The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	1058561	1092466	3674745	transposase,protease,integrase	Enterobacteria_phage(33.33%)	28	1085063:1085076	1094014:1094027
WP_008878794.1|1058561_1059113_+|protease	spore protease YyaC	protease	NA	NA	NA	NA
WP_008878795.1|1059159_1060881_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_008878796.1|1060880_1061144_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_081157281.1|1061255_1063271_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_008878798.1|1063510_1064368_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_008878799.1|1064526_1065348_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	29.6	5.2e-05
WP_171355325.1|1065523_1066150_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_081157282.1|1066207_1067485_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.8	5.4e-17
WP_008878803.1|1067540_1067786_-	YueH family protein	NA	NA	NA	NA	NA
WP_035499108.1|1067853_1068603_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_060475710.1|1068871_1069516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008878806.1|1069686_1069881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008878807.1|1070074_1070662_+	cell wall hydrolase	NA	A0A0E3XAL9	Bacillus_phage	48.1	8.2e-45
WP_087959914.1|1070873_1071299_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008881762.1|1071390_1071771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099232911.1|1074457_1075711_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.4e-09
WP_011230382.1|1075703_1076504_+	ExeA family protein	NA	NA	NA	NA	NA
WP_008881771.1|1078414_1078765_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_081157650.1|1079208_1079973_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.9	5.5e-49
WP_081157651.1|1079969_1081538_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_009361858.1|1082684_1083440_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.7	9.2e-57
WP_015375695.1|1083851_1084985_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
1085063:1085076	attL	ATTCTCCTTTTAAA	NA	NA	NA	NA
WP_015864897.1|1085296_1085461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015864898.1|1085575_1085986_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_015864899.1|1085982_1086441_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052510034.1|1089458_1089830_-	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_042409697.1|1089984_1090365_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_042409700.1|1090357_1092466_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1094014:1094027	attR	TTTAAAAGGAGAAT	NA	NA	NA	NA
>prophage 2
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	1166611	1176443	3674745		Bacillus_phage(66.67%)	7	NA	NA
WP_008878886.1|1166611_1167646_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	61.4	1.3e-122
WP_099232927.1|1167751_1170034_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	68.6	2.8e-306
WP_081157187.1|1170547_1171558_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	1.4e-20
WP_008878889.1|1171559_1172351_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008878890.1|1172581_1173256_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	64.4	3.8e-78
WP_099232929.1|1173252_1174317_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	50.6	2.6e-89
WP_011886997.1|1174535_1176443_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	31.0	4.6e-36
>prophage 3
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	1188627	1205946	3674745	transposase	Burkholderia_phage(25.0%)	11	NA	NA
WP_172437878.1|1188627_1190295_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_087959898.1|1190872_1191214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087959896.1|1191974_1192943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099232940.1|1193313_1194542_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087959846.1|1195106_1196384_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021292746.1|1196645_1197815_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	26.3	3.3e-21
WP_025950780.1|1197964_1198342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087959893.1|1199104_1200307_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.6	6.0e-50
WP_009361858.1|1200303_1201059_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.7	9.2e-57
WP_087959892.1|1203899_1204700_-	ExeA family protein	NA	NA	NA	NA	NA
WP_099232911.1|1204692_1205946_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.4e-09
>prophage 4
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	1549601	1588479	3674745	transposase	Aeribacillus_phage(33.33%)	29	NA	NA
WP_099233567.1|1549601_1550829_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011886784.1|1551022_1551811_-	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	28.7	5.2e-18
WP_011886783.1|1552221_1552683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087959816.1|1553079_1554360_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011886780.1|1555570_1555996_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_171355695.1|1556013_1556421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011886778.1|1556472_1556952_-	pre-toxin TG domain-containing protein	NA	NA	NA	NA	NA
WP_099232992.1|1557348_1557849_-	maleate cis-trans isomerase	NA	NA	NA	NA	NA
WP_015374822.1|1558003_1559509_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_042412494.1|1559767_1560325_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_021292743.1|1560465_1561719_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.3	1.1e-09
WP_011230382.1|1561711_1562512_+	ExeA family protein	NA	NA	NA	NA	NA
WP_008881167.1|1564012_1564294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029761977.1|1565461_1565812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008881171.1|1566930_1567278_-	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
WP_060475596.1|1567324_1567807_-	type VII secretion protein EssA	NA	NA	NA	NA	NA
WP_008881173.1|1567796_1570577_-	type VII secretion protein EsaA	NA	NA	NA	NA	NA
WP_099232996.1|1570600_1575040_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.1	3.2e-40
WP_081157540.1|1575076_1576363_-	type VII secretion protein EssB	NA	NA	NA	NA	NA
WP_008881176.1|1576397_1576637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008881177.1|1576867_1577161_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_008881178.1|1577437_1577770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099232998.1|1577785_1579714_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_060475594.1|1579728_1580328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099233569.1|1580979_1581579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099233000.1|1585507_1585945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081157653.1|1585957_1586263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158083266.1|1586489_1587050_-	replication initiation protein	NA	NA	NA	NA	NA
WP_014195313.1|1587948_1588479_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	1696000	1748538	3674745	transposase,protease,holin	Erysipelothrix_phage(14.29%)	39	NA	NA
WP_087960193.1|1696000_1697290_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	34.2	1.1e-52
WP_008881271.1|1697394_1697685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008881273.1|1700039_1700822_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	35.7	9.1e-07
WP_029761504.1|1701613_1702024_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	68.1	1.8e-51
WP_011886727.1|1702260_1703652_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	30.7	1.1e-50
WP_008881301.1|1703926_1705159_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_011886726.1|1705654_1705834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029761506.1|1706028_1707498_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_087959841.1|1708917_1709403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011886722.1|1710012_1710603_-	GrpB family protein	NA	NA	NA	NA	NA
WP_099233036.1|1710722_1711520_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	78.5	2.9e-125
WP_015374614.1|1711529_1712663_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_099233038.1|1713173_1713977_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_099233040.1|1713969_1714530_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_008881400.1|1714522_1714846_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008881404.1|1718164_1718515_-	DUF2200 domain-containing protein	NA	NA	NA	NA	NA
WP_099233042.1|1718915_1719272_-	YxeA family protein	NA	NA	NA	NA	NA
WP_011886719.1|1719296_1721168_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011886718.1|1721142_1721916_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	2.7e-27
WP_011886717.1|1722253_1723639_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_087959836.1|1724307_1725690_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	48.1	2.3e-122
WP_008881410.1|1725764_1726685_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.9	2.3e-25
WP_081157607.1|1726828_1728349_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.7	1.2e-07
WP_008881412.1|1728370_1728907_-	NfeD family protein	NA	NA	NA	NA	NA
WP_060475550.1|1729724_1731443_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_029761619.1|1731753_1733199_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_081157625.1|1733573_1734320_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_008881416.1|1734346_1735420_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_029761618.1|1735423_1736653_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_060475548.1|1736656_1738126_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
WP_171355685.1|1738122_1738410_-	DUF997 family protein	NA	NA	NA	NA	NA
WP_087959814.1|1738814_1739984_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.1	2.5e-24
WP_060475547.1|1740614_1741823_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.9	7.0e-14
WP_008881421.1|1742185_1742848_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	1.2e-31
WP_029761614.1|1742837_1744211_+	GHKL domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.8	2.3e-13
WP_029761613.1|1744380_1744902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029761612.1|1744861_1745515_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_008881425.1|1745688_1746927_+	MFS transporter	NA	NA	NA	NA	NA
WP_033025194.1|1747401_1748538_+|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	2.7e-36
>prophage 6
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	1795665	1804055	3674745		Synechococcus_phage(33.33%)	8	NA	NA
WP_081157373.1|1795665_1796295_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.2	3.0e-24
WP_008881461.1|1796291_1797332_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	47.0	8.5e-69
WP_008881462.1|1797429_1798842_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.9	6.4e-51
WP_008881463.1|1798817_1801046_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.7	1.1e-166
WP_081157372.1|1801029_1801716_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_008881465.1|1801712_1801967_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_029761594.1|1801954_1802683_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	42.4	1.6e-45
WP_008881467.1|1802759_1804055_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.3	1.7e-18
>prophage 7
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	2113614	2123409	3674745		Streptococcus_phage(16.67%)	8	NA	NA
WP_008880808.1|2113614_2114979_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.4	1.8e-122
WP_008880807.1|2115138_2116425_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.4	1.7e-71
WP_008880805.1|2116649_2117363_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.3	1.0e-44
WP_081157359.1|2117369_2119199_+	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	27.5	1.1e-23
WP_008880803.1|2119191_2120520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008880802.1|2120506_2121289_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_008880801.1|2121295_2122090_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	36.9	1.6e-43
WP_035499498.1|2122191_2123409_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.3	3.6e-18
>prophage 8
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	2444751	2502407	3674745	transposase,integrase	Streptococcus_phage(36.36%)	45	2465160:2465175	2505796:2505811
WP_081157651.1|2444751_2446320_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_081157650.1|2446316_2447081_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.9	5.5e-49
WP_099233147.1|2447177_2448416_-	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_031406929.1|2450164_2451400_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	63.0	6.9e-142
WP_099233149.1|2452301_2452910_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_099233151.1|2452909_2453821_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_099233153.1|2454022_2455591_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.2	1.6e-71
WP_099233155.1|2456081_2458157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008880572.1|2458538_2459708_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.2	1.9e-24
WP_011888231.1|2460780_2461983_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099233157.1|2461997_2462666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011888229.1|2462823_2464032_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011888228.1|2464054_2465311_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
2465160:2465175	attL	TCAAGCAGCTGTTTCG	NA	NA	NA	NA
WP_011888227.1|2465335_2465704_-	EamA family transporter	NA	NA	NA	NA	NA
WP_029761369.1|2465690_2466059_-	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
WP_011888225.1|2466074_2466761_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	27.6	8.8e-06
WP_081157677.1|2466930_2468367_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	32.5	5.4e-05
WP_011888224.1|2469223_2471590_+	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_099233158.1|2471603_2472479_+	accessory Sec system S-layer assembly protein	NA	NA	NA	NA	NA
WP_011888222.1|2473026_2474091_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_171355362.1|2474512_2475520_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	29.3	4.7e-24
WP_011888220.1|2475550_2476195_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.1	5.9e-36
WP_008880360.1|2476414_2477599_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008880359.1|2477595_2478273_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011888218.1|2478745_2479591_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.4	8.3e-14
WP_035499366.1|2480362_2481739_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	39.0	2.2e-64
WP_099233162.1|2481735_2482428_+	ComF family protein	NA	NA	NA	NA	NA
WP_099233589.1|2485927_2486224_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_099233591.1|2486282_2486720_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_008880352.1|2486726_2488511_+	flagellar protein	NA	NA	NA	NA	NA
WP_008880351.1|2488595_2489033_+	YaaR family protein	NA	NA	NA	NA	NA
WP_011888210.1|2489065_2489488_+	membrane protein	NA	NA	NA	NA	NA
WP_099233164.1|2489559_2489826_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_008880348.1|2489841_2490309_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_099233166.1|2490320_2491907_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_099233168.1|2491917_2492811_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_099233170.1|2492894_2493449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233172.1|2493471_2493906_+	flagellar assembly protein FliW	NA	NA	NA	NA	NA
WP_099233174.1|2493922_2494171_+	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	58.8	2.0e-08
WP_062679055.1|2494167_2494353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233593.1|2494719_2496114_+	flagellin	NA	NA	NA	NA	NA
WP_099233178.1|2497146_2497437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233180.1|2498108_2498438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233182.1|2500025_2500970_-	endonuclease	NA	NA	NA	NA	NA
WP_087959816.1|2501126_2502407_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2505796:2505811	attR	CGAAACAGCTGCTTGA	NA	NA	NA	NA
>prophage 9
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	2750882	2760097	3674745	holin	Staphylococcus_phage(57.14%)	13	NA	NA
WP_087960383.1|2750882_2751119_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	63.5	3.9e-22
WP_008880964.1|2751316_2751793_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_008880963.1|2751817_2752033_-	YtzI protein	NA	NA	NA	NA	NA
WP_081157198.1|2752127_2752568_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	69.2	8.0e-53
WP_008880961.1|2752710_2753106_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	49.6	1.8e-24
WP_008880960.1|2753359_2753698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029760561.1|2753756_2754224_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	36.8	8.6e-21
WP_008880958.1|2754276_2755086_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_008880957.1|2755072_2755891_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	4.2e-31
WP_029760563.1|2755909_2756914_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008880955.1|2757132_2757921_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	36.9	2.6e-33
WP_008880954.1|2758069_2758312_+	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_008880953.1|2758510_2760097_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.4	7.3e-197
>prophage 10
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	2767624	2831377	3674745	transposase,tRNA,integrase	Staphylococcus_phage(31.25%)	49	2798006:2798065	2829704:2831508
WP_008880943.1|2767624_2770042_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	75.4	0.0e+00
WP_029760579.1|2770105_2770420_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	45.8	3.1e-14
WP_008880941.1|2770661_2770841_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_099233268.1|2770973_2772275_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	59.0	1.8e-28
WP_060476120.1|2772389_2774015_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_008880938.1|2774120_2774321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008880937.1|2774424_2775171_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_008880936.1|2775268_2775490_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078172648.1|2775739_2777152_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_060476119.1|2777234_2778431_+	MFS transporter	NA	NA	NA	NA	NA
WP_011887999.1|2778427_2779006_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_008880932.1|2779017_2779959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233270.1|2780064_2782245_+	type I pullulanase	NA	NA	NA	NA	NA
WP_008880930.1|2782473_2783256_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_008880929.1|2783352_2783622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060476115.1|2783769_2784420_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_008880927.1|2784678_2785530_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_029760589.1|2785524_2785821_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_008880925.1|2785933_2787010_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_008880924.1|2787112_2787643_+	DUF84 family protein	NA	NA	NA	NA	NA
WP_008880923.1|2787689_2788487_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	56.9	1.5e-36
WP_008880922.1|2788508_2789114_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_099233272.1|2789220_2792313_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	50.3	2.6e-89
WP_008880920.1|2792440_2793745_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_008880919.1|2794006_2794456_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_008880918.1|2794442_2794826_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_029760596.1|2794831_2795164_+	bacillithiol system redox-active protein YtxJ	NA	NA	NA	NA	NA
WP_008880916.1|2795407_2796490_+	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase	NA	E3T537	Cafeteria_roenbergensis_virus	28.9	2.5e-15
WP_011887988.1|2796963_2797959_+	catabolite control protein A	NA	NA	NA	NA	NA
2798006:2798065	attL	AGAGGCTGACTCAAAAGGTCGTTAAACCGACCTTTTGGGGACAGCCTCTGTTTCTTTTCT	NA	NA	NA	NA
WP_087959916.1|2798110_2799679_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.2	4.7e-71
WP_087959838.1|2801671_2802839_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.8	1.4e-59
WP_172437890.1|2804275_2804743_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099233276.1|2804891_2805734_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_034839221.1|2805726_2806440_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099233278.1|2807188_2807491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008880914.1|2807744_2808914_-	acetoin utilization protein AcuC	NA	NA	NA	NA	NA
WP_008880913.1|2808910_2809555_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_081157677.1|2809724_2811161_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	32.5	5.4e-05
WP_008880912.1|2811440_2812073_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008880911.1|2812248_2813964_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	74.8	9.3e-214
WP_008880910.1|2814262_2817022_-	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_081157600.1|2817457_2818717_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	41.4	1.5e-83
WP_099233280.1|2819739_2820171_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_099233282.1|2820233_2821280_+|transposase	IS630-like element ISBs2 family transposase	transposase	NA	NA	NA	NA
WP_087960193.1|2822116_2823406_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	34.2	1.1e-52
WP_060476369.1|2823398_2824157_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	45.5	6.6e-55
WP_011230088.1|2825643_2826012_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	78.7	1.8e-50
WP_011230089.1|2826004_2828143_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	84.8	0.0e+00
WP_087959916.1|2829808_2831377_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.2	4.7e-71
2829704:2831508	attR	AGAGGCTGACTCAAAAGGTCGTTAAACCGACCTTTTGGGGACAGCCTCTGTTTCTTTTCTTTACTATTTGGTTATTTATTCCTTTTTTGAAACGAGAATTTCTCCTTATTTCTGAATTTTATCCTGTTTTTTCTTTGTTGGATCGGTTGTGGCCGCCCACTTTCTCAAATTGTGAGCAGCACAAATAAGCCCCCATTCCAAGGTAATTTTTGGGAGCCCTCTTAACAAAAAGCGCTGAAATTGCTGGTTGTGCTTGATTTGCCCAAACACCGGCTCGTTTTCGATTTGTCGTTTTCGGTACGTCGCCGCCCCTTCTTCCGTGGACAGCCGTTTACGGATCTCTTGCCGTTGTTGTTGATTTCTCAAGGAAACGCGGATGGTTTTCGTGTCTTTGCCTTTGGCGCATGTCGCCTGAAACGGGCATCCGGCACAAGCCGTACAACGATACGTCCGTTTGACGGTAACGTACCCGTTGTCGGTCGTTTCCTTCCGTTCATACACAAACACCAACCGTTCCCCTTTGACGCAAATCCACTCATCCAGCTCCTCATCATACGTCATGTTCTCGATTCGGCCGATCTCCTTCGCCCACGCTTTCGTTTGTTCCCGATCCAACGTGTTGTACTTGATCAGGGCGACTATCTCCTTTTTCTCACAGTACGTGTAGTTCTCCTCACTCCCATAGGCGGAATCCGCAATGGCTTGTTTAGGCATTGGACGCCCATAGGCGGCCAATTGCTCCAAATGCGGAATGAAACATCCGGCATCCCCTGCCCGTTGATGCACGCTAAATCCAGTGATGAATTGGTTCTCTGTCCCAATCTGCACATTGTACCCCGGTTTGAGCTGGCCGTTTTTCATATGGTCGTCCTTCATCCGCATAAACGTGGCATCCGGATCCGTTTTCGAAAAACTGTTCCGTTCGCCTAATCTTTCTTTGTATTCTTCATATTTTTTCTTACGGGGGAGAAGATCTTGTTCCAATTGCCGTTTGGCTTTCTTTAACGTACGATTCTTCGGCTCTTTCTTTAGGCGCTCTTCCACTTGTTCGATGACGGCTTCGATCCTTTCGGACGTGATCGGTGAAGCTTCCAGCTTTTCTTGAAAATCCCCCTCTTGTTCCGCCTCTTCATCTTCTTTCGTCACCTGTTCGATCGAGGCAACGATTTTCCGGAATTTCTCCTCCAGTTTCTGATCGTACTTTTCCGTTGATTTGCGCCAAACGAATGTATATCGGTTGGCATTGGCTTCGATTTTCGTTCCATCCAGAAAATAATCCTCTAACTTGACCAGCCCTTCTTGACGCAGAAGATCGACAATGGAGAAAAACGTTTCGTAAATGATGTCCTTCATCCGTTCCGACCGAAATCGGTTGATCGTGCGAAAATCCGGTGTTTGATGGCCGGATAGCCACATAAAGTAAATGTTTTCTTTCAACTGCTTGGCGATTTGGCGAGAGGAGTAGATCCGATTGGCGTAGGCATACAGGATGACTTTCAACATCATTTTCGGATGATAGGCTGGACGCCCTCCGCCAAGATAGAGGGAAACGAACAGAGCCGGATCCATTTTTTCCACTGCCAGATCCACAATCCGGCAAAGATGATGTTTGGGAATGAAAATTTCAAGATCCATTGGCAAAATGAGTTGATCTCGGTTATAATAAATGTACATAAGAAAACCGTCCTTTCTTTGGTAGGGTTGTGGTGACTCTATTATACCAAAAGAGGAACGGTTTTCTTCTTTTTTATCCAAAAAAGTGTCCCAAAAGCGAACGCTATGCGAACACTTTTGGGACATCCTCT	NA	NA	NA	NA
>prophage 11
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	2969749	3027037	3674745	protease,coat,tRNA	Bacillus_virus(20.0%)	54	NA	NA
WP_011887922.1|2969749_2971015_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.7	4.1e-150
WP_008881109.1|2971155_2972832_+|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	32.2	1.8e-12
WP_011887921.1|2973101_2975444_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.0	2.8e-184
WP_008881107.1|2975440_2976028_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_099233306.1|2976101_2976587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011887920.1|2976751_2978119_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_008881104.1|2978129_2978945_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_008881103.1|2978960_2979890_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_008881102.1|2979889_2980660_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011887919.1|2980660_2981635_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_008881100.1|2981650_2982940_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_008881099.1|2983058_2984123_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_008881098.1|2984166_2985198_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_008881097.1|2985194_2985383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008881096.1|2985967_2988610_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.0	5.5e-165
WP_099233308.1|2988740_2990045_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_087960167.1|2990103_2992110_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_087960166.1|2992218_2993796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008881092.1|2993812_2994388_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_008881091.1|2994371_2994983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011887916.1|2995107_2996454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087960165.1|2996823_2998191_+	VanW family protein	NA	NA	NA	NA	NA
WP_099233310.1|2998187_2999852_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_099233312.1|2999864_3000920_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_029760649.1|3000906_3002118_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_171355523.1|3002204_3002687_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011887913.1|3002692_3003439_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_008881083.1|3003464_3004397_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_008881082.1|3004386_3004962_+	fimbrial protein	NA	NA	NA	NA	NA
WP_011887912.1|3004958_3005627_+	pilus assembly protein PilO	NA	NA	NA	NA	NA
WP_029760654.1|3005645_3006080_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_008881079.1|3006196_3007321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881078.1|3007439_3008021_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_171355528.1|3008145_3008817_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_008881075.1|3008974_3009997_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_008881074.1|3010017_3010884_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_011887910.1|3010880_3011399_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_011887909.1|3011448_3012132_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_008881070.1|3012134_3012938_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011887908.1|3013372_3014140_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_029760656.1|3014132_3014993_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_008881067.1|3015238_3015547_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011887906.1|3015550_3015883_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_008881065.1|3015898_3016189_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_099233314.1|3016366_3016927_+	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_011887904.1|3017021_3018323_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_008881062.1|3018340_3018784_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_011887902.1|3018805_3019654_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_011887901.1|3019932_3020481_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_008881059.1|3020468_3021614_-	IscS subfamily cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	9.5e-29
WP_060476083.1|3021718_3023281_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_008881057.1|3023313_3024144_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_011887898.1|3024158_3025262_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_099233317.1|3025420_3027037_+|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
>prophage 12
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	3294879	3305357	3674745		Staphylococcus_phage(50.0%)	12	NA	NA
WP_008879706.1|3294879_3295980_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.8	1.1e-58
WP_011887733.1|3295979_3296624_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.6	1.5e-39
WP_008879704.1|3296647_3297841_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	8.7e-118
WP_011887731.1|3297858_3298323_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.4	8.8e-42
WP_008879702.1|3298443_3298794_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008879701.1|3298849_3299362_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_172437904.1|3299628_3300384_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	26.1	2.5e-09
WP_008879699.1|3300615_3301245_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	9.5e-15
WP_029761016.1|3301291_3301690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051358518.1|3302123_3302378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099233381.1|3302562_3303912_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	45.0	1.8e-39
WP_029761014.1|3304211_3305357_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.6	1.1e-21
>prophage 13
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	3368759	3379465	3674745		Pandoravirus(25.0%)	13	NA	NA
WP_008879623.1|3368759_3369032_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	78.9	3.5e-30
WP_029760976.1|3369165_3369732_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	54.9	4.8e-50
WP_008879621.1|3369744_3369969_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_029760975.1|3370082_3370862_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_029760974.1|3370866_3371571_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_008879618.1|3371587_3372550_+	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	23.6	1.1e-06
WP_008879617.1|3372647_3373097_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.2	7.0e-28
WP_008879616.1|3373175_3373946_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_008879615.1|3374047_3375214_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.2	3.8e-41
WP_011887695.1|3375216_3376317_+	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	28.5	4.8e-22
WP_008879613.1|3376313_3376694_+	chorismate mutase	NA	NA	NA	NA	NA
WP_008879612.1|3376925_3378452_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	37.7	9.0e-35
WP_008879611.1|3378445_3379465_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.2	2.4e-68
>prophage 14
NZ_CP017690	Geobacillus thermodenitrificans strain ID-1 chromosome, complete genome	3674745	3427692	3524115	3674745	transposase,portal,terminase,capsid,integrase,protease,head,tail	Geobacillus_phage(19.57%)	98	3429912:3429928	3528771:3528787
WP_081157677.1|3427692_3429129_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	32.5	5.4e-05
WP_099233415.1|3429419_3430661_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
3429912:3429928	attL	CCGAAAACATGGGATGA	NA	NA	NA	NA
WP_099233417.1|3430742_3431672_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_033014063.1|3431671_3432490_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_099233420.1|3432579_3434769_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_029760954.1|3434826_3435609_-	EcsC family protein	NA	NA	NA	NA	NA
WP_008879557.1|3435766_3436951_+	galactokinase	NA	NA	NA	NA	NA
WP_011887667.1|3436947_3437934_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.5	4.0e-52
WP_099233423.1|3437936_3439463_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_011887665.1|3439519_3440542_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_008879553.1|3440557_3441001_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_008879552.1|3441065_3441356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099233425.1|3447634_3448768_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	51.6	7.3e-106
WP_008881998.1|3448809_3449244_-	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	89.5	1.0e-71
WP_008881997.1|3449265_3449736_-	hypothetical protein	NA	S6C481	Thermus_phage	72.2	1.9e-44
WP_131261719.1|3449944_3450169_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_008881995.1|3450165_3450891_+	phage antirepressor Ant	NA	A0A2P1JTZ2	Anoxybacillus_phage	72.2	2.8e-95
WP_099233617.1|3451086_3451335_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_099233427.1|3451306_3451579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881991.1|3452111_3452306_+	hypothetical protein	NA	A6M980	Geobacillus_virus	73.3	3.2e-22
WP_008881990.1|3452329_3452806_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	72.3	1.8e-53
WP_008881989.1|3452802_3453504_+	ERF family protein	NA	A0A1J0MFT8	Staphylococcus_phage	44.4	3.6e-39
WP_008881988.1|3453500_3453662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008881986.1|3453909_3454731_+	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	69.2	9.1e-42
WP_008881985.1|3454746_3455010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233429.1|3455006_3456254_+	DNA helicase	NA	A0A0U4B0A1	Bacillus_phage	37.3	3.5e-77
WP_008880429.1|3456258_3456687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008880430.1|3456683_3457142_+	HNH endonuclease	NA	A6M989	Geobacillus_virus	59.7	2.6e-38
WP_008880432.1|3457231_3457729_+	single-stranded DNA-binding protein	NA	A6M990	Geobacillus_virus	57.9	9.1e-45
WP_041264900.1|3457807_3458101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013144080.1|3458192_3458375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011888079.1|3458393_3458942_+	dUTP diphosphatase	NA	A0A290GJJ6	Caldibacillus_phage	39.3	4.1e-30
WP_008881975.1|3458955_3459447_+	hypothetical protein	NA	A0A0C5AFC9	Paenibacillus_phage	51.4	1.0e-32
WP_011888077.1|3459459_3459882_+	hypothetical protein	NA	A6M9A1	Geobacillus_virus	62.7	9.1e-46
WP_099233431.1|3459923_3460352_+	transcriptional regulator	NA	E5DV97	Deep-sea_thermophilic_phage	60.0	4.6e-45
WP_099233433.1|3460592_3460955_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	36.3	1.7e-08
WP_099233435.1|3461206_3461662_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	93.3	1.6e-72
WP_099233437.1|3461759_3462695_+	hypothetical protein	NA	A0A1L2JY39	Aeribacillus_phage	26.3	2.8e-18
WP_099233439.1|3462721_3463255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611651.1|3463666_3464712_-|transposase	IS630-like element ISBs2 family transposase	transposase	S5VXX4	Leptospira_phage	27.5	4.7e-27
WP_099233441.1|3465053_3465284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172437894.1|3465404_3466682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233445.1|3466674_3467451_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_099233447.1|3467544_3468210_+	hypothetical protein	NA	A0A2K9V492	Faecalibacterium_phage	37.9	1.5e-23
WP_099233449.1|3468225_3469338_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2K9V409	Faecalibacterium_phage	42.0	2.0e-76
WP_099233619.1|3469352_3469874_+	ParB N-terminal domain-containing protein	NA	A0A2K9V467	Faecalibacterium_phage	68.9	5.0e-62
WP_099233621.1|3469885_3470425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233451.1|3470399_3471794_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	56.3	5.5e-148
WP_081157441.1|3471812_3473261_+|portal	phage portal protein	portal	A0A2L1IVM1	Streptomyces_phage	30.8	7.5e-47
WP_099233453.1|3473253_3474120_+|head	phage head morphogenesis protein	head	NA	NA	NA	NA
WP_099233455.1|3474187_3475591_+	structural protein	NA	Q9HH51	Methanothermobacter_phage	51.9	2.3e-37
WP_099233457.1|3475627_3476545_+|capsid	phage major capsid protein	capsid	V9QJI4	Rhizobium_phage	37.3	2.2e-36
WP_099233459.1|3476559_3476919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233461.1|3476925_3477348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233463.1|3477353_3477779_+	HK97 gp10 family phage protein	NA	D4P800	Rhodococcus_phage	43.1	1.1e-06
WP_099233465.1|3477775_3478219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008880455.1|3478220_3478433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008880456.1|3478444_3479395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008880457.1|3479468_3479897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233623.1|3481157_3482720_+	hypothetical protein	NA	Q0H230	Geobacillus_phage	58.2	2.1e-18
WP_099233467.1|3482716_3483466_+|tail	phage tail family protein	tail	W8EK66	Geobacillus_phage	40.0	6.8e-52
WP_099233469.1|3483481_3484546_+	hypothetical protein	NA	W8EIX3	Geobacillus_phage	37.3	6.9e-50
WP_099233470.1|3484556_3486050_+|tail	phage tail protein	tail	W8EEW0	Geobacillus_phage	51.0	1.3e-139
WP_011888049.1|3486046_3486244_+	hypothetical protein	NA	W8ECV6	Geobacillus_phage	56.5	5.8e-11
WP_011888048.1|3486248_3487046_+	hypothetical protein	NA	W8EBC9	Geobacillus_phage	43.9	5.0e-53
WP_099233472.1|3487042_3489934_+	glycoside hydrolase	NA	W8EK73	Geobacillus_phage	43.7	4.7e-234
WP_081207181.1|3489948_3490299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060476139.1|3490298_3490484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060476138.1|3490502_3490862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008880469.1|3490959_3491466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233474.1|3491549_3492236_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	59.1	5.6e-61
WP_099233476.1|3492333_3492645_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_087959838.1|3492706_3493875_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.8	1.4e-59
WP_099233478.1|3494127_3495096_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_099233480.1|3495129_3496323_-	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	65.1	1.3e-134
WP_099233482.1|3496889_3498125_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	62.2	6.4e-140
WP_060476135.1|3498481_3498700_+	hypothetical protein	NA	Q0H253	Geobacillus_phage	84.3	5.6e-31
WP_008881007.1|3498799_3499462_-	hypothetical protein	NA	D2XR34	Bacillus_phage	58.0	9.7e-18
WP_051358552.1|3500790_3501240_+	hypothetical protein	NA	S6AVV9	Thermus_phage	75.0	4.1e-12
WP_171355773.1|3501193_3501352_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_008880479.1|3502919_3505697_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_008880480.1|3505891_3506821_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_060475996.1|3506822_3507668_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_021292746.1|3508051_3509221_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	26.3	3.3e-21
WP_087959814.1|3509472_3510642_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.1	2.5e-24
WP_081157417.1|3511205_3512321_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_008880483.1|3512317_3513769_+	acyl-CoA reductase	NA	NA	NA	NA	NA
WP_060475995.1|3513783_3514530_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	1.1e-38
WP_008880485.1|3514526_3515282_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008880486.1|3515278_3516310_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008880487.1|3516322_3517093_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_060475993.1|3517272_3517590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233484.1|3517689_3518931_-	aminopeptidase	NA	NA	NA	NA	NA
WP_060475991.1|3519214_3520651_+	sodium/proline symporter	NA	NA	NA	NA	NA
WP_011887644.1|3521118_3521622_+	DoxX family protein	NA	NA	NA	NA	NA
WP_171355512.1|3522353_3522665_+	autorepressor SdpR family transcription factor	NA	NA	NA	NA	NA
WP_008880493.1|3522661_3523318_+	SdpI family protein	NA	NA	NA	NA	NA
WP_008880494.1|3523332_3524115_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
3528771:3528787	attR	CCGAAAACATGGGATGA	NA	NA	NA	NA
>prophage 1
NZ_CP017691	Geobacillus thermodenitrificans strain ID-1 plasmid pLDW-2, complete sequence	91217	6045	63638	91217	integrase,transposase	Bacillus_phage(23.53%)	55	52337:52351	63907:63921
WP_076611651.1|6045_7091_-|transposase	IS630-like element ISBs2 family transposase	transposase	NA	NA	NA	NA
WP_078172677.1|7440_8508_-	thermonuclease family protein	NA	A0A1L2JY19	Aeribacillus_phage	85.3	3.5e-86
WP_060476351.1|8585_9656_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_060476350.1|9740_10889_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.3	6.6e-14
WP_060475948.1|12635_13127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233653.1|13550_13991_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012301104.1|14182_14674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060475949.1|14968_15400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099233655.1|15525_16113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233657.1|16134_17646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042409984.1|17663_18335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042409983.1|18340_19384_-	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_012301109.1|19376_19643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060475952.1|19663_20212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060475953.1|20208_21243_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.6	9.8e-17
WP_011888476.1|21239_23093_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_060475954.1|23109_24156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008881746.1|24168_24393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011888478.1|24513_25149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099233705.1|25549_26152_+	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_041265036.1|26536_27514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060476368.1|27558_28086_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.5	2.7e-07
WP_014195313.1|28085_28616_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042409949.1|29287_29518_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	68.1	3.2e-21
WP_008881738.1|29875_30208_+	hypothetical protein	NA	Q0H251	Geobacillus_phage	38.2	9.8e-11
WP_087960395.1|30221_31379_+	chromosome partitioning protein ParA	NA	Q0H250	Geobacillus_phage	57.2	7.6e-119
WP_099233659.1|31380_32109_+	replication-relaxation family protein	NA	Q0H249	Geobacillus_phage	51.5	1.2e-56
WP_042385872.1|32215_32623_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_042385876.1|32668_33058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099233661.1|33067_34219_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_008881732.1|34668_35214_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	74.1	3.0e-57
WP_099233663.1|35277_35925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042385881.1|35941_36196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042410068.1|36170_36422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099233665.1|36648_38580_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_060476344.1|38598_40734_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012301124.1|40755_42876_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	40.5	7.2e-91
WP_041265042.1|42908_43103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233667.1|43099_44092_+	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
WP_073519239.1|44099_44465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042410091.1|44475_45300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233669.1|45810_46014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099233671.1|46279_46858_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_099233673.1|46922_47651_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_099233675.1|47675_50606_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.8	1.7e-98
WP_099233677.1|50602_51907_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	25.8	2.7e-11
WP_099233679.1|51893_53393_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	43.6	6.2e-113
52337:52351	attL	TACCTTGGCGAATTT	NA	NA	NA	NA
WP_099233681.1|54985_55483_+	GNAT family N-acetyltransferase	NA	A0A1B2IAV9	Erwinia_phage	34.1	1.4e-05
WP_081188680.1|55500_55998_+	GrpB family protein	NA	NA	NA	NA	NA
WP_015863856.1|56087_56813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099233683.1|57451_58684_-	serine/threonine protein kinase	NA	A0A161HRA3	Powai_lake_megavirus	28.6	9.6e-11
WP_099233685.1|59110_60025_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	27.3	1.5e-16
WP_049752141.1|61713_62121_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_099233687.1|62139_62466_-	ATP-dependent helicase	NA	U5PSZ2	Bacillus_phage	42.9	1.4e-06
WP_087960303.1|62504_63638_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
63907:63921	attR	TACCTTGGCGAATTT	NA	NA	NA	NA
