The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	1439	73642	2172769	transposase,integrase	Staphylococcus_phage(37.5%)	53	20809:20834	23938:23963
WP_099202186.1|1439_2297_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_157771642.1|2432_2708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099202188.1|2712_2919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940638.1|6450_7026_+	AAA family ATPase	NA	C1KFF1	Lactobacillus_virus	22.4	6.4e-10
WP_056940639.1|7059_7704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940640.1|7672_9157_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_056940641.1|9454_10633_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.3	9.7e-37
WP_099202190.1|11207_12410_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_056940655.1|14322_14553_+	copper-binding protein	NA	NA	NA	NA	NA
WP_056940654.1|14552_15104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025006172.1|15122_15752_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_082589053.1|16773_17175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940653.1|17325_18732_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_056940652.1|18808_20341_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	4.2e-48
WP_099202192.1|20330_20918_+	type I restriction endonuclease	NA	NA	NA	NA	NA
20809:20834	attL	TAAATAATCAAATAAATGATAATTTA	NA	NA	NA	NA
WP_005727342.1|20900_21758_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_099202194.1|21867_22401_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_056940413.1|22476_23442_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.4	5.5e-30
WP_099202196.1|23438_23981_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
23938:23963	attR	TAAATAATCAAATAAATGATAATTTA	NA	NA	NA	NA
WP_099202198.1|23977_24607_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_056940412.1|24670_27814_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.0	7.7e-65
WP_056940411.1|27833_29612_+	DUF262 domain-containing protein	NA	U3PFK3	Vibrio_phage	38.7	8.7e-05
WP_056940410.1|31354_32392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162252728.1|33577_34882_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_056940408.1|35311_36430_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	40.4	1.0e-72
WP_013437854.1|36610_37084_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013437855.1|37192_38008_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_056940407.1|38022_39204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940406.1|42305_43085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940405.1|43221_43554_+	monooxygenase	NA	NA	NA	NA	NA
WP_056940404.1|43556_43979_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	40.6	3.5e-29
WP_056940403.1|44483_45017_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.4	7.1e-11
WP_099202200.1|45239_46229_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.7	6.0e-40
WP_099202202.1|46304_47687_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.1	1.4e-58
WP_056940368.1|47871_48111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940367.1|48725_50243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940366.1|50239_52432_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_056940365.1|52424_53828_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_056940364.1|53824_54766_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_056940363.1|54887_55139_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_056940362.1|56148_57906_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_082589034.1|59742_60306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940360.1|61027_61669_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_056940359.1|61722_62184_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.9	3.2e-28
WP_056940358.1|62195_63371_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.5	8.1e-100
WP_056940357.1|63373_63970_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.2	1.4e-31
WP_056940356.1|63962_65021_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	32.2	5.3e-42
WP_056940354.1|66309_66777_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_056940353.1|66872_67730_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.0	2.8e-57
WP_056940369.1|67790_68237_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_056940352.1|68313_68868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940351.1|70054_70588_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099202208.1|72466_73642_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	204807	406849	2172769	plate,terminase,tail,capsid,portal,integrase,tRNA,transposase,protease	Lactobacillus_phage(48.31%)	200	303827:303886	345942:346030
WP_099202216.1|204807_206031_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.7	1.3e-97
WP_056940673.1|207970_209332_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_056940672.1|209787_210441_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_056940671.1|210573_211122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940670.1|211211_211817_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_013438106.1|211818_211980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940669.1|211997_213164_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099202218.1|213224_214274_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.5	5.8e-49
WP_056940573.1|214933_215869_-	carbamate kinase	NA	NA	NA	NA	NA
WP_056940574.1|215870_216911_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_056940575.1|216879_218151_-	arginine deiminase	NA	NA	NA	NA	NA
WP_056940576.1|218227_219079_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056940577.1|219207_221481_+	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.7	5.5e-44
WP_056940578.1|221540_222038_-	lactocepin S-layer protein	NA	NA	NA	NA	NA
WP_082589047.1|222172_223663_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_056940580.1|223834_224548_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_099202220.1|226213_227263_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.5	7.6e-49
WP_013438124.1|227443_227971_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	39.7	4.2e-24
WP_056940220.1|228075_230349_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	36.5	6.4e-77
WP_056940219.1|230459_231149_-	class A sortase	NA	NA	NA	NA	NA
WP_056940218.1|231151_232990_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.6	3.1e-21
WP_056940217.1|233089_234244_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	26.5	4.2e-24
WP_056940216.1|234327_236178_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.8	6.7e-141
WP_056940215.1|236194_236779_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_056940214.1|236791_237841_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_056940213.1|239716_240646_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_056940212.1|240666_241560_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_013438134.1|241610_241976_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_056940211.1|241994_244598_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	5.7e-21
WP_013438136.1|244602_244914_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_041806903.1|244916_245192_-	YlxR family protein	NA	NA	NA	NA	NA
WP_013438138.1|245221_246409_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_056940210.1|246428_246905_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_056940209.1|247015_251323_-	PolC-type DNA polymerase III	NA	Q8W6C3	Saccharomonospora_phage	22.3	1.4e-27
WP_056940208.1|251328_253026_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_056940207.1|253075_254332_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_013438143.1|254342_255158_-	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	35.0	9.5e-07
WP_013438144.1|255163_255898_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.4	1.1e-22
WP_013642134.1|255900_256458_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_013642135.1|256457_257183_-	UMP kinase	NA	NA	NA	NA	NA
WP_056940206.1|257320_258343_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_013438148.1|258376_259150_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_056940205.1|259310_260342_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_056940204.1|260405_261020_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_056940203.1|261144_262320_+	class I SAM-dependent methyltransferase	NA	A0A2K9L0U7	Tupanvirus	33.2	7.4e-45
WP_056940613.1|264207_266151_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.4	1.3e-62
WP_056940612.1|266242_268039_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	20.9	9.1e-10
WP_056940611.1|268031_269798_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.1	1.7e-48
WP_013438154.1|269881_270100_-	YneF family protein	NA	NA	NA	NA	NA
WP_025014877.1|270165_270414_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_056940610.1|270580_271207_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.7	8.9e-13
WP_056940609.1|271225_272029_-	SGNH/GDSL hydrolase family protein	NA	I6P9N4	Staphylococcus_phage	24.8	3.8e-08
WP_056940608.1|272028_272676_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_003629071.1|273016_273364_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_156399039.1|273807_274074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082589049.1|274025_274640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099202224.1|274691_275156_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.1	1.1e-31
WP_099202226.1|275255_276587_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	38.7	8.1e-64
WP_056940347.1|276749_277484_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_056940349.1|277473_277989_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_056940346.1|278055_278328_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_056940345.1|278416_279847_-	signal recognition particle protein	NA	D6PHS7	uncultured_phage	27.0	8.3e-06
WP_013438168.1|279850_280192_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_056940343.1|281000_282428_+	amino acid permease	NA	NA	NA	NA	NA
WP_056940342.1|282488_282896_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056940341.1|282955_284377_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_082589032.1|284422_285751_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_056940340.1|285751_289321_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_056940339.1|289333_290020_-	ribonuclease III	NA	A9YW43	Ostreococcus_tauri_virus	33.8	8.2e-20
WP_056940338.1|290135_291908_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_056940337.1|292120_293872_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_056940336.1|294084_295017_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_056940335.1|295031_295991_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013642166.1|295993_296980_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	8.5e-18
WP_013438181.1|296983_298012_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	3.5e-14
WP_013438182.1|298132_298375_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	40.2	3.1e-06
WP_013438183.1|298408_299410_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_056940334.1|299432_301469_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_056940333.1|301470_303132_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_003547910.1|303153_303516_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_056940332.1|303683_303869_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
303827:303886	attL	TTCAACCAAGGCTTTAAAGTCTGGTAAAGTTACTCGTGTCTAATAATAAAAAAGCCTATT	NA	NA	NA	NA
WP_056940065.1|304096_305218_-	lysin	NA	Q71JA9	Lactobacillus_phage	93.6	1.4e-197
WP_056940120.1|305280_305670_-	hypothetical protein	NA	L0P6Z4	Lactobacillus_phage	97.7	1.3e-59
WP_056940066.1|305678_305903_-	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	90.7	4.4e-31
WP_056940067.1|305886_306096_-	hypothetical protein	NA	L0P8N8	Lactobacillus_phage	68.1	4.9e-08
WP_082589022.1|306115_306343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940069.1|306488_306671_-	hypothetical protein	NA	L0P7C5	Lactobacillus_phage	74.2	3.2e-16
WP_056940070.1|306672_307275_-	hypothetical protein	NA	L0P6H5	Lactobacillus_phage	81.4	2.6e-78
WP_056940071.1|307339_307720_-	hypothetical protein	NA	L0P6Y9	Lactobacillus_phage	75.2	2.0e-52
WP_056940072.1|307716_308154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940073.1|308303_308921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940075.1|310436_311006_-	DUF2313 domain-containing protein	NA	L0P8N4	Lactobacillus_phage	89.4	4.5e-88
WP_056940076.1|310998_312144_-|plate	baseplate J/gp47 family protein	plate	L0P7C2	Lactobacillus_phage	92.1	1.8e-200
WP_056940121.1|312133_312547_-	DUF2634 domain-containing protein	NA	L0P6H1	Lactobacillus_phage	91.2	1.4e-62
WP_056940077.1|312572_312974_-	DUF2577 domain-containing protein	NA	L0P6Y6	Lactobacillus_phage	71.4	7.3e-45
WP_056940078.1|312946_314014_-	hypothetical protein	NA	L0P6D8	Lactobacillus_phage	97.5	9.6e-193
WP_056940079.1|314010_314703_-	hypothetical protein	NA	L0P8M9	Lactobacillus_phage	96.1	1.6e-116
WP_082589023.1|314715_315189_-	hypothetical protein	NA	L0P7B8	Lactobacillus_phage	90.4	4.7e-59
WP_056940080.1|317717_318134_-	hypothetical protein	NA	L0P6Y3	Lactobacillus_phage	97.1	4.6e-66
WP_056940081.1|318146_318620_-|tail	phage tail protein	tail	L0P6D4	Lactobacillus_phage	94.3	1.7e-80
WP_056940082.1|318631_320092_-|tail	phage tail protein	tail	L0P8M7	Lactobacillus_phage	89.5	1.4e-247
WP_056940083.1|320095_320299_-	hypothetical protein	NA	L0P7B3	Lactobacillus_phage	74.6	4.5e-19
WP_056940084.1|320267_320693_-	hypothetical protein	NA	L0P6G4	Lactobacillus_phage	92.2	1.8e-70
WP_056940085.1|320689_321091_-	HK97 gp10 family phage protein	NA	X2CXN4	Lactobacillus_phage	55.6	6.0e-39
WP_056940086.1|321087_321450_-	hypothetical protein	NA	A9D9T8	Lactobacillus_prophage	66.7	1.2e-38
WP_056940087.1|321446_321818_-	hypothetical protein	NA	L0P6D1	Lactobacillus_phage	90.2	1.2e-57
WP_056940088.1|321835_322942_-	hypothetical protein	NA	L0P8M2	Lactobacillus_phage	82.3	5.9e-169
WP_056940089.1|322956_323496_-|capsid	phage capsid protein	capsid	L0P7B0	Lactobacillus_phage	93.9	2.3e-86
WP_082589021.1|324022_325096_-|capsid	minor capsid protein	capsid	A9D9S7	Lactobacillus_prophage	59.8	5.4e-119
WP_099202360.1|325098_326550_-|portal	phage portal protein	portal	X2CY64	Lactobacillus_phage	68.8	5.5e-183
WP_056940091.1|326555_327785_-|terminase	PBSX family phage terminase large subunit	terminase	Q20DD8	Lactobacillus_phage	69.7	4.8e-180
WP_056940122.1|327771_328254_-	hypothetical protein	NA	L0P6X1	Lactobacillus_phage	48.4	3.2e-26
WP_056940092.1|329682_330123_-	hypothetical protein	NA	L0P6G6	Lactobacillus_phage	91.7	1.1e-70
WP_056940093.1|330251_330803_-	hypothetical protein	NA	L0P8Q7	Lactobacillus_phage	71.8	2.0e-08
WP_056940094.1|330925_331264_-	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	88.9	1.1e-52
WP_157771643.1|331265_331421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940095.1|331423_331609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940096.1|331608_331821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940097.1|331846_332029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940098.1|332029_332296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168170597.1|332282_332456_-	hypothetical protein	NA	L0P706	Lactobacillus_phage	85.5	1.6e-20
WP_056940099.1|332445_332838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940100.1|332852_333281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940101.1|333270_333873_-	hypothetical protein	NA	L0P6F5	Lactobacillus_phage	45.9	9.7e-41
WP_056940102.1|333874_334165_-	DUF1599 domain-containing protein	NA	F8J1G5	Lactobacillus_phage	43.0	2.7e-12
WP_056940103.1|334657_335980_-	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	47.8	8.5e-106
WP_056940104.1|335972_336770_-	DNA primase	NA	U3PBE3	Lactobacillus_phage	66.2	2.3e-90
WP_056940105.1|336860_337436_-	hypothetical protein	NA	U3PDN3	Lactobacillus_phage	50.8	5.4e-49
WP_056940106.1|337438_338203_-	AAA family ATPase	NA	U3PIS9	Lactobacillus_phage	57.5	4.3e-70
WP_056940107.1|338216_338570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940108.1|338566_339136_-	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	48.7	1.4e-36
WP_056940109.1|339068_340334_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	56.3	3.4e-128
WP_056940110.1|340451_340811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940111.1|340813_341044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940112.1|341040_341424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940113.1|341423_341900_-	hypothetical protein	NA	A0A0A1EL06	Lactobacillus_phage	41.5	4.5e-25
WP_168170598.1|342022_342184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940114.1|342173_342473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940115.1|342478_342688_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056940116.1|342981_343326_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SCP6	Streptococcus_phage	31.9	5.2e-07
WP_056940117.1|343318_343720_+	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	36.8	5.7e-21
WP_082589025.1|343820_344564_+	hypothetical protein	NA	A0A1P8D5Q9	Corynebacterium_phage	61.1	8.3e-10
WP_056940119.1|344718_345858_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	44.4	1.0e-75
WP_046432383.1|346082_346388_-	hypothetical protein	NA	NA	NA	NA	NA
345942:346030	attR	TTCAACCAAGGCTTTAAAGTCTGGTAAAGTTACTCGTGTCTAATAATAAAAAAGCCTATTAGATCTTCGATCTGGTAGACTATTTTTTT	NA	NA	NA	NA
WP_056940123.1|346432_347119_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_056940124.1|347118_347769_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013642172.1|347780_348671_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_056940125.1|348671_350696_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SD90	Indivirus	27.5	4.4e-21
WP_013438191.1|350685_351441_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_056940126.1|351445_352774_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_056940127.1|352760_353705_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.9	6.2e-10
WP_056940128.1|353718_356118_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_003547927.1|356168_356393_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_056940129.1|356395_357010_-	guanylate kinase	NA	S4W1R9	Pandoravirus	33.1	4.0e-10
WP_056940130.1|357175_357460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940131.1|357460_357901_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_056940132.1|357893_359576_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_056940133.1|359586_360399_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_013642177.1|360399_361269_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_056940134.1|361271_361514_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_056940135.1|361503_362862_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.1	1.7e-32
WP_056940136.1|362848_363700_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	42.6	6.6e-43
WP_056940137.1|363756_364149_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_056940138.1|364148_364583_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_013438204.1|364600_365170_-	elongation factor P	NA	NA	NA	NA	NA
WP_056940139.1|365252_366362_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_013438206.1|366488_366779_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_013438207.1|366799_367111_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_056940140.1|367274_368651_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_056940141.1|368803_369826_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003547962.1|369881_370061_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_056940142.1|370110_370551_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_056940153.1|370663_371503_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_056940143.1|371672_372902_-	lysin	NA	Q65YV6	Lactobacillus_phage	54.8	1.3e-60
WP_013642185.1|373075_373432_-	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_056940144.1|373433_374330_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	26.4	1.1e-11
WP_056940145.1|374657_376238_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	23.0	4.2e-19
WP_056940146.1|376237_377815_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	24.2	1.2e-10
WP_056940147.1|378142_378958_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_056940148.1|379029_379362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940149.1|379586_381584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940150.1|383229_383412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940663.1|386234_387872_-	ATPase	NA	W8CYF6	Bacillus_phage	32.5	1.2e-29
WP_056940664.1|387871_388552_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	1.9e-29
WP_056940665.1|388671_389310_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_013642200.1|389309_390077_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	3.6e-16
WP_056940666.1|390080_390956_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_056940667.1|390960_391866_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_056940668.1|391884_392775_-	phosphate ABC transporter substrate-binding protein	NA	M1U9L0	Synechococcus_phage	23.5	8.8e-06
WP_099202228.1|394734_395592_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_025015408.1|395833_397066_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	2.5e-75
WP_022087364.1|397526_398126_-	SHOCT domain-containing protein	NA	Q38183	Lactococcus_phage	28.0	9.1e-07
WP_056940700.1|398198_398996_-	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	30.5	4.3e-20
WP_014565983.1|399089_399305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940699.1|399766_402148_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_099202230.1|402360_403722_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_056940762.1|403877_404315_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_056940761.1|404364_404646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099202226.1|404953_406285_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	38.7	8.1e-64
WP_099202232.1|406384_406849_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.1	1.4e-31
>prophage 3
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	552179	618090	2172769	tRNA,transposase,bacteriocin	Bacillus_virus(22.22%)	56	NA	NA
WP_056939771.1|552179_553457_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	37.3	7.7e-64
WP_056939772.1|553479_553890_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	40.5	6.0e-18
WP_003627170.1|554112_555090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099202241.1|555271_556450_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_056940740.1|556600_558115_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_056940739.1|558213_559191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099202243.1|559387_560719_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	39.2	9.5e-65
WP_014563192.1|560869_562183_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_056940543.1|562234_564136_-	S-layer protein	NA	NA	NA	NA	NA
WP_056940542.1|564418_565780_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_025005563.1|566865_567738_-	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	23.6	1.7e-06
WP_056940541.1|567750_568992_-	tellurium resistance protein TerC	NA	NA	NA	NA	NA
WP_056940540.1|568991_570107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940539.1|570119_571382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940538.1|571356_574038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156399037.1|574111_574255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940537.1|574512_575325_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099202368.1|577336_577591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438461.1|577693_578341_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_013438462.1|578360_578681_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_056939817.1|578746_579403_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_056939816.1|579414_580647_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013438465.1|580639_581383_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.8e-20
WP_056939815.1|581474_581906_+	HIT family protein	NA	D7NW73	Streptomyces_phage	34.9	4.1e-09
WP_056939814.1|581917_582274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056939813.1|582391_583297_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_056939812.1|583371_584349_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_056939811.1|584341_586837_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_056939810.1|586817_588032_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_013438472.1|588040_588391_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_056939809.1|588408_590466_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_056939808.1|590556_591414_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_056939807.1|591473_592523_-	glycolate oxidase	NA	NA	NA	NA	NA
WP_013086716.1|593529_593859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056939806.1|594246_594570_-	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_056939805.1|595644_596754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082589006.1|596833_598141_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_056939804.1|598401_599043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056939802.1|599587_600367_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_056939821.1|600363_601302_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_052543162.1|603712_603901_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_056939800.1|603897_604212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056939820.1|604439_604925_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_056939798.1|606596_607097_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_022087580.1|607083_607236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438488.1|607245_607449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025015305.1|608074_608992_-	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_056939796.1|609101_610787_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.4	4.6e-72
WP_013642341.1|611090_611765_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_013438494.1|611897_612746_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_022087578.1|612747_614046_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_056939795.1|614379_614697_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_013438497.1|614769_615474_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014566105.1|615591_617025_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.5	3.7e-91
WP_013438499.1|617034_617580_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	40.4	1.7e-28
WP_056939794.1|617835_618090_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 4
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	638252	702136	2172769	tRNA,transposase	Staphylococcus_phage(33.33%)	46	NA	NA
WP_056939783.1|638252_640667_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.5	0.0e+00
WP_056939782.1|640956_641619_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_056939781.1|641672_642884_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_056939780.1|642903_643803_-	prenyltransferase	NA	NA	NA	NA	NA
WP_056939779.1|643876_644857_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_056939778.1|644861_646610_-	thiol reductant ABC exporter subunit CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.6	1.9e-20
WP_056939777.1|646599_648318_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.2	1.5e-22
WP_056939776.1|648319_649336_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_056939775.1|649336_650773_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_099202218.1|651072_652122_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.5	5.8e-49
WP_056940727.1|652323_653784_-	MFS transporter	NA	NA	NA	NA	NA
WP_013438508.1|653806_655006_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.3	3.3e-141
WP_056940728.1|655455_656343_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_013436902.1|659731_659917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099202253.1|662241_663603_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_056940572.1|663790_664255_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.8	1.1e-41
WP_056940571.1|664267_666610_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	36.1	5.0e-85
WP_013437272.1|666680_666914_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013437271.1|666981_669042_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.3	1.8e-142
WP_056940570.1|669113_670139_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_056940569.1|670138_671182_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013641552.1|671195_672359_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_056940568.1|674099_674522_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_013436902.1|679178_679364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940751.1|681458_682454_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_056940750.1|682463_683114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099202255.1|683259_684540_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	2.2e-42
WP_012845668.1|684695_685898_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_056940649.1|686161_686770_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_056940648.1|686766_687537_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_056940647.1|687536_688166_-	YutD family protein	NA	NA	NA	NA	NA
WP_056940646.1|688166_689543_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013437260.1|689557_689878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940645.1|689971_691342_+	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	27.1	1.2e-09
WP_056940650.1|691396_692398_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_056940644.1|692543_693650_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_056940643.1|693699_694074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940642.1|694091_694517_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_056940753.1|694671_696021_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_056940718.1|696185_697031_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_082589059.1|697422_697953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940720.1|698062_698683_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	32.6	2.0e-12
WP_056940721.1|698682_699489_-	glutamate racemase	NA	NA	NA	NA	NA
WP_056940723.1|699579_699987_+	YslB family protein	NA	NA	NA	NA	NA
WP_056940722.1|700068_700440_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_025015408.1|700903_702136_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	2.5e-75
>prophage 5
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	841045	914865	2172769	tRNA,transposase,protease	Chrysochromulina_ericina_virus(11.76%)	59	NA	NA
WP_056939888.1|841045_843214_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	47.6	6.7e-108
WP_082589012.1|843308_844580_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	26.2	3.9e-15
WP_056939889.1|844593_844956_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013437115.1|844955_845330_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_011254102.1|845404_845647_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_056939890.1|845662_849157_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_056939891.1|849158_849716_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_056939892.1|849849_850821_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_056939893.1|850990_851698_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_056939894.1|851771_852902_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	9.4e-29
WP_056939895.1|852904_853261_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_056939896.1|853342_854836_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	38.8	1.8e-67
WP_056939897.1|854849_856217_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_013437106.1|856342_856588_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_056939898.1|856698_858324_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_056939899.1|858441_859272_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_056939900.1|860997_862233_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	54.5	5.3e-102
WP_099202270.1|862862_864038_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_056940759.1|864212_864728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099202274.1|865067_866117_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.5	7.6e-49
WP_056940402.1|866287_866521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940401.1|870121_870880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940400.1|871081_872632_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.5	2.8e-23
WP_056940399.1|873720_874323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940398.1|874554_875133_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_056940397.1|875140_876424_+	purine permease	NA	NA	NA	NA	NA
WP_013437089.1|877142_877967_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_056940396.1|878027_879452_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_056940395.1|879594_880890_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_056940394.1|881019_882639_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.1	1.0e-137
WP_056940393.1|882764_883319_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_056940392.1|883365_883767_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_056940391.1|883881_885246_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.1	3.6e-27
WP_013437082.1|885274_885538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940390.1|885579_886491_-	ROK family protein	NA	NA	NA	NA	NA
WP_056940389.1|886568_887906_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_056940388.1|888101_888824_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056940387.1|888963_890391_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_056940444.1|891687_892662_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.5	3.6e-45
WP_056940445.1|892902_894603_-	cell division protein	NA	NA	NA	NA	NA
WP_056940446.1|894733_895543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013437076.1|895697_897083_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	34.6	8.8e-29
WP_056940447.1|897130_897961_-	pur operon repressor	NA	NA	NA	NA	NA
WP_056940448.1|898067_898325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940449.1|898386_899271_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_056940450.1|899260_899827_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_046432969.1|899813_900581_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_056940451.1|900580_902557_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.1	1.6e-100
WP_056940452.1|902652_905316_-	magnesium-translocating P-type ATPase	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	24.3	4.9e-36
WP_056940453.1|905609_906227_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_013641434.1|906207_906687_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	60.7	1.8e-37
WP_056940454.1|906708_907731_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_056940455.1|907833_908433_+	DUF159 family protein	NA	NA	NA	NA	NA
WP_056940456.1|908604_909267_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_056940457.1|909398_909779_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_013437062.1|910013_910439_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_099202220.1|910587_911637_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.5	7.6e-49
WP_056940752.1|911774_913091_+	aminopeptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	26.7	6.2e-40
WP_099202276.1|913533_914865_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	38.7	5.2e-63
>prophage 6
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	1051168	1122444	2172769	transposase	Lactobacillus_phage(40.0%)	50	NA	NA
WP_168170605.1|1051168_1051900_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013436928.1|1052858_1053770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940606.1|1053855_1054794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628386.1|1054814_1055138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014565477.1|1055441_1055795_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	35.8	1.1e-12
WP_056940605.1|1055791_1056214_+	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	35.9	1.1e-19
WP_082589048.1|1056290_1056962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940604.1|1057116_1058358_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	55.2	1.3e-116
WP_056940603.1|1058513_1059272_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_056940602.1|1059955_1060792_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_056940601.1|1060809_1061766_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_056940600.1|1061779_1062727_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_056940599.1|1062723_1063593_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_082589071.1|1065265_1065472_+	steroid-binding protein	NA	NA	NA	NA	NA
WP_056940742.1|1065551_1067411_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	64.1	5.2e-226
WP_056940743.1|1067531_1068455_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	40.7	7.6e-61
WP_056940293.1|1080662_1081076_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	46.5	3.8e-12
WP_056940294.1|1081140_1082364_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_056940295.1|1082484_1083585_+	serine hydrolase	NA	NA	NA	NA	NA
WP_056940296.1|1083622_1086448_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	26.1	4.3e-22
WP_056940297.1|1087615_1088443_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.9	7.4e-100
WP_052543307.1|1089067_1090081_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.9	4.6e-51
WP_056940298.1|1090140_1090746_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	38.4	1.0e-29
WP_056940299.1|1091902_1092721_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_056940300.1|1092839_1094765_-	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1S5SF82	Streptococcus_phage	30.4	4.3e-66
WP_056940301.1|1094828_1095536_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_056940302.1|1095899_1096892_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_056940303.1|1096888_1097788_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_056940304.1|1097784_1098546_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	8.3e-13
WP_056940305.1|1098790_1099147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006351301.1|1099234_1100569_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_013436886.1|1100773_1100956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940306.1|1100996_1101569_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_056940307.1|1101565_1102603_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_056940308.1|1102861_1105096_+	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A1D8EUG2	Mycobacterium_phage	31.5	3.1e-84
WP_056940309.1|1105113_1105512_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_056940310.1|1105515_1106040_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_025015541.1|1106039_1106603_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_056940311.1|1106621_1107419_-	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_056940312.1|1107512_1108883_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_056940313.1|1109072_1110473_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_099202288.1|1111266_1112598_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	38.0	1.5e-62
WP_056940726.1|1113623_1114226_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_056940725.1|1114417_1115242_+	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046434019.1|1115297_1115498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046434020.1|1115455_1115674_-	DUF3923 family protein	NA	NA	NA	NA	NA
WP_056940724.1|1115880_1117140_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.0	8.5e-47
WP_007125833.1|1119013_1119853_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_099202290.1|1119949_1120807_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_099202292.1|1121073_1122444_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	1125534	1179170	2172769	tRNA,transposase,integrase	Bacillus_virus(30.0%)	48	1125437:1125496	1134996:1135963
1125437:1125496	attL	TACGCGTGGTGCTAGTTAAATCGTTTTAGTTAATAAAAAAGTCCAATTAGACTAGACTCA	NA	NA	NA	NA
WP_056940763.1|1125534_1126392_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_007127152.1|1126509_1127343_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157771647.1|1127455_1128283_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_056940691.1|1128383_1129289_-	hypothetical protein	NA	A0A1D8EX18	Mycobacterium_phage	39.4	1.1e-51
WP_056940690.1|1129288_1130347_-	DNA methylase	NA	A0A1D8EX39	Mycobacterium_phage	61.2	2.0e-126
WP_056940689.1|1130379_1131609_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_056940688.1|1131654_1131834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940687.1|1131835_1132219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624854.1|1132218_1133040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624855.1|1133126_1133921_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_056940763.1|1134099_1134957_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_056940629.1|1135452_1135893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940630.1|1136075_1136792_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1134996:1135963	attR	TGAGTCTAGTCTAATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGTAGTAATGTAAATACCCTCTGAAGTTTCTTCATAGATGATCTTGACGCCATATTCAACTTTTTTTTCATTGAAAATGGTAGTTTCTTTTTTCTCTACATAATCTATAAGTTGCTCAGAATGGACAATACTCATCAATCTCTTATAGATTTTATAGTCAATAACATGTAATTTAATCCATTTCCAAGCTGGATACCCTAGAGGTATAATATTTAATAAAAGTGGATATACAAGAGCAGTATAATTACCACTGCTCAACAAGTGCGGTGCGACCTTATATTCAACGCCAATTGATAATGCTAAGGTTGACATCGTTACCATTTTTAAACTGTTAGGATTTCCTAGCGGTTTTTTTGTGTCTAAGACTAATTTCTTAGTTTTCATATATAAGCACCTCAATTCTATAAGTTCATAGCCTCTTGAGGACTCACTTCTAATACTCGCATACCTGAAGCTGATAGTCCTTCATTACCATTGAAATTCCAATGGCTAAGATCATCGAATGCTACTACCTTATTCTTCTCTAACCCTAAGAGAAGTTTTTTATTCTCTTCATCAGCAATTACACTCTCACTACCTTTAATTTTCACCGTTAACACAGTTCCAATTGGTAATCTTGTATTAGAACTAATAACTCGAACCTCATATACAGCGCGTGGAATAGTTTTAGTTTCATCAGTAGAATCTTGAACCTCTTCCGTCGTTCCACTTAATAGTAGGAAACATTTACCAATTGCTTCCACCAATGGTCGAGTTAAAGCAGACTGAATTGGAGTCCTCTTACTGTTGCTTTCATTGAAGGTAGAAAGCAATTCACCTTGTTTGGTTACATTATTAGACATTGTTAATGTCCTCTCTTTCTTTTTACGTTCCAAATATGGTTATTCATGTATTGATGTACCACTTTTGGAT	NA	NA	NA	NA
WP_056940631.1|1136971_1138333_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_007125838.1|1138536_1139343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940632.1|1139783_1140485_+	methyltransferase	NA	G3MA03	Bacillus_virus	44.2	9.3e-19
WP_056940633.1|1140545_1141778_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_056940758.1|1144498_1145086_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	33.9	7.0e-20
WP_099202294.1|1145347_1148263_-	starch-binding protein	NA	NA	NA	NA	NA
WP_003681033.1|1148546_1148846_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082589030.1|1148803_1149160_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010620892.1|1149211_1149397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660204.1|1149443_1149725_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_168170601.1|1149950_1150781_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_056940277.1|1150829_1151021_-	CsbD family protein	NA	NA	NA	NA	NA
WP_056940278.1|1151166_1152045_-	ROK family protein	NA	NA	NA	NA	NA
WP_056940279.1|1152163_1153093_-	DegV family protein	NA	NA	NA	NA	NA
WP_056940280.1|1153196_1154144_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_056940281.1|1154369_1155764_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.1	4.9e-120
WP_056940282.1|1155793_1156249_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_056940283.1|1156263_1158285_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003549366.1|1158453_1158690_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_013436847.1|1158718_1159240_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	50.3	1.0e-38
WP_005723612.1|1159285_1159582_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_056940284.1|1159800_1162266_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.1	3.0e-112
WP_056940285.1|1162276_1164241_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.5	3.2e-141
WP_056940286.1|1164241_1165369_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_056940287.1|1165368_1165593_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_056940288.1|1165823_1166954_-	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	28.6	3.4e-31
WP_056940289.1|1167130_1168498_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003549412.1|1168975_1169116_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_013438816.1|1169167_1169536_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_013438815.1|1169516_1170413_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_013438814.1|1170522_1171908_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_056940290.1|1171916_1173815_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_056940291.1|1174190_1175999_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_056940292.1|1176227_1177631_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	29.2	1.6e-38
WP_005721666.1|1177799_1179170_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	1281592	1386435	2172769	transposase,bacteriocin	Bacillus_phage(14.29%)	107	NA	NA
WP_099202305.1|1281592_1282963_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_056940729.1|1283121_1284369_-	MFS transporter	NA	NA	NA	NA	NA
WP_056940730.1|1284555_1285524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168170602.1|1285881_1286145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940753.1|1287312_1288662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_056940628.1|1288817_1289180_-	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	68.6	2.3e-21
WP_056940627.1|1289380_1291915_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.9	2.2e-70
WP_082589052.1|1292058_1293312_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.7	1.2e-120
WP_056940625.1|1293439_1294933_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.3	6.9e-72
WP_056940623.1|1296543_1297752_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_005727342.1|1297885_1298743_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_056940170.1|1298868_1299663_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_056940171.1|1299695_1300334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940172.1|1300386_1301148_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_056940173.1|1301144_1301888_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_056940174.1|1302026_1302626_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_056940175.1|1302738_1303266_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056940176.1|1303266_1304328_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013438693.1|1304329_1305004_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	5.4e-32
WP_056940177.1|1305044_1306457_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_056940178.1|1306552_1306795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940179.1|1306898_1307522_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056940180.1|1307671_1308211_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.5	1.4e-27
WP_056940181.1|1308224_1308773_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	42.8	1.4e-30
WP_056940182.1|1308869_1309661_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_056940183.1|1309666_1310596_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_056940184.1|1310642_1311179_-	CvpA family protein	NA	NA	NA	NA	NA
WP_056940185.1|1311339_1312062_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_056940186.1|1312078_1312915_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	34.2	1.6e-17
WP_056940201.1|1312929_1313709_+	ParA family protein	NA	Q8JL10	Natrialba_phage	31.5	5.1e-26
WP_056940187.1|1313686_1314571_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.8	6.4e-17
WP_056940188.1|1314563_1314827_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_013438679.1|1314884_1315985_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_056940189.1|1315993_1316770_+	DUF1129 family protein	NA	NA	NA	NA	NA
WP_056940190.1|1316888_1318613_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	3.4e-38
WP_056940202.1|1318622_1320482_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	3.1e-45
WP_013438675.1|1320663_1321350_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.2	1.3e-36
WP_056940191.1|1321353_1322508_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.4	5.2e-27
WP_056940192.1|1322556_1324128_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_013438672.1|1324139_1324889_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_013438671.1|1324961_1325252_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_056940193.1|1325436_1325622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940194.1|1325633_1325843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940195.1|1326124_1327354_+	lactate oxidase	NA	NA	NA	NA	NA
WP_022087570.1|1327752_1327977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566198.1|1328069_1328261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940197.1|1328376_1330683_+	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
WP_056940198.1|1330874_1332272_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_056940199.1|1332508_1333837_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_056940200.1|1333829_1334630_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_082589068.1|1336136_1336226_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_082589067.1|1336340_1336514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099202218.1|1338589_1339639_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.5	5.8e-49
WP_056940559.1|1340321_1340918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940558.1|1341078_1342386_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_056940557.1|1342386_1342587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642488.1|1343342_1343633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721006.1|1343650_1343845_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005721007.1|1343914_1344130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940556.1|1344483_1345023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003549779.1|1345037_1345247_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013642485.1|1345379_1345574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642484.1|1345600_1346023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642483.1|1346282_1346522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013642482.1|1346558_1347455_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	30.5	3.3e-05
WP_056940555.1|1347447_1348662_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_056940554.1|1348969_1349725_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_056940553.1|1349726_1350641_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_056940552.1|1350666_1352670_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_056940756.1|1352796_1353846_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.2	1.2e-49
WP_056940701.1|1354069_1354483_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_056940702.1|1354479_1354923_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013438654.1|1355064_1355343_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056940703.1|1355583_1356474_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_056940704.1|1356508_1357156_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.1	3.0e-16
WP_013642476.1|1357155_1357950_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_056940705.1|1358050_1358344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940706.1|1358345_1358750_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_099202278.1|1358746_1359211_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.9	1.1e-31
WP_099202315.1|1359310_1360642_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	38.7	8.1e-64
WP_082589064.1|1360824_1360989_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_157771648.1|1361018_1361087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940737.1|1361873_1363388_+	L-lactate permease	NA	NA	NA	NA	NA
WP_162252734.1|1363493_1363799_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_082589062.1|1364001_1364460_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_069168716.1|1364667_1365891_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.7	1.3e-97
WP_056940473.1|1366161_1367958_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_056940474.1|1368119_1369352_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056940475.1|1369417_1370107_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_056940476.1|1370081_1370660_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013438639.1|1370785_1371160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940477.1|1371168_1372710_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.6e-45
WP_056940478.1|1372720_1373491_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_056940479.1|1373494_1373980_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_056940480.1|1374175_1374889_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_013642464.1|1374982_1375528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940481.1|1375998_1376619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940482.1|1376664_1378170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438631.1|1378263_1378566_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_056940483.1|1378662_1379211_+	AAA family ATPase	NA	A0A2R2ZGN1	Clostridioides_phage	32.7	2.3e-09
WP_056940484.1|1379393_1379948_+	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	37.2	3.4e-16
WP_056940485.1|1380216_1380984_+	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	40.0	6.8e-15
WP_056940486.1|1381156_1382032_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	48.4	2.3e-19
WP_056940487.1|1382144_1383146_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_056940488.1|1383152_1384427_-	GTPase HflX	NA	NA	NA	NA	NA
WP_099202376.1|1384679_1385300_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	54.9	7.3e-60
WP_099202317.1|1385274_1386435_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFS0	Lactobacillus_virus	44.2	2.8e-81
>prophage 9
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	1400759	1456645	2172769	transposase	unidentified_phage(30.0%)	46	NA	NA
WP_005725993.1|1400759_1400990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_056938247.1|1400904_1402272_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.4	1.3e-40
WP_056940429.1|1402691_1406006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099202321.1|1406250_1407426_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_099202325.1|1407418_1408024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940733.1|1408202_1409102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940735.1|1409487_1409880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082589061.1|1410075_1411563_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	27.4	3.2e-29
WP_056940756.1|1411634_1412684_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.2	1.2e-49
WP_056940275.1|1413053_1413911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940274.1|1414215_1415388_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_056940273.1|1415661_1417197_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_056940272.1|1417328_1418366_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	47.1	2.6e-86
WP_056940271.1|1418370_1419255_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.9	2.7e-92
WP_056940270.1|1419277_1419886_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.3	1.9e-44
WP_056940269.1|1419906_1420893_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	37.8	1.4e-28
WP_056940268.1|1421056_1423024_+	AbiA family abortive infection protein	NA	NA	NA	NA	NA
WP_056940267.1|1423057_1423504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940266.1|1423565_1423889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168170603.1|1424051_1424213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940265.1|1425582_1426266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940264.1|1426284_1427334_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	6.8e-50
WP_056940263.1|1427662_1429510_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_082589029.1|1430698_1431028_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_056940261.1|1431411_1432653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940260.1|1432743_1435290_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_056940259.1|1435425_1436559_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_056940258.1|1436574_1437000_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_056940257.1|1437025_1437517_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_056940256.1|1437539_1438355_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_056940255.1|1438351_1439200_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_056940254.1|1439222_1440011_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_056940253.1|1440720_1441275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940251.1|1442218_1443535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940250.1|1443879_1444077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940249.1|1444240_1445047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099202220.1|1445232_1446282_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.5	7.6e-49
WP_056939861.1|1446320_1447556_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_168170604.1|1447593_1449219_+	DUF853 family protein	NA	NA	NA	NA	NA
WP_056939858.1|1449993_1450494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056939857.1|1451017_1451275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162252724.1|1451317_1451842_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_056939864.1|1452176_1453028_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_056939855.1|1453027_1454908_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_056939854.1|1454920_1456405_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.2	8.0e-28
WP_099202378.1|1456492_1456645_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	1471894	1549318	2172769	tRNA,transposase,protease	Streptococcus_phage(23.08%)	60	NA	NA
WP_056939846.1|1471894_1472581_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_056939845.1|1472735_1475042_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_056939863.1|1475472_1476120_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_056939844.1|1476134_1476755_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.7	8.7e-29
WP_056939843.1|1476758_1477577_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013438557.1|1477579_1478032_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013438556.1|1478028_1478589_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_056939842.1|1478635_1479550_+	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_056939841.1|1479687_1480263_+	elongation factor P	NA	NA	NA	NA	NA
WP_056939840.1|1480311_1480899_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_056939839.1|1481003_1481372_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_056939838.1|1481688_1483326_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_052543180.1|1483425_1483881_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056939837.1|1483880_1484396_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_056939836.1|1484450_1485089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056939835.1|1485768_1487106_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	1.0e-21
WP_056939834.1|1487107_1487809_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_056939833.1|1487860_1488778_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_056939832.1|1488899_1490504_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.3	3.5e-21
WP_056939831.1|1491437_1491782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082589008.1|1491843_1493766_-	cell surface protein	NA	NA	NA	NA	NA
WP_013438538.1|1494043_1494781_+	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	82.9	5.7e-120
WP_056939830.1|1494987_1497858_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_013438534.1|1498413_1499214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013438533.1|1499221_1500178_+	DNA polymerase III subunit epsilon	NA	A0A0N9SJX9	Paenibacillus_phage	31.3	2.8e-10
WP_013438532.1|1500187_1501048_+	DNA nuclease	NA	NA	NA	NA	NA
WP_014566113.1|1501085_1502513_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_056939829.1|1502794_1503880_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.7e-27
WP_013438529.1|1503879_1504746_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013438528.1|1504749_1505574_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_056939828.1|1505557_1506853_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_056939827.1|1506907_1508212_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_056939826.1|1508315_1509233_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_056939825.1|1509248_1510196_+	serine hydrolase	NA	NA	NA	NA	NA
WP_056939824.1|1510316_1510892_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056939823.1|1510896_1514532_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_099202329.1|1514773_1515997_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.5	3.0e-97
WP_056940748.1|1516305_1517337_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_056940749.1|1519039_1519237_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005727342.1|1519280_1520138_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_056940694.1|1520470_1521763_+	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_056940695.1|1521816_1523199_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_056940696.1|1523359_1523863_+	nucleoside 2-deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	26.7	1.9e-10
WP_056940697.1|1523899_1524757_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056940698.1|1524759_1525554_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014566907.1|1525701_1526559_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_056940746.1|1526697_1527306_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	39.6	5.7e-33
WP_056940745.1|1527305_1527857_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_056940744.1|1528081_1529389_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	2.1e-93
WP_069168716.1|1529618_1530842_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.7	1.3e-97
WP_013436902.1|1533278_1533464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940591.1|1536979_1537990_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_056940592.1|1538008_1538821_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_056940593.1|1538849_1539770_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_056940594.1|1539773_1540142_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_056940595.1|1541173_1541692_+	acetyltransferase	NA	NA	NA	NA	NA
WP_056940596.1|1541719_1543093_-	amino acid permease	NA	NA	NA	NA	NA
WP_056940597.1|1543403_1546031_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_056940598.1|1546232_1548044_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I1B8	Acanthocystis_turfacea_Chlorella_virus	35.0	6.2e-83
WP_099202220.1|1548268_1549318_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.5	7.6e-49
>prophage 11
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	1566731	1612881	2172769	transposase	Bacillus_phage(14.29%)	36	NA	NA
WP_099202331.1|1566731_1567766_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.2	1.7e-53
WP_056940470.1|1567996_1571590_+	type I pullulanase	NA	NA	NA	NA	NA
WP_081036442.1|1572470_1573778_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.0	1.2e-43
WP_162252730.1|1573924_1574074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940469.1|1574388_1574595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940468.1|1574710_1575106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940467.1|1575135_1576065_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.8	7.6e-77
WP_056940466.1|1576080_1576953_+	serine/threonine protein phosphatase	NA	A0A0E3T919	Enterococcus_phage	25.9	5.9e-15
WP_056940465.1|1577366_1578701_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_056940464.1|1578700_1579600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940471.1|1579973_1580648_+	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	59.1	1.6e-15
WP_056940463.1|1580787_1581858_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_056940462.1|1581935_1582511_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	36.4	1.2e-19
WP_082589039.1|1582517_1583108_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_056940460.1|1583175_1583835_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_056940459.1|1583887_1584571_+	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	33.3	7.4e-13
WP_056940458.1|1585261_1585804_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099202202.1|1585966_1587349_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.1	1.4e-58
WP_156399038.1|1587354_1587552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940562.1|1587681_1588941_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_056940566.1|1588989_1591209_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_056940563.1|1591316_1592279_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_162252732.1|1592272_1592758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940565.1|1593151_1595839_+	magnesium-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	25.7	6.9e-46
WP_056940567.1|1599616_1599877_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_099202230.1|1600162_1601524_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_056940615.1|1603080_1604577_+	SlpX protein	NA	NA	NA	NA	NA
WP_056940616.1|1604709_1605072_-	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	30.0	6.7e-05
WP_013437337.1|1606737_1607136_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_013641596.1|1607276_1607726_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_056940617.1|1608181_1609297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013437341.1|1609391_1610093_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056940618.1|1610099_1610501_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	54.4	1.1e-29
WP_013437345.1|1610555_1610942_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.0	1.9e-18
WP_099202335.1|1611125_1612286_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFS0	Lactobacillus_virus	44.2	2.2e-81
WP_056940766.1|1612260_1612881_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	54.9	7.3e-60
>prophage 12
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	1793458	1836115	2172769	tRNA,transposase	Bacillus_phage(33.33%)	41	NA	NA
WP_099202202.1|1793458_1794841_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.1	1.4e-58
WP_099202342.1|1794874_1796158_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	2.2e-42
WP_056940536.1|1796616_1797138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940535.1|1797149_1798025_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013641676.1|1798092_1798791_+	uracil-DNA glycosylase	NA	V5NWU7	Chelonid_alphaherpesvirus	41.4	2.5e-40
WP_056940534.1|1798804_1799794_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_056940533.1|1799793_1800273_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_082589044.1|1800341_1800914_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_056940531.1|1800962_1801196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940530.1|1801350_1801884_-	3'-5' exonuclease	NA	M1PFD8	Streptococcus_phage	35.9	3.7e-20
WP_056940529.1|1801981_1802878_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_056940528.1|1802939_1804037_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.6	7.7e-36
WP_056940527.1|1804026_1804839_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	28.3	2.3e-13
WP_056940526.1|1804835_1805651_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013437520.1|1805647_1806721_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_056940525.1|1806759_1807602_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_056940524.1|1807598_1808558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940523.1|1808586_1809942_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_013437524.1|1810040_1810856_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_056940522.1|1810873_1811680_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_056940521.1|1811700_1812423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641689.1|1812419_1812881_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_099202202.1|1812914_1814297_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.1	1.4e-58
WP_056940693.1|1814358_1815492_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.9	6.0e-44
WP_056940692.1|1818548_1820024_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_099202344.1|1820087_1821263_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_056940710.1|1821544_1822492_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_056940709.1|1822548_1824174_-	APC family permease	NA	NA	NA	NA	NA
WP_056940708.1|1824553_1824727_+	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_056940707.1|1824857_1825379_+	VanZ family protein	NA	NA	NA	NA	NA
WP_025014446.1|1825463_1826192_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_099202253.1|1826354_1827716_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_056940679.1|1828048_1829023_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_056940678.1|1828991_1829993_+	type II secretion system protein F	NA	NA	NA	NA	NA
WP_056940677.1|1830003_1830348_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_056940676.1|1830328_1830748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013641698.1|1830768_1831014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940680.1|1831003_1831528_+	competence protein ComGF	NA	NA	NA	NA	NA
WP_056940675.1|1831701_1832703_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_056940674.1|1832748_1833933_+	acetate kinase	NA	NA	NA	NA	NA
WP_099202202.1|1834732_1836115_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.1	1.4e-58
>prophage 13
NZ_CP017706	Lactobacillus amylovorus DSM 20531 chromosome, complete genome	2172769	2075374	2132181	2172769	tRNA,transposase,integrase,protease	Mycobacterium_phage(16.67%)	55	2065841:2065857	2098558:2098574
2065841:2065857	attL	AAATTAAAAAGAATAAG	NA	NA	NA	NA
WP_056939377.1|2075374_2076691_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_056939378.1|2076690_2077599_+	tyrosine recombinase XerC	NA	A0A142K830	Mycobacterium_phage	30.6	4.4e-13
WP_056939379.1|2077608_2078133_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_056939380.1|2078144_2079542_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	25.2	1.2e-28
WP_056939381.1|2079681_2080578_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_056939382.1|2081943_2082801_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_056939383.1|2082843_2083653_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_056939384.1|2083857_2084247_+	CrcB family protein	NA	NA	NA	NA	NA
WP_056939385.1|2084248_2084626_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_056939386.1|2084667_2086068_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_056939387.1|2086246_2086735_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_082588990.1|2087017_2087497_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_162252720.1|2087478_2087646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162252721.1|2087606_2088098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056939389.1|2089057_2089360_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_056939390.1|2089429_2090902_-	APC family permease	NA	NA	NA	NA	NA
WP_056939391.1|2093252_2094515_+	aluminum resistance protein	NA	NA	NA	NA	NA
WP_056939392.1|2094634_2095306_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_056939393.1|2095298_2096639_-	ATP synthase subunit J	NA	NA	NA	NA	NA
WP_056939394.1|2096750_2098517_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	41.3	2.1e-80
WP_056939395.1|2098608_2099061_+	transcriptional regulator	NA	NA	NA	NA	NA
2098558:2098574	attR	CTTATTCTTTTTAATTT	NA	NA	NA	NA
WP_056939396.1|2099202_2100198_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_056939397.1|2100417_2101050_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_056939398.1|2101262_2102381_+	serine hydrolase	NA	NA	NA	NA	NA
WP_056939399.1|2102460_2103282_+	pyridoxal kinase	NA	NA	NA	NA	NA
WP_013437815.1|2103291_2103849_+	membrane protein	NA	NA	NA	NA	NA
WP_056939400.1|2103924_2105130_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_022087145.1|2105426_2105576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156399021.1|2105569_2105920_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013436867.1|2105979_2106216_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013436866.1|2106160_2107534_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	27.7	2.6e-41
WP_056939402.1|2107634_2107988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056939403.1|2108101_2108692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056939404.1|2108784_2110719_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_056939405.1|2110901_2111627_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_056939406.1|2111642_2113304_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_056939407.1|2113486_2114932_+	amino acid permease	NA	NA	NA	NA	NA
WP_056939408.1|2115168_2115639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013437823.1|2115689_2116133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056939409.1|2116181_2117294_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_056939410.1|2117361_2118222_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_162252717.1|2118241_2118745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162252718.1|2119085_2119289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627907.1|2119913_2120072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082589075.1|2122190_2122841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099202228.1|2122983_2123841_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_157771642.1|2123976_2124252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940635.1|2124256_2124490_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_013437829.1|2124554_2125487_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_056940636.1|2126323_2126854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940637.1|2126947_2127997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940638.1|2127998_2128574_+	AAA family ATPase	NA	C1KFF1	Lactobacillus_virus	22.4	6.4e-10
WP_056940639.1|2128607_2129252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056940640.1|2129220_2130705_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_056940641.1|2131002_2132181_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.3	9.7e-37
