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3602441_3602825_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3602829_3603339_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3603319_3603535_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3603538_3603742_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3603741_3604206_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3604301_3604952_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3604955_3606014_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3606030_3606864_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3607006_3608773_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3608772_3609798_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3609859_3611602_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3611877_3612555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3612669_3612903_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3612913_3613102_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3613255_3615670_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3615666_3616524_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3616520_3616748_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3616747_3616981_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3617048_3617390_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3617353_3617554_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3617561_3618071_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3618103_3618325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3618470_3619349_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3619360_3620305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3620403_3621891_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3622378_3623359_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3623434:3623452	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 12
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	4275142	4286795	5484708	integrase	Enterobacteria_phage(70.0%)	13	4275592:4275606	4298648:4298662
WP_004144574.1|4275142_4276246_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4275592:4275606	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4276256_4277510_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4277862_4279053_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4279040_4279991_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4279990_4280416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4280983_4281550_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4281567_4281813_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4281809_4282547_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4283088_4283355_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4283357_4283909_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4283905_4284133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4284129_4284450_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4284461_4286795_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4298648:4298662	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 13
NZ_CP023941	Klebsiella pneumoniae strain FDAARGOS_444 chromosome, complete genome	5484708	4755036	4764561	5484708	transposase	Enterobacteria_phage(85.71%)	11	NA	NA
WP_004152207.1|4755036_4757370_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4757384_4757705_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4757701_4757929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4757925_4758468_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4758470_4758737_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4759297_4760035_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4760031_4760277_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4760294_4760861_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4761601_4762681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4762681_4763218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4763580_4764561_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP023943	Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence	196733	1614	61889	196733	transposase,integrase,protease	Escherichia_phage(39.13%)	46	34777:34836	42567:43388
WP_000124025.1|1614_4602_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.4e-294
WP_001138064.1|4936_7903_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_046788546.1|7911_8313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|8397_9102_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|10026_10911_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|11127_12342_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_000743213.1|12615_12840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|12836_13574_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|14059_14200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|14205_14910_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000227969.1|15622_16699_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189111.1|17240_18749_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_006788217.1|20635_20815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098977.1|20934_21561_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
WP_004098982.1|22193_23069_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_087759376.1|24165_25286_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_020324562.1|25383_26088_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_004201232.1|27920_28607_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_004201234.1|28744_29482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201235.1|30001_31471_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001067855.1|32622_33327_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|33470_34112_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
34777:34836	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|34840_35545_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|36235_37249_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|37540_38095_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001749986.1|38191_38644_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_001749985.1|38776_39250_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_001749984.1|39430_40276_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_000679427.1|40392_40740_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|40733_41573_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001067855.1|42630_43335_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153729.1|44190_45018_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
42567:43388	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCG	NA	NA	NA	NA
WP_004152695.1|45014_45878_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|45886_46714_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|46722_47733_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|47726_48596_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|49804_50785_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|51986_52250_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|52264_52528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|52771_53053_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|53087_53657_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_098977952.1|53771_56567_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|56566_56764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|57001_57751_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152113.1|57737_58700_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|60542_61889_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP023942	Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2	187926	9408	23211	187926	transposase	Enterobacteria_phage(18.18%)	16	NA	NA
WP_000019445.1|9408_10389_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_015493085.1|11899_12850_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_040219232.1|12996_13197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|13250_13883_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_015493083.1|14245_15451_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479949.1|15447_16419_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493081.1|16554_17826_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|17825_18248_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493079.1|18427_19099_-	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|19457_20135_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|20134_20356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|20366_20786_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|20839_21619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|22023_22530_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|22572_22764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493072.1|22956_23211_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	5.2e-12
>prophage 2
NZ_CP023942	Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2	187926	53724	64883	187926		Escherichia_phage(50.0%)	10	NA	NA
WP_001568041.1|53724_54426_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|54862_55093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|55155_55827_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_004152353.1|55829_56801_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004178082.1|57049_58537_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568036.1|58943_59375_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|59374_60646_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_011977819.1|60727_61702_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|61701_62907_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|64016_64883_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
>prophage 3
NZ_CP023942	Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2	187926	142762	157390	187926	protease,transposase	Escherichia_phage(50.0%)	14	NA	NA
WP_001067858.1|142762_143467_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_015059004.1|143554_143836_+	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_012372818.1|143916_144672_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|144841_145702_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_064441864.1|145884_146421_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000957857.1|146512_146701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|147378_148083_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|149193_149898_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362812.1|151648_152617_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_013188475.1|152651_153527_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_001067855.1|154037_154742_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|156052_156454_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|156386_156644_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|156736_157390_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
