The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	10454	17968	5843140	tRNA,integrase	Hokovirus(16.67%)	6	6397:6410	21670:21683
6397:6410	attL	GCAGGGCGCGTCCG	NA	NA	NA	NA
WP_099507735.1|10454_12005_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	38.8	5.8e-98
WP_099507737.1|12063_13128_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	27.6	6.6e-08
WP_099507739.1|13117_13792_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	43.9	4.0e-35
WP_099507740.1|13791_14997_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	36.2	1.6e-50
WP_099507743.1|15125_16121_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	56.0	1.2e-19
WP_099507745.1|16735_17968_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	44.9	7.7e-85
21670:21683	attR	GCAGGGCGCGTCCG	NA	NA	NA	NA
>prophage 2
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	96842	170185	5843140	transposase	Paramecium_bursaria_Chlorella_virus(25.0%)	47	NA	NA
WP_099507858.1|96842_98372_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_157933942.1|105935_106094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099507862.1|106247_107603_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_099507863.1|107987_108872_+	DMT family transporter	NA	NA	NA	NA	NA
WP_099507865.1|109004_110063_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_099507867.1|110059_111925_+	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_162299201.1|111951_112935_+	hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	35.0	6.0e-16
WP_099507872.1|112931_113732_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_099507873.1|113813_115112_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099507875.1|115174_116524_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099512560.1|116523_118326_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.1	7.2e-15
WP_099507877.1|118453_118702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157933943.1|119653_119830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099507880.1|120871_122521_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_099507882.1|122495_123122_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099507884.1|123891_124500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099507886.1|124794_126159_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099507888.1|126169_127504_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_099507890.1|127578_128250_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099512561.1|128597_129377_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	9.9e-30
WP_099507892.1|129366_130296_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099507894.1|130292_131252_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099507896.1|131286_132276_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099507898.1|132358_133798_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_099507900.1|133882_135124_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_157933945.1|135174_135561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099512562.1|135671_136286_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_099507904.1|136483_137500_+	thioesterase	NA	NA	NA	NA	NA
WP_099507906.1|140646_141888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162299129.1|141975_143145_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_157934343.1|143203_144667_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	1.5e-50
WP_099507909.1|146049_147822_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_099507910.1|148991_150251_-	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_099507911.1|150425_151814_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_162299130.1|151810_152995_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_099507913.1|152997_154299_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_157933946.1|154791_157443_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_157933947.1|157466_158867_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_162299131.1|159519_160536_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_157933948.1|160718_161837_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099507918.1|162083_163160_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_099507919.1|163411_164059_-	sugar transferase	NA	NA	NA	NA	NA
WP_099507920.1|164506_165790_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_099507921.1|166294_166639_+	VanZ family protein	NA	NA	NA	NA	NA
WP_099507922.1|166747_168043_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_157933949.1|168176_168875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099507924.1|168898_170185_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	299607	368311	5843140	protease,transposase,tRNA	Planktothrix_phage(13.33%)	60	NA	NA
WP_099508024.1|299607_300777_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099508025.1|300962_301637_-	ParA family protein	NA	NA	NA	NA	NA
WP_099508026.1|301979_302387_+	DUF1236 domain-containing protein	NA	NA	NA	NA	NA
WP_099508027.1|302441_303515_-	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_099512576.1|303651_303861_+	DUF2842 domain-containing protein	NA	NA	NA	NA	NA
WP_099508028.1|303949_304144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508029.1|304775_305831_-	response regulator	NA	W8CYM9	Bacillus_phage	36.2	2.8e-11
WP_099508030.1|305831_307976_-	PAS domain-containing protein	NA	Q6XLV6	Feldmannia_irregularis_virus	28.3	4.4e-11
WP_099508031.1|307978_308485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508032.1|308896_309319_+	BA14K family protein	NA	NA	NA	NA	NA
WP_099508033.1|309504_309777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508034.1|309801_310791_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_157933959.1|310870_311581_-	extensin family protein	NA	NA	NA	NA	NA
WP_157933960.1|311745_312270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508037.1|312456_314733_+	CDC48 family AAA ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	47.3	4.6e-51
WP_099508038.1|314816_315254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173909411.1|315557_316448_-	DMT family transporter	NA	NA	NA	NA	NA
WP_099508040.1|316444_317383_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157933961.1|317504_318527_-	acyltransferase family protein	NA	Q9MC93	Pseudomonas_phage	26.9	2.0e-06
WP_099512577.1|318750_319092_-	RidA family protein	NA	NA	NA	NA	NA
WP_099508042.1|319179_320184_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.7	2.9e-13
WP_099508043.1|320180_321173_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	1.5e-17
WP_099508044.1|321187_322138_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099508045.1|322148_323129_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099508046.1|323234_324833_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099512578.1|324985_326140_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_157933962.1|326376_327348_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_157933963.1|327468_327675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508049.1|327763_328009_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_157933964.1|328704_329217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508052.1|329873_330152_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	55.1	1.1e-18
WP_099508053.1|330346_332773_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	48.4	3.4e-193
WP_099508054.1|333003_334272_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.5	3.5e-133
WP_099508055.1|334494_335127_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	61.9	5.5e-63
WP_099512579.1|335204_336572_-	trigger factor	NA	NA	NA	NA	NA
WP_099508056.1|336942_338280_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_099508057.1|338272_339760_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_036360409.1|339943_340282_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_099508058.1|340354_341764_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_157933965.1|341970_342228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508024.1|342435_343605_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099508060.1|343845_344490_-	porin family protein	NA	NA	NA	NA	NA
WP_099508061.1|344799_345498_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_099508062.1|345686_347246_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	33.8	1.9e-51
WP_099508063.1|347238_347613_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_099508064.1|347616_347997_-	iron-sulfur cluster assembly accessory protein	NA	A0A0P0CQC4	Ostreococcus_lucimarinus_virus	38.7	3.6e-17
WP_099508065.1|348167_350057_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_099508066.1|350290_350662_-	SUF system Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_099508067.1|350673_351909_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	38.8	8.5e-92
WP_099508068.1|352026_353340_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_099508069.1|353341_354094_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	26.9	1.1e-09
WP_099508070.1|354216_355689_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_099508071.1|355755_356928_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_099512580.1|357163_357820_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099508072.1|357967_360487_-	M10 family metallopeptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099508073.1|360864_362127_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	33.3	8.5e-55
WP_099508074.1|362140_365611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508075.1|365817_366285_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_099508076.1|366374_366977_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_099508077.1|367024_368311_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	383451	429632	5843140	tRNA,transposase,integrase	Stx2-converting_phage(40.0%)	36	371631:371647	430946:430962
371631:371647	attL	CGGCGGTCACCGTGCCG	NA	NA	NA	NA
WP_099508088.1|383451_384123_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_099512582.1|384125_384737_-	DUF2155 domain-containing protein	NA	NA	NA	NA	NA
WP_099508089.1|384986_385610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508090.1|385615_386416_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_157933966.1|386483_387254_-	DUF4239 domain-containing protein	NA	NA	NA	NA	NA
WP_099508092.1|387923_388964_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099508093.1|389080_390073_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099508094.1|390170_390392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099512583.1|390413_390827_-	NADH:ubiquinone oxidoreductase subunit NDUFA12	NA	NA	NA	NA	NA
WP_099508095.1|391493_395201_+	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	57.7	0.0e+00
WP_099508096.1|395519_396656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508097.1|396655_398944_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_099508098.1|398940_400104_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_099508099.1|400103_401060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508100.1|401467_402397_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_099508101.1|402446_404627_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_099508102.1|404681_408338_-	DNA helicase	NA	NA	NA	NA	NA
WP_157933968.1|410044_411343_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_099512584.1|411405_413418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157933969.1|413803_415462_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_099508105.1|415445_415997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508106.1|415996_416467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508107.1|416463_418701_+	AAA family ATPase	NA	A0A1W6JKX1	Lactococcus_phage	23.4	5.4e-20
WP_099508109.1|419757_420186_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157933970.1|420392_421067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157933971.1|421122_421740_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_099508112.1|421841_422702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157933972.1|422702_422879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508113.1|422940_424038_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_099508114.1|424034_425261_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_099508115.1|425914_426100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508116.1|426124_426802_+	GTP cyclohydrolase I	NA	A0A1C3NFQ1	Phage_NCTB	38.9	3.2e-40
WP_099508117.1|426856_427069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508118.1|427141_427567_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099508119.1|427563_427914_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	51.9	3.4e-30
WP_099508120.1|427961_429632_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.0	6.3e-98
430946:430962	attR	CGGCACGGTGACCGCCG	NA	NA	NA	NA
>prophage 5
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	475830	538845	5843140	transposase,integrase	Paramecium_bursaria_Chlorella_virus(28.57%)	49	483392:483408	501112:501128
WP_099508146.1|475830_476493_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_157933976.1|476661_477309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508149.1|477635_478118_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_099508150.1|478442_479414_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_099508151.1|479478_479805_-	DUF1476 domain-containing protein	NA	NA	NA	NA	NA
WP_157933977.1|480648_480846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162299202.1|480920_481403_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_099508154.1|481411_482911_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_099512586.1|483080_484019_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
483392:483408	attL	CCCGCGGGATGACGATC	NA	NA	NA	NA
WP_099508155.1|484168_485572_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_099508156.1|485568_486234_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.3	4.4e-26
WP_099508157.1|486456_487743_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_099508158.1|487778_490481_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_099508159.1|490514_491168_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	35.5	6.8e-16
WP_099508160.1|491177_491564_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_173909500.1|491691_492555_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_157933978.1|492564_494217_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_157933979.1|494605_494752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099512588.1|495167_496631_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099508162.1|496998_498438_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_178005135.1|498779_499640_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.7	6.0e-28
WP_099512589.1|499650_500847_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_099508164.1|501441_502929_-	DUF1254 domain-containing protein	NA	M1HNU9	Paramecium_bursaria_Chlorella_virus	21.3	2.2e-09
501112:501128	attR	GATCGTCATCCCGCGGG	NA	NA	NA	NA
WP_099508166.1|504053_504350_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_099508167.1|505756_506062_-	Dabb family protein	NA	NA	NA	NA	NA
WP_099508168.1|506990_507683_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_099508169.1|507682_508417_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_099508170.1|508476_509364_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_099508171.1|509462_510266_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.6	6.7e-21
WP_099508172.1|510364_511165_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_099512590.1|511183_512164_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099508173.1|512326_513307_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_173909412.1|513317_514340_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099508174.1|516260_517040_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099508175.1|517231_517519_-	YciI family protein	NA	NA	NA	NA	NA
WP_099508176.1|517904_518735_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099508177.1|521542_522493_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099508178.1|522555_523563_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099508179.1|523599_525156_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.9e-08
WP_099508180.1|525241_526189_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099508181.1|526246_527311_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_099512592.1|527456_528329_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_099508182.1|528391_529303_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_099508183.1|529417_530488_-	maleylacetate reductase	NA	NA	NA	NA	NA
WP_099508184.1|531062_531557_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_099512593.1|532167_533610_+	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	48.5	1.8e-117
WP_099512594.1|533832_534780_-	DUF1612 domain-containing protein	NA	NA	NA	NA	NA
WP_099508185.1|535056_536664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099508187.1|537693_538845_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	657385	690435	5843140	transposase,integrase	Lactococcus_phage(33.33%)	33	653678:653694	690625:690641
653678:653694	attL	TGGTGCCCAGGGGCGGA	NA	NA	NA	NA
WP_157933989.1|657385_658873_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099508287.1|658869_659637_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.0	2.0e-43
WP_099508288.1|659918_661457_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.5	9.5e-117
WP_099508289.1|661470_662217_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.0	5.7e-59
WP_099508290.1|662364_662733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508292.1|663872_664115_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_099508293.1|665309_666329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157933990.1|666752_667160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099512601.1|667413_668769_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_157933991.1|669688_669826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508294.1|669957_670146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508295.1|670182_670587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157933992.1|670600_670783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508297.1|671230_671419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508298.1|672371_672587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157933993.1|672576_673827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508300.1|673832_674402_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_099508301.1|674661_675726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162299137.1|675734_676805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162299204.1|677128_678367_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	24.9	5.8e-08
WP_099508303.1|678378_678636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508304.1|678670_678970_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_157934347.1|679838_680630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157933994.1|681284_683798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508310.1|684024_684390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099508311.1|684409_684601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157933995.1|685102_685375_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_099508313.1|685421_685619_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_099508314.1|685766_686303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508315.1|686319_686637_-	DoxX family protein	NA	NA	NA	NA	NA
WP_157933989.1|686804_688292_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099508287.1|688288_689056_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.0	2.0e-43
WP_157933996.1|689226_690435_+|integrase	tyrosine-type recombinase/integrase	integrase	B0VK72	Azospirillum_phage	33.5	5.1e-17
690625:690641	attR	TGGTGCCCAGGGGCGGA	NA	NA	NA	NA
>prophage 7
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	923604	982364	5843140	tRNA,tail,head,portal,transposase,protease	Acinetobacter_phage(21.05%)	54	NA	NA
WP_099508524.1|923604_924309_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_099508525.1|924573_925572_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_099508526.1|925807_926116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508527.1|926183_926654_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_099508528.1|926670_927318_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_099508529.1|927373_927856_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	38.8	1.2e-20
WP_099508530.1|927961_928930_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	36.4	1.4e-41
WP_099508531.1|928926_931257_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	53.0	2.5e-222
WP_099508532.1|931261_932743_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	42.2	3.1e-96
WP_099508533.1|932864_933305_-	VOC family protein	NA	NA	NA	NA	NA
WP_099508534.1|933499_936151_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.9	7.8e-18
WP_099508535.1|936342_938670_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.6	8.4e-24
WP_157934029.1|939797_941276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508539.1|941517_941706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508540.1|942019_943099_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_157934030.1|943386_945780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508542.1|945971_947327_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_157934031.1|947432_948350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508544.1|948574_951526_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_173909420.1|951617_953039_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_099508546.1|953205_953904_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	4.9e-28
WP_099508547.1|954052_955264_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.4	2.0e-21
WP_099508548.1|955393_955792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508549.1|955959_956418_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_099508550.1|956422_958405_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_099508551.1|958434_958893_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_099508552.1|958889_959981_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_099508553.1|960213_961611_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_099508554.1|961607_962279_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099508555.1|962293_962608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508556.1|962691_962901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508557.1|962914_963451_-	glycoside hydrolase family 108 protein	NA	A0A088F6V6	Sulfitobacter_phage	50.3	1.2e-37
WP_157934032.1|963460_964999_-	DUF2793 domain-containing protein	NA	A0A0K1LM04	Rhodobacter_phage	42.7	3.2e-40
WP_157934033.1|965003_965171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508559.1|965151_969012_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	39.0	1.3e-239
WP_099508560.1|969011_969440_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	49.3	2.5e-35
WP_099508561.1|969604_970495_-	DUF2163 domain-containing protein	NA	A0A1V0DY93	Dinoroseobacter_phage	42.9	2.0e-66
WP_099508562.1|970780_971419_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	51.9	7.6e-52
WP_099508563.1|971498_971744_+	YdcH family protein	NA	NA	NA	NA	NA
WP_099508564.1|971812_972499_-|tail	phage tail tape measure protein	tail	G9JXH3	Shigella_phage	46.2	2.5e-08
WP_099508565.1|972644_972938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508566.1|972980_973190_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_099508567.1|973138_973522_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_099508568.1|973679_974090_-|tail	phage major tail protein, TP901-1 family	tail	I3UM07	Rhodobacter_phage	42.3	1.3e-20
WP_099508569.1|974507_974918_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_099508570.1|974914_975250_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_099508571.1|975438_976005_-|head,tail	phage head-tail connector protein	head,tail	A0A0F7L420	uncultured_marine_virus	32.1	1.4e-12
WP_099508572.1|976029_976782_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_099508573.1|976914_977712_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_099508574.1|979415_979619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508575.1|979728_980265_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	49.4	1.1e-30
WP_099508576.1|980533_980734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934034.1|981006_981156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508577.1|981188_982364_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	42.6	2.5e-77
>prophage 8
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	1123186	1140415	5843140	transposase,integrase	Burkholderia_phage(25.0%)	11	1137029:1137067	1140450:1140488
WP_099508688.1|1123186_1124542_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_099508689.1|1124756_1125707_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099508690.1|1125787_1127437_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_157934045.1|1128863_1129556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508693.1|1129534_1130122_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_099508694.1|1130298_1131414_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.2	3.9e-27
WP_099508695.1|1131555_1135110_+	FkbM family methyltransferase	NA	G9E6G5	Micromonas_pusilla_virus	26.3	5.8e-08
WP_099508696.1|1135317_1136397_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099508697.1|1136600_1136972_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	35.0	1.9e-10
1137029:1137067	attL	AATTATGTGGAGTGCCGGATTATGCGGAGTCCGCAGCGG	NA	NA	NA	NA
WP_099508698.1|1138490_1139405_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099508699.1|1139401_1140415_+|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	22.5	1.9e-12
1140450:1140488	attR	CCGCTGCGGACTCCGCATAATCCGGCACTCCACATAATT	NA	NA	NA	NA
>prophage 9
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	2045404	2097638	5843140	protease,transposase,integrase	Acidithiobacillus_phage(22.22%)	55	2052302:2052356	2082284:2082338
WP_099509421.1|2045404_2046112_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_099509422.1|2046255_2047005_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_099509423.1|2047017_2047962_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_099509424.1|2048032_2048914_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_162299152.1|2049147_2049717_+	HNH endonuclease	NA	A0A1P8DIY8	Virus_Rctr197k	44.3	3.7e-26
WP_099509426.1|2049744_2050830_-	D-TA family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_099509427.1|2050921_2051422_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_099509428.1|2051432_2052014_-	DedA family protein	NA	NA	NA	NA	NA
2052302:2052356	attL	ACTCAAAATCGAGTTCCGCAAGGAGTGCTGGTTCGATCCCGGCCAGGGGCACCAT	NA	NA	NA	NA
WP_099509429.1|2052561_2053377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934105.1|2054250_2054493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099509431.1|2054485_2054743_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_099509433.1|2055285_2055765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509434.1|2055844_2056063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509435.1|2056571_2056970_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099509436.1|2057130_2057646_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099509437.1|2058070_2058793_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_099509438.1|2058879_2059128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508287.1|2059338_2060106_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.0	2.0e-43
WP_157933989.1|2060102_2061590_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099509441.1|2062683_2063667_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099509442.1|2063833_2064346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509443.1|2065187_2065415_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_157934106.1|2065694_2066009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934107.1|2066081_2066630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099509446.1|2067174_2067366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509447.1|2067994_2068225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934108.1|2069725_2070469_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_157934109.1|2071124_2071346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509449.1|2071640_2071928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099509450.1|2072096_2072858_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	52.7	2.0e-67
WP_099509451.1|2072876_2074415_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.5	4.5e-127
WP_099509452.1|2074563_2074749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099509453.1|2074976_2075198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934110.1|2075788_2076625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509455.1|2076706_2076970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509456.1|2077221_2079009_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	33.8	4.9e-48
WP_099509457.1|2079009_2079576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509458.1|2079844_2080072_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099509459.1|2080074_2080263_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157934111.1|2080331_2080814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099509461.1|2080909_2082127_-|integrase	site-specific integrase	integrase	A0A2R4AQW5	Mycobacterium_phage	25.5	6.8e-09
WP_099509462.1|2082675_2082870_+	hypothetical protein	NA	NA	NA	NA	NA
2082284:2082338	attR	ACTCAAAATCGAGTTCCGCAAGGAGTGCTGGTTCGATCCCGGCCAGGGGCACCAT	NA	NA	NA	NA
WP_099509463.1|2083034_2083583_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_099509464.1|2083805_2085122_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.8	3.7e-29
WP_099509465.1|2085121_2086474_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_099509466.1|2086477_2086972_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_099509467.1|2087045_2087426_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_099509468.1|2087524_2088181_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_099509469.1|2088177_2089464_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.5	1.4e-84
WP_099509470.1|2089614_2090733_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	2.1e-57
WP_099509471.1|2090729_2091764_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_099509472.1|2091916_2092567_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036355650.1|2092746_2093013_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_099509473.1|2093048_2093441_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_099509475.1|2096570_2097638_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	2957371	3025005	5843140	protease,transposase,integrase	Leptospira_phage(16.67%)	60	2951978:2952037	2972046:2972155
2951978:2952037	attL	CTTGGTGGAGCTGAGGGGAATCGAACCCCTGACCTCTGCAGTGCGATTGCAGCGCTCTCC	NA	NA	NA	NA
WP_099509451.1|2957371_2958910_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.5	4.5e-127
WP_157934165.1|2959601_2960078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099510182.1|2960071_2962177_+	recombinase family protein	NA	NA	NA	NA	NA
WP_157934166.1|2962943_2963162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934167.1|2963307_2963700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099512853.1|2963972_2964641_+	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	44.5	7.0e-32
WP_099510185.1|2967306_2967888_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_157934168.1|2968943_2969333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099510187.1|2969741_2970635_-|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	38.3	1.0e-46
WP_157934169.1|2970667_2970991_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157934170.1|2970951_2971770_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	24.0	6.0e-09
WP_099510190.1|2972305_2972596_+	YggT family protein	NA	NA	NA	NA	NA
2972046:2972155	attR	CTTGGTGGAGCTGAGGGGAATCGAACCCCTGACCTCTGCAGTGCGATTGCAGCGCTCTCCCATCTGAGCTACAGCCCCGGTCGATTCCATCGAACCAAGCGGCGGAAGTT	NA	NA	NA	NA
WP_099510191.1|2972600_2972927_+	DUF167 domain-containing protein	NA	NA	NA	NA	NA
WP_099510192.1|2972923_2973835_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.2	1.2e-23
WP_099512854.1|2974109_2974739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099510193.1|2974912_2975800_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099510194.1|2976003_2976399_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_099510195.1|2976411_2976831_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_099510196.1|2976842_2978666_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_099510197.1|2978680_2979463_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_099510198.1|2979634_2980222_+|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_099508970.1|2980352_2981807_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.2	2.2e-59
WP_099512856.1|2982158_2983364_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_099510199.1|2983360_2983990_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099510200.1|2984211_2985174_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_099510201.1|2985278_2986478_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_099510202.1|2986490_2987378_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_099510203.1|2987436_2990397_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_099510204.1|2990410_2990731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099510205.1|2990757_2991996_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_099510206.1|2992115_2993516_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.4	1.5e-47
WP_099510207.1|2993525_2994149_+	thymidine kinase	NA	A0A248SL10	Salicola_phage	44.7	1.4e-42
WP_157934171.1|2994240_2994495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099510208.1|2994523_2995507_-	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	26.3	6.7e-15
WP_099510209.1|2995553_2997716_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_099510210.1|2997747_2998308_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_099510211.1|2998517_2999090_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_099510212.1|2999089_3000619_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_099510213.1|3000674_3001547_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_099510214.1|3001569_3003012_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_099510215.1|3003126_3003528_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_099510216.1|3003586_3004156_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_099510217.1|3004264_3007363_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_099510218.1|3007477_3007939_+	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_099510219.1|3008154_3009165_-	TerC family protein	NA	K7QKE8	Escherichia_phage	33.5	3.4e-38
WP_099510220.1|3009392_3010505_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162299218.1|3010680_3011454_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.1	2.6e-30
WP_099510221.1|3011462_3012230_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099510222.1|3012510_3013647_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_099510223.1|3013651_3014557_-	DMT family transporter	NA	NA	NA	NA	NA
WP_099510224.1|3014689_3016114_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_099510225.1|3016302_3017205_+	EamA family transporter	NA	NA	NA	NA	NA
WP_157934172.1|3017277_3017775_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_157934173.1|3017844_3018009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934174.1|3018320_3018551_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_099510227.1|3018916_3019483_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099510228.1|3020146_3021478_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	6.5e-29
WP_099510230.1|3022071_3023184_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_099510231.1|3023382_3023829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099510232.1|3023778_3025005_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	4702409	4734476	5843140	transposase,integrase	Pseudomonas_phage(33.33%)	32	4699201:4699222	4734700:4734721
4699201:4699222	attL	CGCCCCGCCATTCGCCCCGCCA	NA	NA	NA	NA
WP_099511638.1|4702409_4703705_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099511639.1|4704148_4704475_+	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	56.7	6.4e-23
WP_099511641.1|4704519_4704744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511642.1|4704862_4705069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511646.1|4705574_4705760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934272.1|4706072_4706477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934273.1|4706804_4707107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511652.1|4708295_4708649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511654.1|4708741_4709185_+	GFA family protein	NA	NA	NA	NA	NA
WP_099513153.1|4709287_4710058_-	porin family protein	NA	NA	NA	NA	NA
WP_099511638.1|4710475_4711771_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099511656.1|4712438_4713560_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_099508982.1|4713822_4714101_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099511657.1|4714159_4715299_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162299183.1|4716495_4717572_-	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157934275.1|4717750_4717900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511661.1|4719056_4719521_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157934276.1|4719512_4721048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511662.1|4721061_4722198_-	glycosyltransferase family 2 protein	NA	A0A0N9P7Z4	Sulfolobales_Virus_YNP2	37.4	1.1e-26
WP_157934277.1|4723212_4723368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511664.1|4723645_4723978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511666.1|4724001_4724328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511667.1|4725027_4727070_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	26.9	3.8e-28
WP_099511669.1|4727066_4728602_-	hypothetical protein	NA	Q2NP91	Xanthomonas_phage	28.9	1.0e-09
WP_099511671.1|4728605_4729910_-	AAA family ATPase	NA	A0A0S0N5C8	Pseudomonas_phage	35.9	3.7e-61
WP_099511673.1|4729913_4730261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511675.1|4730257_4730803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175608889.1|4730914_4731202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511677.1|4731277_4731940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511679.1|4731936_4733037_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	47.4	3.3e-79
WP_099508982.1|4732999_4733278_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099511657.1|4733336_4734476_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
4734700:4734721	attR	CGCCCCGCCATTCGCCCCGCCA	NA	NA	NA	NA
>prophage 13
NZ_CP016616	Microvirga ossetica strain V5/3m chromosome, complete genome	5843140	4935205	4992938	5843140	tRNA,transposase,integrase	uncultured_Mediterranean_phage(50.0%)	56	4946630:4946645	4993816:4993831
WP_099513180.1|4935205_4937014_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2I2L4Y8	Orpheovirus	30.2	2.1e-06
WP_099511878.1|4937010_4937883_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_099511879.1|4937879_4938977_+	acyltransferase	NA	A9YX16	Burkholderia_phage	29.0	2.1e-17
WP_099511880.1|4938948_4939569_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	46.7	2.3e-29
WP_099511881.1|4939782_4942086_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_099511882.1|4942262_4943267_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	25.1	2.3e-15
WP_099511883.1|4943325_4945185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511884.1|4945273_4945600_-	iron-sulfur cluster insertion protein ErpA	NA	NA	NA	NA	NA
WP_099511885.1|4945688_4946903_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
4946630:4946645	attL	CGATGCCGCGATCAAG	NA	NA	NA	NA
WP_099511886.1|4947101_4948862_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_099511887.1|4948970_4950389_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_099511888.1|4950460_4951480_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	40.2	2.5e-25
WP_099513181.1|4951519_4952320_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.7	1.3e-32
WP_099513182.1|4952333_4953041_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	51.5	1.8e-41
WP_099511889.1|4953037_4954162_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	38.5	6.7e-11
WP_099511890.1|4954219_4954465_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	70.0	7.4e-08
WP_099511891.1|4954538_4955132_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_099511892.1|4955128_4955932_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.2	3.9e-53
WP_099511893.1|4956032_4957394_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.2	9.0e-95
WP_099511894.1|4957395_4958160_+	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_099511895.1|4958174_4958858_+	methyltransferase domain-containing protein	NA	A0A1J0MC37	Streptomyces_phage	37.8	6.7e-06
WP_099511896.1|4958973_4960032_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	38.2	2.7e-14
WP_099511898.1|4961409_4962300_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_173909488.1|4962528_4962807_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	50.6	6.7e-13
WP_099511900.1|4962896_4964504_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_099513183.1|4964516_4965455_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.2	1.7e-52
WP_099511901.1|4965459_4965846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511902.1|4965847_4966693_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_099511903.1|4966909_4968328_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_099513184.1|4968414_4969173_+	glucose 1-dehydrogenase	NA	B5U431	Mycobacterium_phage	28.4	1.4e-07
WP_099511904.1|4969257_4969413_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_099511905.1|4969657_4970542_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_099511906.1|4970812_4971619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511907.1|4971716_4972037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511908.1|4972070_4972355_-	porin	NA	NA	NA	NA	NA
WP_099511909.1|4972683_4973013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934291.1|4973040_4973712_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_173909489.1|4973953_4974385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511912.1|4974465_4974693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511913.1|4974960_4975851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511914.1|4975927_4976737_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099511915.1|4976881_4979878_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	63.7	0.0e+00
WP_099511916.1|4980083_4980758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511917.1|4980892_4981432_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	71.9	1.6e-42
WP_099511918.1|4981765_4981993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511919.1|4982046_4983477_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_099511920.1|4983674_4984790_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_099511921.1|4984786_4985299_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_173909527.1|4986175_4986616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511923.1|4986810_4987848_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_099511924.1|4988078_4989431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099511925.1|4989692_4990268_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099511926.1|4990264_4990807_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_099511788.1|4990941_4991711_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157934292.1|4992151_4992349_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_162299187.1|4992452_4992938_+|transposase	transposase	transposase	NA	NA	NA	NA
4993816:4993831	attR	CGATGCCGCGATCAAG	NA	NA	NA	NA
>prophage 1
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	4977	233972	1343367	integrase,transposase	Acidithiobacillus_phage(18.18%)	169	7997:8013	225520:225537
WP_099513261.1|4977_5595_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	38.0	6.0e-22
WP_099513262.1|5687_6728_-	hypothetical protein	NA	NA	NA	NA	NA
7997:8013	attL	AATCGTCCGATGCTCTA	NA	NA	NA	NA
WP_099513263.1|8263_9946_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
7997:8013	attL	AATCGTCCGATGCTCTA	NA	NA	NA	NA
WP_099513265.1|10508_11501_-	phasin family protein	NA	NA	NA	NA	NA
7997:8013	attL	AATCGTCCGATGCTCTA	NA	NA	NA	NA
WP_099513266.1|12151_13180_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	27.4	7.7e-06
WP_099513267.1|13694_14723_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_175608893.1|14850_15192_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_157934355.1|16651_18775_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_099508092.1|19235_20276_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099511091.1|20392_21385_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099513269.1|21545_22955_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099513270.1|23151_23622_-	DUF1772 domain-containing protein	NA	NA	NA	NA	NA
WP_157934356.1|24137_24335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934357.1|25795_25978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513274.1|27007_27232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513275.1|27742_30232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513276.1|30564_31482_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_099513277.1|32182_32836_+	OsmC family protein	NA	NA	NA	NA	NA
WP_099513279.1|33007_33343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099513280.1|34089_36549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513281.1|37826_39605_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_099513282.1|39815_40070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513283.1|40149_40875_-	DUF2270 domain-containing protein	NA	NA	NA	NA	NA
WP_157934358.1|41642_42596_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	37.7	7.8e-45
WP_099513285.1|42781_43984_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	54.5	2.4e-115
WP_099514244.1|44682_45768_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_099514245.1|46441_47251_-	APH(6) family putative aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_099513287.1|47361_47751_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_099513288.1|47737_48013_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_175608894.1|48862_49144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513289.1|49380_50430_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513290.1|50550_51252_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_157934359.1|52288_52504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513293.1|56043_57030_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099513295.1|57988_59254_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	47.8	1.1e-97
57110:57126	attR	AATCGTCCGATGCTCTA	NA	NA	NA	NA
WP_157934360.1|59518_59827_+	hypothetical protein	NA	NA	NA	NA	NA
57110:57126	attR	AATCGTCCGATGCTCTA	NA	NA	NA	NA
WP_099513298.1|60764_61085_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
57110:57126	attR	AATCGTCCGATGCTCTA	NA	NA	NA	NA
WP_099513299.1|61421_62189_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099513300.1|62475_62751_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157934361.1|62985_63393_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_099513302.1|63494_63905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513303.1|64104_65249_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	2.6e-50
WP_099513304.1|65943_67593_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_157934362.1|69353_69797_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099513307.1|69869_70181_-	EthD family reductase	NA	NA	NA	NA	NA
WP_099513308.1|70414_71710_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099513309.1|71862_72207_+	VanZ family protein	NA	NA	NA	NA	NA
WP_157934363.1|72242_72422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934364.1|73155_74886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513311.1|75611_76580_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_099508289.1|76727_77474_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.0	5.7e-59
WP_099508288.1|77487_79026_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.5	9.5e-117
WP_157934365.1|79410_79575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513312.1|79641_80786_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.2e-52
WP_099513313.1|80844_82545_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_099513315.1|83773_85423_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_099513316.1|85483_86005_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099513317.1|86074_87538_-	M10 family metallopeptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099513318.1|88249_89394_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.3	5.5e-53
WP_099513319.1|89488_89743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513320.1|91473_92802_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	7.1e-52
WP_099513321.1|93194_93905_+	hypothetical protein	NA	F5B430	Synechococcus_phage	36.4	1.3e-15
WP_099513322.1|95228_96373_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.5	4.7e-52
WP_099513323.1|96487_97000_-	acyltransferase	NA	NA	NA	NA	NA
WP_099513324.1|97524_98511_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099513325.1|99120_100365_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_099513326.1|101955_102423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173909537.1|103011_103608_+	sugar transferase	NA	NA	NA	NA	NA
WP_099513327.1|104103_104610_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_099513328.1|104612_105662_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_099513329.1|105658_106774_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.3	2.3e-40
WP_099513330.1|106844_107846_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	31.6	2.2e-37
WP_099513331.1|107845_109009_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.5	4.8e-36
WP_099514247.1|109366_109834_+	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_157934366.1|109830_110355_+	glucuronosyltransferase	NA	NA	NA	NA	NA
WP_099513333.1|110784_111705_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_099513334.1|113111_114017_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_157934367.1|114280_115033_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099513336.1|115017_115221_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099513337.1|115301_115694_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099513338.1|115690_116035_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_099514248.1|116110_117535_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.0	7.3e-63
WP_099513339.1|117810_117990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513340.1|117976_120049_+	recombinase family protein	NA	NA	NA	NA	NA
WP_099513341.1|121526_121916_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	61.8	3.1e-16
WP_099513342.1|121927_123148_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	27.5	6.4e-07
WP_099513343.1|123147_124080_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099513344.1|124076_125078_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	29.1	6.8e-15
WP_157934368.1|125034_125277_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_099514249.1|125273_125648_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162299236.1|125729_127124_-	recombinase family protein	NA	Q38184	Lactococcus_phage	28.2	1.8e-18
WP_157934369.1|127336_128341_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513346.1|128582_129623_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513347.1|129868_130411_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_099513348.1|130407_130983_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099513349.1|131333_132194_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.6	1.5e-34
WP_099513350.1|132206_133406_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_099513351.1|133411_133627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509450.1|134428_135190_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	52.7	2.0e-67
WP_099509451.1|135208_136747_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.5	4.5e-127
WP_099513352.1|136901_137657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099513353.1|138196_139225_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	27.4	7.7e-06
WP_099513354.1|139523_141590_-	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	25.4	3.0e-09
WP_099513355.1|141963_142973_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099513356.1|143167_144508_-	M10 family metallopeptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099513357.1|144817_145681_-	hypothetical protein	NA	K4ICS3	Acidithiobacillus_phage	44.3	5.0e-14
WP_099513358.1|145834_146668_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157934370.1|146682_146922_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099513360.1|146949_147816_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	27.7	2.3e-11
WP_099513354.1|148193_150260_+	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	25.4	3.0e-09
WP_099513361.1|150268_150925_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	37.5	1.3e-11
WP_157934371.1|151026_151410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513362.1|152008_153046_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513363.1|153803_154379_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099508187.1|154699_155851_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513364.1|155880_156411_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_099513365.1|158209_159805_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_157934372.1|160918_161077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513366.1|161057_161417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513367.1|161415_162556_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	7.9e-52
WP_157934373.1|162522_162660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513354.1|162884_164951_-	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	25.4	3.0e-09
WP_099513340.1|165663_167736_-	recombinase family protein	NA	NA	NA	NA	NA
WP_099513339.1|167722_167902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513369.1|168444_168702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934374.1|168742_169009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513370.1|169228_170347_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157934169.1|170675_170999_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157934170.1|170959_171778_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099513371.1|171992_173336_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_157934375.1|173740_174577_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_099513373.1|175572_176714_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.9	4.6e-52
WP_099513374.1|177955_179353_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099513375.1|179349_181497_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.3	2.6e-40
WP_099513376.1|181516_181843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513377.1|181855_186649_-	DUF4082 domain-containing protein	NA	NA	NA	NA	NA
WP_099513378.1|188021_188288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934376.1|188481_188742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934377.1|188803_190138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513380.1|190299_191343_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099510510.1|191567_191990_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099510511.1|191986_192529_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099513304.1|193769_195419_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_099509451.1|195980_197519_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.5	4.5e-127
WP_099509450.1|197537_198299_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	52.7	2.0e-67
WP_099513381.1|198442_198730_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	34.0	2.2e-06
WP_099513382.1|199323_200919_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157934495.1|203021_204335_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099513383.1|204639_205434_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_099513384.1|205541_207077_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_099513385.1|207413_208748_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_099514250.1|209029_210553_+	O-antigen translocase	NA	NA	NA	NA	NA
WP_157934378.1|210726_211572_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_099513387.1|214654_215026_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	47.8	4.6e-09
WP_099513388.1|215022_215265_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_099513344.1|215221_216223_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	29.1	6.8e-15
WP_099513343.1|216219_217152_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099513342.1|217151_218372_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	27.5	6.4e-07
WP_157934379.1|218895_219084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513389.1|219061_221146_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	24.7	1.2e-05
WP_099513390.1|221153_221330_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_099513391.1|221338_223402_-	recombinase family protein	NA	NA	NA	NA	NA
WP_099513392.1|223950_225567_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.9	3.4e-101
WP_099513393.1|225570_225801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513394.1|226921_228070_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099513395.1|228054_229053_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099513396.1|229563_229935_-	hypothetical protein	NA	A0A0F7L6S1	uncultured_marine_virus	32.8	5.3e-05
WP_099513397.1|230271_231112_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099513398.1|232746_233972_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	68.0	1.2e-101
>prophage 2
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	246440	312673	1343367	integrase,transposase	Staphylococcus_phage(14.29%)	55	243620:243635	293550:293565
243620:243635	attL	TCGGCATTTCCTCCGG	NA	NA	NA	NA
WP_099513406.1|246440_247142_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	32.0	7.1e-27
WP_099513407.1|247479_248022_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514251.1|248097_248484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513408.1|249225_250233_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099513409.1|250229_250814_+	SCO family protein	NA	NA	NA	NA	NA
WP_099513410.1|250800_253425_+	GAF domain-containing protein	NA	A0A1V0SGX0	Hokovirus	35.4	3.4e-29
WP_173909538.1|253424_253787_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	37.5	5.7e-12
WP_099513412.1|253802_254981_+	response regulator	NA	W8CYM9	Bacillus_phage	36.7	2.5e-16
WP_099513413.1|255153_256161_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099513414.1|257637_258339_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099513289.1|258459_259509_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513415.1|260365_261394_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099513416.1|261735_262731_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_173909543.1|263541_264417_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513418.1|264509_265733_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_099514252.1|265747_266311_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_099513419.1|266523_267678_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513420.1|268349_269564_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_099509201.1|269576_270452_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.9	4.4e-34
WP_099513421.1|270796_271855_+	nuclease	NA	NA	NA	NA	NA
WP_099514253.1|271913_272591_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_099513422.1|272826_273681_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_099513423.1|274236_274938_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	32.0	7.1e-27
WP_099513424.1|275341_276838_+	amidase	NA	NA	NA	NA	NA
WP_099513425.1|278237_279002_+	creatininase family protein	NA	NA	NA	NA	NA
WP_099513426.1|279047_280172_+	hydantoinase/carbamoylase family amidase	NA	NA	NA	NA	NA
WP_099513427.1|280219_281444_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	68.4	1.8e-102
WP_099513428.1|282076_283981_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_099513429.1|284744_285428_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	50.0	9.1e-11
WP_099513430.1|285504_286287_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	30.4	3.4e-14
WP_099514254.1|286306_286792_-	2,4'-dihydroxyacetophenone dioxygenase family protein	NA	NA	NA	NA	NA
WP_099513431.1|286821_288318_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_099513432.1|288324_288798_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_099513433.1|288908_289880_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_099513434.1|289803_290640_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513435.1|290647_291295_-	RraA family protein	NA	E3T536	Cafeteria_roenbergensis_virus	22.7	4.5e-12
WP_157934388.1|291413_292328_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_099513437.1|292643_293447_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513438.1|293564_293999_+	VOC family protein	NA	NA	NA	NA	NA
293550:293565	attR	CCGGAGGAAATGCCGA	NA	NA	NA	NA
WP_099513439.1|294008_295184_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.9	1.8e-46
WP_099513440.1|295202_296351_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_099513441.1|296387_297605_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099514255.1|297727_298531_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_099514256.1|298641_299388_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_099513442.1|299397_300204_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	31.8	2.5e-28
WP_099513443.1|300229_300967_+	ribonuclease activity regulator RraA	NA	NA	NA	NA	NA
WP_099513444.1|303906_304284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934389.1|304613_305093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513446.1|306205_306904_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	53.4	4.4e-61
WP_099513447.1|306976_307384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513448.1|307516_307741_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099513450.1|308919_309618_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	55.2	7.2e-64
WP_162299237.1|309656_310064_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_162299238.1|310240_310876_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_099508213.1|311335_312673_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	320172	383528	1343367	transposase	Escherichia_phage(21.43%)	52	NA	NA
WP_099513459.1|320172_320871_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.5	1.8e-43
WP_099513460.1|321219_321588_-	phasin family protein	NA	NA	NA	NA	NA
WP_099513461.1|321966_322665_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	52.6	3.7e-60
WP_099513462.1|326773_327718_+	pirin family protein	NA	NA	NA	NA	NA
WP_099513463.1|327891_328200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513464.1|328435_329938_-	amidase	NA	NA	NA	NA	NA
WP_099513465.1|330018_330696_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	43.4	2.4e-27
WP_099513466.1|331179_332112_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_099513467.1|332111_332816_+	MFS transporter permease	NA	NA	NA	NA	NA
WP_162299239.1|332961_334350_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_157934392.1|334436_334709_-	heme-binding protein	NA	NA	NA	NA	NA
WP_099513470.1|334955_336233_-	DUF2183 domain-containing protein	NA	NA	NA	NA	NA
WP_099511964.1|336678_338457_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099513471.1|338498_340421_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099513472.1|340509_341364_-	transporter substrate-binding domain-containing protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	41.9	1.1e-53
WP_099513473.1|341766_342681_-	alpha/beta hydrolase	NA	A0A2R8FCY4	Cedratvirus	30.9	4.0e-06
WP_099513474.1|342808_343573_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	1.0e-18
WP_099513475.1|343691_344618_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513476.1|344841_345651_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_099513477.1|345640_346957_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_099513478.1|347167_347959_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.7	7.0e-07
WP_099513479.1|348331_349450_+	serine hydrolase	NA	NA	NA	NA	NA
WP_099514258.1|349370_350014_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.5e-42
WP_157934394.1|350006_350402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513481.1|350855_352184_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099513482.1|353110_353347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514259.1|354239_355445_-	MFS transporter	NA	NA	NA	NA	NA
WP_099513484.1|355496_356927_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099513485.1|356941_357193_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_099513486.1|357248_357566_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099513487.1|357877_359413_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_099513488.1|359695_359881_-	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.3	9.2e-11
WP_099513489.1|360496_361549_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	25.8	3.9e-05
WP_099513490.1|361733_362381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513491.1|362295_363648_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099513492.1|363659_365165_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.7	1.3e-17
WP_099513493.1|365321_366257_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.7	1.4e-14
WP_157934395.1|366448_366919_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	40.9	3.8e-08
WP_099513495.1|367410_367800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513497.1|368493_368709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514260.1|369170_369776_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_173909539.1|370385_371213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511788.1|371591_372360_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099513498.1|373438_373981_-	YqhA family protein	NA	NA	NA	NA	NA
WP_099513499.1|374360_374528_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_157934396.1|374610_374739_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_099513501.1|375197_376385_-	MFS transporter	NA	NA	NA	NA	NA
WP_099513502.1|376481_377543_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_099513503.1|377636_379850_+	amylo-alpha-1,6-glucosidase	NA	NA	NA	NA	NA
WP_157933981.1|380496_380940_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099513504.1|381221_382247_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513505.1|382559_383528_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.6	1.3e-47
>prophage 4
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	455931	501375	1343367	integrase,transposase	Streptococcus_phage(28.57%)	41	455643:455662	499705:499724
455643:455662	attL	TCTCAGGGTTTTCCCCGATA	NA	NA	NA	NA
WP_099508970.1|455931_457386_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.2	2.2e-59
WP_099514267.1|457637_458858_+	DUF1254 domain-containing protein	NA	A0A1J0FA30	Only_Syngen_Nebraska_virus	28.4	8.2e-39
WP_099513570.1|458903_460370_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_099513571.1|460820_461087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513572.1|461372_462575_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099513573.1|462841_463735_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513574.1|463906_464962_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099513575.1|465043_466270_+	MFS transporter	NA	NA	NA	NA	NA
WP_099513576.1|466266_466740_+	MFS transporter	NA	NA	NA	NA	NA
WP_099513419.1|466946_468101_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513577.1|468772_469987_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_099509486.1|469999_470875_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.6	1.3e-33
WP_099513578.1|471224_472121_-	pirin family protein	NA	NA	NA	NA	NA
WP_099513579.1|472330_473014_+	HAD family phosphatase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	29.2	3.3e-13
WP_099513580.1|473105_474095_-	3',5'-cyclic-nucleotide phosphodiesterase	NA	NA	NA	NA	NA
WP_099514268.1|474349_474646_+	MliC family protein	NA	NA	NA	NA	NA
WP_099514269.1|474744_475263_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_099513581.1|475297_475720_-	ester cyclase	NA	NA	NA	NA	NA
WP_099513582.1|476193_476823_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_173909544.1|476928_477336_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_099513583.1|477469_478351_-	VOC family protein	NA	NA	NA	NA	NA
WP_099513584.1|478672_479821_+	MFS transporter	NA	NA	NA	NA	NA
WP_099513585.1|479817_480978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513586.1|480989_482750_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099513587.1|482897_483203_-	UBP-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_099514271.1|483202_484891_-	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	30.7	5.5e-25
WP_099513588.1|485064_485952_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_099513589.1|487448_487937_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_099513590.1|488257_488623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513591.1|488919_489111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513592.1|489243_490308_-	putative zinc-binding peptidase	NA	NA	NA	NA	NA
WP_099513593.1|490635_491568_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_157934405.1|491690_491918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513594.1|492041_494021_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_099513595.1|494111_494336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513596.1|494387_495566_+	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_099513597.1|495942_496182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513598.1|496784_498008_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_099513599.1|498357_499383_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	29.6	1.3e-05
WP_099513600.1|500214_500616_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
499705:499724	attR	TCTCAGGGTTTTCCCCGATA	NA	NA	NA	NA
WP_099513601.1|500655_501375_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	33.5	2.0e-24
>prophage 5
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	539488	599287	1343367	transposase	Rhizobium_phage(18.18%)	51	NA	NA
WP_099513636.1|539488_540445_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099513637.1|540659_541577_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.4	1.4e-38
WP_157934412.1|541628_542021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513639.1|542152_542425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934413.1|542676_543222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934414.1|543578_543857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513641.1|544020_544227_+	DUF3563 family protein	NA	NA	NA	NA	NA
WP_099513642.1|544590_545772_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099514274.1|546271_547492_-	cytochrome C	NA	NA	NA	NA	NA
WP_157934415.1|547753_548140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513644.1|548453_548837_+	hypothetical protein	NA	L7TKN6	Rhizobium_phage	43.1	3.4e-15
WP_099513645.1|549052_549301_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_099513646.1|549553_551452_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.0	3.3e-103
WP_099513647.1|551567_552569_-	3'-5' exonuclease	NA	A0A076YPV2	Rhizobium_phage	31.6	1.2e-22
WP_099513648.1|552841_554320_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	4.3e-50
WP_099513649.1|554494_555187_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099513652.1|556927_559126_-	ATP-dependent RecD-like DNA helicase	NA	U5J9B0	Bacillus_phage	30.2	6.2e-61
WP_099513653.1|559451_559649_-	stress-induced protein	NA	NA	NA	NA	NA
WP_099513654.1|560468_560744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514275.1|561023_561608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934416.1|561747_561954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513655.1|561965_565229_-	error-prone DNA polymerase	NA	A0A0K1Y8T6	Streptomyces_phage	26.1	1.9e-90
WP_099513656.1|565225_566725_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_099513657.1|566657_567392_-	damage-inducible mutagenesis protein	NA	NA	NA	NA	NA
WP_099514276.1|567760_568018_+	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_099513658.1|568380_569349_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.2	1.7e-50
WP_099513659.1|569652_570513_+	EcsC family protein	NA	NA	NA	NA	NA
WP_099510310.1|571099_572140_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513660.1|572256_573249_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099513661.1|573454_574759_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_099513662.1|574917_575343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513663.1|575339_576056_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.2	6.6e-20
WP_099513664.1|576073_577315_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099513665.1|577468_578824_-	8-oxoguanine deaminase	NA	NA	NA	NA	NA
WP_099513666.1|579206_579470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513667.1|579557_581468_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	30.9	3.1e-64
WP_099513668.1|581641_581824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513669.1|581820_582636_-	DUF1194 domain-containing protein	NA	NA	NA	NA	NA
WP_099513670.1|582672_583665_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_099513671.1|583689_583917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513672.1|584492_586412_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099513673.1|586717_587350_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099514277.1|587558_588341_-	DUF1194 domain-containing protein	NA	NA	NA	NA	NA
WP_162299240.1|589694_589841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514278.1|590182_590581_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099513675.1|590866_592618_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099513676.1|593237_593744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513678.1|594021_594672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513679.1|594843_596049_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_099513680.1|597020_597650_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099513681.1|598318_599287_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	36.8	5.3e-49
>prophage 6
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	659770	711986	1343367	integrase,transposase	Bacillus_phage(28.57%)	45	687216:687233	724056:724073
WP_157933989.1|659770_661258_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099508287.1|661254_662022_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.0	2.0e-43
WP_099513730.1|662275_663010_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_099513731.1|663325_663547_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_173909547.1|663868_664873_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_099513733.1|665047_666475_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_099514285.1|666989_668243_+	threonine synthase	NA	NA	NA	NA	NA
WP_099513734.1|668660_669413_-	damage-inducible mutagenesis protein	NA	NA	NA	NA	NA
WP_099513735.1|669667_670816_-	DNA polymerase IV	NA	I6RSM4	Salmonella_phage	27.1	7.5e-18
WP_099513736.1|670888_673006_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	29.5	6.0e-69
WP_099513737.1|673136_674177_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.7	4.2e-116
WP_099513738.1|675985_676558_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099513739.1|676677_677007_-	glutathione S-transferase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_157934424.1|677467_679096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513741.1|679466_681260_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099513742.1|681535_683494_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099513743.1|683749_684379_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_099513744.1|684494_685418_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514286.1|685788_687057_+	low temperature requirement protein A	NA	NA	NA	NA	NA
687216:687233	attL	GTTTGACCCCAAGCAGAC	NA	NA	NA	NA
WP_099513745.1|687348_688290_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	25.3	1.0e-12
WP_162299242.1|688434_688785_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_099513748.1|689262_689517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513749.1|689526_689871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934425.1|690122_690662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513751.1|691099_691453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513752.1|692141_692552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513753.1|692907_694203_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099513754.1|694468_695416_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_099513755.1|695418_696630_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099514287.1|696875_697292_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162299243.1|697600_698053_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_099513757.1|698045_698729_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_099513758.1|698775_699219_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_099513759.1|699215_699536_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099513760.1|699638_700112_+	VOC family protein	NA	NA	NA	NA	NA
WP_099513761.1|700309_700756_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099513762.1|700823_702068_+	MFS transporter	NA	NA	NA	NA	NA
WP_099513763.1|702404_703889_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	64.2	1.2e-172
WP_099514288.1|704197_705751_-	acetolactate synthase large subunit	NA	NA	NA	NA	NA
WP_099513764.1|706167_706716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513765.1|706817_707099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513766.1|707230_707833_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513419.1|708057_709212_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513577.1|709883_711098_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_099509486.1|711110_711986_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.6	1.3e-33
724056:724073	attR	GTTTGACCCCAAGCAGAC	NA	NA	NA	NA
>prophage 7
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	722531	844144	1343367	transposase,protease	Rhizobium_phage(15.38%)	114	NA	NA
WP_099513774.1|722531_723830_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099513775.1|724220_725003_-	porin family protein	NA	NA	NA	NA	NA
WP_099513776.1|725512_726616_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513777.1|726747_727116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514290.1|727891_728056_+	periplasmic nitrate reductase, NapE protein	NA	NA	NA	NA	NA
WP_099513778.1|728070_728364_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_099513779.1|728360_728618_+	chaperone NapD	NA	NA	NA	NA	NA
WP_099513780.1|728622_731142_+	periplasmic nitrate reductase subunit alpha	NA	A0A077SK27	Escherichia_phage	22.6	8.2e-09
WP_099513781.1|731138_731612_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_099513782.1|731611_732229_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_099513783.1|732233_732782_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_099513784.1|735291_735810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513785.1|736610_736799_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_099513786.1|736997_737879_+	Ku protein	NA	NA	NA	NA	NA
WP_099513787.1|737913_740493_+	DNA ligase D	NA	A0A068CDF3	Rhizobium_phage	41.5	6.2e-60
WP_099513788.1|740957_741431_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_157934429.1|741444_742083_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_099513791.1|743190_744339_+	helix-turn-helix domain-containing protein	NA	L7TKN6	Rhizobium_phage	40.4	3.0e-59
WP_099513792.1|744466_744715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513793.1|745119_745437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513794.1|746249_747091_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157934430.1|747933_748335_+	response regulator	NA	NA	NA	NA	NA
WP_099513796.1|748882_749191_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_162299244.1|749242_749644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934432.1|749718_749889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934433.1|750562_750937_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099513799.1|751055_752282_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_099513800.1|752889_753924_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099513801.1|753920_754418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934434.1|754525_755482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513803.1|755710_756001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934435.1|756106_756265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513804.1|756261_756699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934436.1|756786_758316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513806.1|759644_760565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513807.1|761316_761682_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_099513808.1|761678_761903_-	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_099513809.1|762699_762954_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_099513810.1|764698_765856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934437.1|766121_766481_+	DUF3572 domain-containing protein	NA	NA	NA	NA	NA
WP_099513812.1|766617_767061_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_099513813.1|767061_767304_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_099513814.1|767518_767854_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_099513815.1|768034_768262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099510511.1|768373_768916_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099510510.1|768912_769335_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099513774.1|769627_770926_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099513816.1|771613_771961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934438.1|772060_772279_-	hypothetical protein	NA	T1SAR8	Salmonella_phage	51.9	5.6e-07
WP_099513818.1|772572_773106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513819.1|773408_774269_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_157934439.1|775126_775408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513821.1|775564_776254_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_099514291.1|776520_777372_-	transglycosylase SLT domain-containing protein	NA	A0A0K2CNS6	Brevibacillus_phage	28.6	1.9e-05
WP_099513822.1|777633_778272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099509475.1|778759_779827_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	28.6	8.0e-06
WP_099513823.1|780096_780537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513824.1|780696_781680_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099513824.1|783096_784080_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099513825.1|784684_784909_-	DUF3563 family protein	NA	NA	NA	NA	NA
WP_099513826.1|785053_785332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513827.1|785588_785891_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099513829.1|786443_786716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513830.1|787003_787273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513831.1|787735_788242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934440.1|788556_788874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934441.1|789047_789407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513834.1|791149_791353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508970.1|791806_793261_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.2	2.2e-59
WP_099513835.1|793474_794701_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099513836.1|794650_794971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513837.1|794967_795180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513838.1|795172_795418_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_099513839.1|795674_796460_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514292.1|796905_797931_+	purine nucleoside permease	NA	NA	NA	NA	NA
WP_099514293.1|798061_799000_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_099513841.1|799161_800460_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099513842.1|800768_801077_+	SWIB/MDM2 domain-containing protein	NA	NA	NA	NA	NA
WP_162299245.1|801161_801650_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	45.3	9.0e-13
WP_099513845.1|802053_802347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162299246.1|802315_802993_-	hypothetical protein	NA	A0A291AUP8	Sinorhizobium_phage	40.4	4.4e-42
WP_099513847.1|804426_804924_+	3'-5' exonuclease	NA	A0A1X9SH08	Bradyrhizobium_phage	28.0	1.5e-10
WP_099513848.1|804923_806975_+	ATP-dependent helicase	NA	S5M596	Bacillus_phage	27.1	8.4e-44
WP_099513849.1|807008_807329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513850.1|807689_808571_+	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	32.0	2.4e-16
WP_099513851.1|808904_809429_-	cytochrome P460 family protein	NA	NA	NA	NA	NA
WP_099513852.1|809457_810828_-	peroxidase	NA	NA	NA	NA	NA
WP_099514294.1|810883_811483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513853.1|811575_812709_-	catalase family protein	NA	NA	NA	NA	NA
WP_099513855.1|812962_813952_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099513856.1|813935_816281_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099513857.1|816280_817366_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_099513858.1|817379_818216_-	3-hydroxybutyrate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.1	2.0e-07
WP_099513859.1|818199_818985_-	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_173909548.1|819116_820250_-	DUF3734 domain-containing protein	NA	NA	NA	NA	NA
WP_099513861.1|821093_822074_+	catalase family peroxidase	NA	NA	NA	NA	NA
WP_099513862.1|822212_823358_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099513863.1|823354_826519_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_099513864.1|826846_828355_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_099513865.1|830023_830278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514295.1|830291_831635_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_099511583.1|831747_831987_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_099513866.1|831983_832763_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_173909549.1|833067_833916_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_099513868.1|833966_835157_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_099513869.1|835234_835864_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513870.1|835905_836376_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_099514296.1|836379_837033_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513871.1|837153_838365_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_099514297.1|838419_840012_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_099513873.1|840354_841662_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_099513874.1|841699_842572_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_099514298.1|842626_843385_-	DMT family transporter	NA	NA	NA	NA	NA
WP_099513875.1|843433_844144_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	932860	978235	1343367	integrase,transposase	Leptospira_phage(25.0%)	46	937043:937060	983049:983066
WP_099513955.1|932860_933736_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.6	6.3e-33
WP_099513956.1|933748_934963_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_099513957.1|935498_935795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513958.1|935827_936646_-	DUF899 domain-containing protein	NA	NA	NA	NA	NA
WP_099513959.1|936768_937989_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
937043:937060	attL	TCGACGCGGCGCGGGCGA	NA	NA	NA	NA
WP_099513960.1|937998_938658_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_162299247.1|938863_939658_-	DUF899 domain-containing protein	NA	NA	NA	NA	NA
WP_157934453.1|939656_940043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513962.1|940235_940646_-	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_099513963.1|940629_940836_-	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_099513964.1|941148_941478_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_099513965.1|942146_942794_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_099513966.1|942925_943843_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513967.1|944422_945295_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	38.5	6.7e-35
WP_099513968.1|945308_946055_+	DUF4336 domain-containing protein	NA	NA	NA	NA	NA
WP_099513969.1|946302_946875_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_099513970.1|948175_948940_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_099513971.1|948936_949827_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_099513972.1|949999_950746_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099513974.1|951515_952073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934454.1|952777_952945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513975.1|953102_953381_+	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_099513976.1|953384_953726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513977.1|953924_954830_+	DUF2243 domain-containing protein	NA	NA	NA	NA	NA
WP_099513978.1|954850_955513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513979.1|956124_957036_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_099513980.1|957110_957590_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_099513981.1|958454_959732_+	DUF2183 domain-containing protein	NA	NA	NA	NA	NA
WP_099513982.1|960026_960626_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_099513983.1|960752_961034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513355.1|961091_962100_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099513354.1|962474_964541_+	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	25.4	3.0e-09
WP_173909542.1|964765_965935_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_099513985.1|966179_966674_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_099514313.1|966852_967917_+	putative zinc-binding peptidase	NA	NA	NA	NA	NA
WP_157934455.1|967998_968190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934456.1|968226_968535_+	response regulator	NA	NA	NA	NA	NA
WP_099513987.1|968806_969607_+	DUF1194 domain-containing protein	NA	NA	NA	NA	NA
WP_099513988.1|969877_970087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934457.1|970144_970432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934458.1|970542_970704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099513990.1|970721_971687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099511638.1|972774_974070_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099513992.1|974389_974776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934460.1|974750_977057_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099513993.1|977047_978235_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J790	uncultured_Caudovirales_phage	28.5	1.9e-08
983049:983066	attR	TCGACGCGGCGCGGGCGA	NA	NA	NA	NA
>prophage 9
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	1014779	1074382	1343367	integrase,transposase,protease	Mycobacterium_phage(33.33%)	45	1026122:1026136	1074232:1074246
WP_099514025.1|1014779_1015481_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099513884.1|1015968_1017315_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157934446.1|1017377_1017656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934464.1|1017675_1018356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514027.1|1019136_1020549_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_099514028.1|1020545_1022594_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_099514029.1|1022574_1024410_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_099514030.1|1024435_1025443_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
WP_099514031.1|1025475_1026468_-	ABC transporter ATP-binding protein	NA	A0A1V0SI78	Klosneuvirus	30.6	2.8e-05
1026122:1026136	attL	TTGACCGCATCGAAG	NA	NA	NA	NA
WP_099514032.1|1026464_1027484_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.8	2.1e-11
WP_099514033.1|1027480_1028404_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099514034.1|1028369_1029347_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099514315.1|1029508_1031155_-	twin-arginine translocation pathway signal protein	NA	NA	NA	NA	NA
WP_099514035.1|1031216_1031972_-	hydrogenase expression protein HupH	NA	NA	NA	NA	NA
WP_099514036.1|1032095_1032911_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514037.1|1033238_1034966_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_099514038.1|1036421_1038185_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_099514039.1|1038199_1038961_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_162299249.1|1038972_1039860_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_099514041.1|1040844_1042455_-	Na+/H+ antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	30.6	1.3e-07
WP_157934465.1|1042703_1043183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514043.1|1043401_1043656_+	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_099514044.1|1043777_1044353_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_099514316.1|1044973_1045375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514045.1|1045752_1046634_+	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	31.2	2.7e-15
WP_099514046.1|1046820_1049019_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_099514047.1|1049022_1050015_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_099514048.1|1050017_1050617_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	37.7	6.5e-21
WP_099514049.1|1052188_1052530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514050.1|1052676_1054110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514051.1|1054503_1055232_-	dimethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_099514052.1|1055228_1056437_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_099514053.1|1057131_1058367_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.0	7.2e-91
WP_099514054.1|1059399_1060338_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_099514055.1|1060598_1060808_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	54.9	2.3e-10
WP_099514056.1|1061697_1062105_+	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_157934466.1|1062183_1064112_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A9YVR1	Ostreococcus_tauri_virus	42.7	9.4e-114
WP_099514057.1|1064338_1065307_+	tyrosine recombinase	NA	A0A142K7N4	Mycobacterium_phage	27.8	3.0e-15
WP_099514058.1|1065570_1065825_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_099514059.1|1065840_1066530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514060.1|1067661_1067931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514062.1|1069634_1070849_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099514063.1|1071232_1071745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514064.1|1071955_1072219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157933989.1|1072894_1074382_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
1074232:1074246	attR	CTTCGATGCGGTCAA	NA	NA	NA	NA
>prophage 10
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	1085743	1106773	1343367	transposase	Escherichia_phage(20.0%)	15	NA	NA
WP_099514319.1|1085743_1086289_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099514077.1|1086613_1087765_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099514078.1|1088102_1089356_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	36.5	4.6e-45
WP_099514079.1|1089352_1090081_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	43.0	5.3e-33
WP_099510694.1|1090023_1091164_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.8	2.9e-54
WP_099514080.1|1091943_1092309_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_099514081.1|1092351_1094166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514082.1|1094162_1094885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514083.1|1095067_1095295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514084.1|1095528_1095783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514085.1|1096123_1101079_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099513636.1|1101196_1102153_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099514086.1|1103006_1104152_+	replication protein C	NA	L7TKN6	Rhizobium_phage	37.4	3.5e-55
WP_099514087.1|1104346_1104967_+	HNH endonuclease	NA	A0A0F6YR61	Sinorhizobium_phage	45.5	5.1e-21
WP_099514088.1|1105402_1106773_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP016617	Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence	1343367	1149873	1272476	1343367	transposase	Sinorhizobium_phage(11.76%)	93	NA	NA
WP_099510511.1|1149873_1150416_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157934475.1|1150693_1151185_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	36.4	1.3e-11
WP_099514125.1|1151568_1151934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514126.1|1151902_1152433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934476.1|1152706_1153057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934477.1|1153067_1153229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514129.1|1153471_1153840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514130.1|1153972_1155007_-	methyltransferase	NA	NA	NA	NA	NA
WP_099514325.1|1156215_1156560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514326.1|1157051_1157333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514133.1|1157379_1158198_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_099514134.1|1158382_1158577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173909551.1|1158978_1160016_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.0	1.2e-115
WP_099514136.1|1160494_1160725_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099514137.1|1162026_1162809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514139.1|1163327_1164680_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_099514140.1|1164996_1165236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934478.1|1166558_1166885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934479.1|1166919_1167162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514141.1|1167213_1167960_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	35.1	1.5e-14
WP_099514142.1|1168176_1168362_-	CsbD family protein	NA	NA	NA	NA	NA
WP_099514143.1|1168463_1170086_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_099514144.1|1170272_1170818_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_099514145.1|1171088_1172231_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_162299251.1|1172332_1172839_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099514146.1|1173950_1174136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162299235.1|1174775_1175291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514147.1|1176816_1177866_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099514148.1|1178109_1178841_-	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	80.4	1.2e-37
WP_099508213.1|1180011_1181349_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099514150.1|1182754_1183015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514151.1|1183387_1185841_+	DNA topoisomerase	NA	F2Y1B5	Organic_Lake_phycodnavirus	24.2	4.1e-05
WP_099514152.1|1185927_1186275_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_157934480.1|1186465_1186852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514154.1|1186936_1188319_-	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	26.1	2.0e-28
WP_099514155.1|1189341_1189767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509086.1|1191303_1191681_-	response regulator	NA	NA	NA	NA	NA
WP_099514156.1|1194892_1195201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514157.1|1195335_1196532_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.2	1.0e-89
WP_099514158.1|1196459_1196978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514159.1|1197671_1198388_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.0	1.8e-54
WP_099514160.1|1198685_1199177_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157934481.1|1199198_1199954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514162.1|1200084_1200969_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_099514328.1|1201220_1201418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514164.1|1202314_1202701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934482.1|1203320_1204127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934483.1|1206337_1207555_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.9	3.7e-23
WP_099514168.1|1208995_1209241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099509451.1|1209436_1210975_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.5	4.5e-127
WP_099509450.1|1210993_1211755_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	52.7	2.0e-67
WP_099514329.1|1211893_1212154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514330.1|1212927_1213401_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099510694.1|1213397_1214539_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.8	2.9e-54
WP_099512701.1|1214735_1215161_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099510694.1|1215502_1216643_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.8	2.9e-54
WP_099514169.1|1217133_1217481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511788.1|1217470_1218240_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099514170.1|1218387_1218612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514171.1|1218644_1218830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934484.1|1218885_1219050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514172.1|1219437_1219872_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_099514175.1|1221558_1223661_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_099514176.1|1223657_1228862_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_157933989.1|1228793_1230281_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099508287.1|1230277_1231045_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.0	2.0e-43
WP_099514177.1|1231890_1233552_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099514331.1|1233595_1234723_-	serine hydrolase	NA	NA	NA	NA	NA
WP_099514178.1|1234862_1235807_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514179.1|1235859_1237074_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_099514332.1|1237180_1238062_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_099514180.1|1238348_1239017_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_099514181.1|1239016_1240522_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_099514182.1|1240578_1241865_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_099514183.1|1241902_1244605_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_099514184.1|1244638_1245292_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	36.0	4.0e-16
WP_099514185.1|1245302_1245689_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_099514333.1|1245816_1246680_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_099510353.1|1247502_1248228_-	acetoacetyl-CoA reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	1.1e-09
WP_099514107.1|1248318_1249491_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_099514334.1|1249609_1250992_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099514187.1|1251018_1252398_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_099514188.1|1252425_1254771_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_099514189.1|1254853_1255264_-	phasin family protein	NA	NA	NA	NA	NA
WP_099514190.1|1255314_1257468_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	3.1e-49
WP_099514191.1|1257510_1258809_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_099514192.1|1258848_1261509_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_099514193.1|1261954_1262929_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_099514195.1|1263672_1265619_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_036359725.1|1265723_1265963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934485.1|1267472_1267721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514197.1|1267915_1268710_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_099514198.1|1271309_1272476_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP016619	Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence	977332	82679	122294	977332	transposase,integrase	Acidithiobacillus_phage(33.33%)	25	98244:98258	129129:129143
WP_099512061.1|82679_83821_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.7e-54
WP_099514949.1|83819_84095_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_099514950.1|85195_86518_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_099515625.1|86584_87772_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A2K9L679	Tupanvirus	25.6	4.4e-13
WP_099514951.1|87805_88687_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099514952.1|88729_90166_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_099514953.1|90178_91288_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_157934588.1|91655_91865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514955.1|92524_93550_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099514956.1|93679_93994_-	cytochrome c	NA	NA	NA	NA	NA
WP_099514957.1|94669_94951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514958.1|96017_96272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514959.1|96271_98884_+	tyrosinase family protein	NA	NA	NA	NA	NA
98244:98258	attL	GGGAAGGCGAATGGC	NA	NA	NA	NA
WP_099514960.1|99602_100457_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099514961.1|100616_101411_+	DUF1194 domain-containing protein	NA	NA	NA	NA	NA
WP_099508288.1|102779_104318_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.5	9.5e-117
WP_099508289.1|104331_105078_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.0	5.7e-59
WP_099514962.1|106188_106464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514963.1|107054_107366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162299263.1|107362_114874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515626.1|115440_115845_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_157934589.1|115979_116438_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099514966.1|116595_118920_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	33.2	2.4e-119
WP_099515627.1|119121_121023_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099514967.1|121172_122294_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1Y0T0H2	Sinorhizobium_phage	31.8	4.1e-08
129129:129143	attR	GGGAAGGCGAATGGC	NA	NA	NA	NA
>prophage 2
NZ_CP016619	Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence	977332	185572	245198	977332	transposase	Planktothrix_phage(12.5%)	54	NA	NA
WP_099515024.1|185572_186910_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099515025.1|187310_188174_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515026.1|188326_189670_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_099515630.1|189789_190635_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_099515027.1|190636_191470_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_099515028.1|191511_192582_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.5	1.9e-23
WP_162299268.1|192670_193495_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_099515030.1|193545_194562_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_099515031.1|194585_195728_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.9	1.1e-45
WP_099515032.1|196654_197920_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	47.2	4.5e-96
WP_099515033.1|198494_199265_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_099515034.1|199457_199937_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_099515035.1|200152_201346_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_099515036.1|201396_202044_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099515037.1|202073_202835_+	SDR family oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	37.8	6.5e-34
WP_099515038.1|202851_204213_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_099515039.1|204606_206157_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_099515040.1|206280_207363_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099515631.1|207445_208981_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_099515041.1|209076_209817_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_099515042.1|209813_210926_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_162299269.1|210922_212581_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_099515044.1|212577_213864_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099515045.1|213860_214829_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_099515046.1|215020_216226_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515047.1|216222_217212_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	4.4e-14
WP_099515632.1|217214_217628_-	DUF2141 domain-containing protein	NA	NA	NA	NA	NA
WP_162299259.1|217976_218291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515049.1|219207_219426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515051.1|219667_219994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934597.1|220233_220746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515053.1|221031_221418_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_099515054.1|221550_222030_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_099515055.1|222175_222385_+	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_099515056.1|222506_222887_+	DUF4174 domain-containing protein	NA	NA	NA	NA	NA
WP_099515057.1|222927_224331_+	deoxyribodipyrimidine photo-lyase	NA	B3TZ20	Ampelophaga_rubiginosa_nucleopolyhedrovirus	36.9	1.5e-73
WP_099515058.1|224579_225047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515059.1|225033_225732_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.1	6.3e-44
WP_175608900.1|225742_225994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515060.1|226132_227698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515633.1|227888_228503_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_099515061.1|228788_228980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515062.1|230288_230999_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099515063.1|231298_232060_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_099515064.1|232112_232577_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_099515065.1|232579_232894_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099515067.1|233589_234300_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	36.2	2.7e-26
WP_099515068.1|235042_235399_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_157934598.1|236857_237004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515069.1|237558_238620_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_099513503.1|238713_240927_+	amylo-alpha-1,6-glucosidase	NA	NA	NA	NA	NA
WP_099515070.1|241346_241580_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099515634.1|242135_243083_-	DUF1612 domain-containing protein	NA	NA	NA	NA	NA
WP_099512264.1|243548_245198_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP016619	Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence	977332	316112	355485	977332	transposase	Acidithiobacillus_phage(28.57%)	37	NA	NA
WP_099508542.1|316112_317468_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	30.2	4.9e-32
WP_099515641.1|318427_319186_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_157934608.1|319722_320313_+	LemA family protein	NA	NA	NA	NA	NA
WP_099515131.1|320360_320687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515132.1|320985_321921_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_099515133.1|322047_322743_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_099515642.1|323306_324023_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.9	6.9e-54
WP_157934609.1|325848_326229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515135.1|326836_327805_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.2	2.2e-50
WP_099515138.1|328484_328733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515139.1|328870_331000_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_099515140.1|331514_332675_+	FIST C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099515643.1|333301_334507_+	response regulator	NA	NA	NA	NA	NA
WP_099515141.1|334929_335637_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099515142.1|335827_336970_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_099515143.1|337488_337680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934610.1|337788_338001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515145.1|338320_338530_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	51.6	1.5e-09
WP_099515146.1|338651_338843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515644.1|338874_339216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515147.1|339282_340479_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_173909572.1|340552_340939_+	response regulator	NA	NA	NA	NA	NA
WP_099515646.1|340994_341729_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_099515148.1|342048_342270_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_099515149.1|342392_342869_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.0	5.3e-10
WP_099515150.1|343061_343370_+	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_099515151.1|343540_344764_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099515152.1|345147_345564_+	DUF1236 domain-containing protein	NA	NA	NA	NA	NA
WP_157934611.1|345553_345742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515647.1|345974_347015_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_099515153.1|346958_347447_+	GTPase RsgA	NA	NA	NA	NA	NA
WP_099509450.1|347477_348239_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	52.7	2.0e-67
WP_099509451.1|348257_349796_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.5	4.5e-127
WP_099515154.1|351455_351695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157933981.1|351832_352276_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099515155.1|353291_353546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515649.1|354129_355485_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP016619	Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence	977332	368348	438523	977332	transposase	Streptococcus_phage(25.0%)	59	NA	NA
WP_099509475.1|368348_369416_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	28.6	8.0e-06
WP_157934614.1|369687_370338_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162299271.1|370389_371778_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_099515167.1|371956_372739_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515168.1|373092_373416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515169.1|374567_375056_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YTY5	Streptomyces_phage	30.2	1.8e-08
WP_099515170.1|375151_375547_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_099515171.1|375808_376117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934615.1|376369_376816_-	response regulator	NA	NA	NA	NA	NA
WP_099515173.1|376906_377401_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_099515174.1|377594_378182_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_099515176.1|379869_380865_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515177.1|381183_382482_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099507922.1|382642_383938_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099515178.1|384154_384592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515180.1|385227_385530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515181.1|385608_385899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099512246.1|386461_387793_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	7.6e-30
WP_157934616.1|388918_389779_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099515183.1|389865_391686_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_157934617.1|392029_392599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515185.1|392807_393230_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_099515650.1|393256_393439_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_099515186.1|394165_394420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515187.1|394480_395371_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515188.1|395526_395895_-	phasin family protein	NA	NA	NA	NA	NA
WP_099515189.1|396657_398352_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.8	1.8e-23
WP_173909563.1|398626_399439_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099515190.1|399468_399729_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_157934618.1|400177_400738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934619.1|401309_402302_+	phasin family protein	NA	NA	NA	NA	NA
WP_099515192.1|403045_404287_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_099515193.1|405767_406823_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513340.1|407502_409575_-	recombinase family protein	NA	NA	NA	NA	NA
WP_099513339.1|409561_409741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515195.1|411224_411482_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_157934620.1|411496_412030_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_099515652.1|412741_412927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515197.1|413017_413266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515198.1|413268_413484_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_099515199.1|413613_413826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515200.1|413858_414101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515201.1|414956_415901_+	amidoligase family protein	NA	NA	NA	NA	NA
WP_099515202.1|416035_416566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515203.1|416669_417515_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_099515653.1|417533_418601_-	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_099515204.1|418998_420390_+	phospholipase	NA	NA	NA	NA	NA
WP_099515206.1|421113_422016_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515207.1|422047_422455_+	DUF2000 family protein	NA	NA	NA	NA	NA
WP_099515208.1|422665_423673_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_099515209.1|423676_425098_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_099515210.1|425099_425684_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515211.1|425929_426424_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_157934621.1|427133_427490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515213.1|428815_429886_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099515214.1|430406_431405_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_099515215.1|431563_432547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515217.1|433480_434122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515218.1|437170_438523_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016619	Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence	977332	445838	500199	977332	transposase	Acidithiobacillus_phage(12.5%)	51	NA	NA
WP_099509451.1|445838_447377_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.5	4.5e-127
WP_099510182.1|448040_450146_-	recombinase family protein	NA	NA	NA	NA	NA
WP_162299260.1|450139_450676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515230.1|452164_452449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173909564.1|453524_453740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934626.1|453812_454130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515233.1|455457_458328_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_157934627.1|458444_458891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515235.1|459083_459473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173909565.1|459675_459948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515237.1|460091_460361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515238.1|460472_460814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515239.1|461508_462198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515240.1|462601_463387_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515241.1|463493_463688_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_157934628.1|463976_464180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515243.1|464254_464692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515244.1|464998_465664_-	ParA family protein	NA	A2I303	Vibrio_virus	26.6	1.7e-14
WP_099515245.1|465993_467289_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_157934629.1|467442_467829_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_099515247.1|468156_468426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515248.1|468553_468757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515249.1|468913_469162_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099515654.1|469391_470213_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_099515250.1|471877_472081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515251.1|472264_473083_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_099515655.1|473130_473400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515252.1|473860_474070_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	52.9	4.0e-10
WP_099515253.1|474544_475314_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157934630.1|475927_476698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515255.1|476743_477091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515256.1|477350_478364_-	hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	30.8	4.8e-16
WP_099512750.1|478514_479570_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	2.4e-26
WP_157934631.1|479596_480658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515258.1|480671_481679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934632.1|481954_483253_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_099515260.1|483349_484282_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_157934633.1|484344_485151_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099515262.1|485161_486181_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_099515263.1|486852_487551_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	55.2	1.7e-65
WP_099515264.1|487609_489391_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_099515265.1|489541_490351_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099515266.1|490677_490935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515268.1|491503_491806_-	SWIB/MDM2 domain-containing protein	NA	NA	NA	NA	NA
WP_099515269.1|491841_492549_-	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	29.6	1.8e-09
WP_099515270.1|492704_493157_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_099515272.1|493862_494651_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515273.1|494756_495041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099508342.1|495807_497073_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_162299272.1|497572_498724_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099508970.1|498744_500199_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.2	2.2e-59
>prophage 6
NZ_CP016619	Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence	977332	503862	562135	977332	transposase,integrase	Escherichia_phage(16.67%)	47	495281:495296	563903:563918
495281:495296	attL	AAGCCGTCCATCGTGG	NA	NA	NA	NA
WP_099514513.1|503862_504561_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	55.2	3.6e-63
WP_099515278.1|506671_507601_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_099515279.1|507612_509058_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_099515280.1|509054_510524_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515281.1|510523_511552_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.1	3.8e-21
WP_099515282.1|511548_512529_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.4	1.8e-12
WP_099515283.1|512549_513422_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515284.1|513429_514395_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515285.1|514485_516054_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515286.1|516101_516500_-	VOC family protein	NA	NA	NA	NA	NA
WP_099515287.1|516496_517876_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_099515288.1|517872_518532_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_099515289.1|518726_519434_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173909566.1|519960_520827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515291.1|522277_523759_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_099515292.1|523787_524462_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_099515293.1|524461_525136_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_173909573.1|525145_525871_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.1	4.2e-06
WP_099515656.1|525912_526764_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515295.1|526899_527826_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515296.1|527945_529067_+	DUF917 family protein	NA	NA	NA	NA	NA
WP_099515297.1|529179_530529_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_099515657.1|530534_531779_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_099515298.1|531783_532455_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_099515299.1|532451_533141_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_099515300.1|533137_534562_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_099515301.1|534575_535502_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_099515302.1|535501_536287_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_157934671.1|536773_537970_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_173909574.1|537980_538841_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	28.1	5.5e-21
WP_157934672.1|539184_540309_-	hypothetical protein	NA	K4JS89	Caulobacter_virus	34.1	4.2e-05
WP_099515304.1|542085_543417_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	6.5e-29
WP_157934635.1|544990_545848_+	glutaredoxin 3	NA	I1TRQ4	Cronobacter_phage	43.8	1.9e-05
WP_157934636.1|546425_547181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099514078.1|547354_548608_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	36.5	4.6e-45
WP_099514429.1|548604_549477_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.2	2.1e-52
WP_099515306.1|549964_550828_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	33.0	7.6e-31
WP_175608902.1|551623_551902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515660.1|553985_555005_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	41.5	2.0e-70
WP_099515308.1|555061_555427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515309.1|555423_555831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515310.1|556062_556380_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_099515311.1|556483_557485_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157934170.1|557881_558700_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157934169.1|558660_558984_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099515312.1|559440_560007_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_099514570.1|560839_562135_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
563903:563918	attR	AAGCCGTCCATCGTGG	NA	NA	NA	NA
>prophage 7
NZ_CP016619	Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence	977332	571218	635336	977332	transposase	Planktothrix_phage(30.0%)	60	NA	NA
WP_099515323.1|571218_571929_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099515324.1|572348_573767_-	amidohydrolase	NA	NA	NA	NA	NA
WP_099515325.1|573816_574686_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099515326.1|574682_575687_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.0	7.3e-17
WP_099515327.1|575683_576667_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.2e-18
WP_099515328.1|576666_577578_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515329.1|577574_578552_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515330.1|578590_580201_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515331.1|580302_581175_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515332.1|581684_582077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515333.1|582243_582741_-	RidA family protein	NA	NA	NA	NA	NA
WP_099515661.1|582785_583193_-	cytochrome c	NA	NA	NA	NA	NA
WP_099515334.1|583264_584866_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_157934638.1|585073_586477_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_162299273.1|586715_587042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515337.1|587210_588224_+	cadherin-like domain-containing protein	NA	NA	NA	NA	NA
WP_157934640.1|588147_590490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515339.1|590635_591025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934641.1|591937_592654_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515341.1|592687_594190_+	peptide ABC transporter	NA	NA	NA	NA	NA
WP_099515342.1|594209_595139_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515343.1|595135_596002_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515344.1|596009_596801_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.8	4.5e-22
WP_099515345.1|596812_597706_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_173909567.1|597705_599262_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_099515347.1|599251_600250_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.3	9.2e-12
WP_099515348.1|600246_601233_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.0	6.5e-18
WP_099515349.1|601264_601666_+	RidA family protein	NA	NA	NA	NA	NA
WP_099515350.1|602095_602338_+	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_099515253.1|602502_603271_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099515351.1|603679_604387_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_099515352.1|604386_605112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515353.1|605509_606276_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099515354.1|606432_609165_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_099515355.1|609564_609888_-	cytochrome c	NA	NA	NA	NA	NA
WP_099515357.1|610331_610838_+	DUF2267 domain-containing protein	NA	NA	NA	NA	NA
WP_099515358.1|610970_611417_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_099515359.1|611550_611841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515360.1|611945_612686_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	35.3	2.3e-12
WP_099515361.1|612706_612952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162299274.1|614508_614661_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162299275.1|614608_615046_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.3	7.3e-06
WP_099515363.1|615086_615746_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_099515662.1|615795_616650_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_157934642.1|616818_617112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515365.1|617313_618252_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_099515663.1|618850_619318_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_099515664.1|619467_620895_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_099515665.1|621347_621671_-	cytosolic protein	NA	NA	NA	NA	NA
WP_099515366.1|621738_622209_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_099515367.1|622381_623218_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	28.5	1.8e-05
WP_099515368.1|623396_624227_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_175608903.1|625232_626045_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099515667.1|626072_626315_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_099515369.1|626412_627024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515370.1|627265_629968_+	DEAD/DEAH box helicase	NA	A0A2I7MM20	Spilosoma_obliqua_nucleopolyhedrosis_virus	29.1	1.1e-38
WP_157934643.1|629973_631059_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_099515371.1|631163_631601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515372.1|632099_633431_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	6.5e-29
WP_099508077.1|634049_635336_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP016619	Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence	977332	652291	718577	977332	transposase,protease	Pseudomonas_phage(14.29%)	59	NA	NA
WP_099515385.1|652291_653305_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099515386.1|653872_655762_+	sensor histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	25.4	6.8e-08
WP_099515387.1|656088_656655_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162299276.1|656880_658056_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_099515389.1|658849_660355_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_099515390.1|660354_661026_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_099515391.1|661149_662205_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_099515392.1|662296_663142_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_099515393.1|663166_663586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515394.1|663596_665426_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_099515395.1|665422_667513_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_099515396.1|667584_668178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515397.1|668424_669372_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_099515398.1|669604_670522_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099508287.1|671531_672299_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.0	2.0e-43
WP_157933989.1|672295_673783_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099513495.1|674074_674464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175608904.1|674761_675364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934646.1|676015_676225_+	cytochrome c	NA	NA	NA	NA	NA
WP_157934647.1|676184_676817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934648.1|676947_678705_+	adenylate cyclase	NA	NA	NA	NA	NA
WP_099515401.1|678783_679764_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_099515402.1|679991_681722_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_157934649.1|681785_682139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515404.1|682223_682976_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_157934650.1|683177_683342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099511749.1|683602_684889_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_099515406.1|685431_685674_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_099515407.1|686154_686361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515408.1|687178_688744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515409.1|689879_690512_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099515410.1|691607_691892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515411.1|692039_692810_-	porin family protein	NA	Q94M22	Bartonella_quintana_phage	32.4	2.8e-08
WP_099515668.1|693986_696152_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	44.2	5.9e-80
WP_099515413.1|696569_697010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515414.1|697363_697981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515669.1|698243_699095_+	transglycosylase SLT domain-containing protein	NA	A0A0K2CNS6	Brevibacillus_phage	28.6	2.4e-05
WP_099515415.1|699361_700051_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_099515416.1|701136_701643_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_099515417.1|702186_703374_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_099515418.1|703541_703760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515419.1|704132_705164_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_099515420.1|705271_705499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515421.1|705742_706408_-	ParA family protein	NA	A2I303	Vibrio_virus	26.6	6.5e-14
WP_099515422.1|706737_708033_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_157934629.1|708186_708573_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_099515247.1|708900_709170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515248.1|709297_709501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515249.1|709657_709906_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099515654.1|710135_710957_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_036349065.1|712622_712826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515423.1|713009_713828_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_099515424.1|713875_714145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515425.1|714283_714496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515426.1|714595_714805_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	52.9	3.0e-10
WP_157934651.1|715224_715407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934652.1|715741_716593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515428.1|716638_716986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515429.1|717278_718577_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP016618	Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence	712299	11322	65314	712299	transposase,integrase	Bacillus_virus(25.0%)	51	9581:9596	38871:38886
9581:9596	attL	CTTCCGTGACCGAGGC	NA	NA	NA	NA
WP_162299257.1|11322_12354_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157934499.1|13393_13558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514846.1|14476_14686_-	DUF2165 family protein	NA	NA	NA	NA	NA
WP_099514847.1|15412_15910_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	33.3	2.9e-06
WP_099514848.1|16041_17475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514343.1|17558_17897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514344.1|18157_18316_+	DUF1127 domain-containing protein	NA	A0A0F6YPC3	Sinorhizobium_phage	59.0	6.5e-05
WP_099514345.1|18574_19906_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	3.7e-77
WP_099514346.1|19976_20441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514347.1|20655_20850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514348.1|20935_21319_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099514349.1|21638_22574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514351.1|23449_23659_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	52.9	8.9e-10
WP_099514353.1|24150_24441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514354.1|24944_25199_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_099514355.1|25211_25901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934500.1|27649_27841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934501.1|28260_28479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514358.1|30429_31785_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099514359.1|31958_32588_+	LysE family translocator	NA	NA	NA	NA	NA
WP_157934502.1|32642_32789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514361.1|33307_34153_-	metal-dependent phosphohydrolase	NA	A0A2I2L3U5	Orpheovirus	36.9	1.5e-47
WP_157934503.1|34245_35220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514363.1|35453_36209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514364.1|36690_37377_+	transglutaminase-like cysteine peptidase	NA	V9QJI1	Rhizobium_phage	35.3	9.4e-16
WP_099514365.1|37582_37798_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_157934504.1|37962_38121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514366.1|38406_38712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934505.1|39148_39577_+	hypothetical protein	NA	NA	NA	NA	NA
38871:38886	attR	CTTCCGTGACCGAGGC	NA	NA	NA	NA
WP_099514368.1|39646_40672_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099514369.1|42592_43903_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099513293.1|44047_45034_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099514370.1|45224_46490_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_099513491.1|46764_48117_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099514203.1|48271_49540_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_099514371.1|49636_50056_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514372.1|50333_51734_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_157934506.1|52026_53004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514374.1|53379_54441_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_099514375.1|54637_54871_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_099513884.1|54836_56183_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157934446.1|56245_56524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514849.1|56494_57355_-	quinone oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.4	7.2e-05
WP_099514376.1|57735_57984_-	DUF3422 family protein	NA	NA	NA	NA	NA
WP_099514377.1|58344_59355_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	2.0e-22
WP_099514378.1|59396_60680_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_099514850.1|60753_61632_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099514379.1|61636_62539_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099514380.1|62543_63275_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_099514381.1|63435_64137_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099514147.1|64264_65314_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016618	Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence	712299	88723	126278	712299	transposase,integrase	Escherichia_phage(33.33%)	32	96290:96306	138146:138162
WP_099514399.1|88723_89476_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	2.2e-18
WP_099514400.1|89598_90618_+	hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	31.6	8.5e-21
WP_099514401.1|90686_91385_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	54.7	1.8e-62
WP_099514402.1|91567_92803_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.6	1.9e-91
WP_157934511.1|92864_94298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514343.1|94381_94720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514344.1|94980_95139_+	DUF1127 domain-containing protein	NA	A0A0F6YPC3	Sinorhizobium_phage	59.0	6.5e-05
WP_099514345.1|95397_96729_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	3.7e-77
96290:96306	attL	TCGCCGACAACACGGCC	NA	NA	NA	NA
WP_099514346.1|96799_97264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514405.1|97763_98123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514406.1|98544_99822_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_099514409.1|101039_101681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514410.1|102112_102373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514411.1|102561_102780_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_099514412.1|103480_103699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514413.1|103931_104552_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_099514414.1|104843_105044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514415.1|106966_107218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514416.1|107672_107936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514417.1|107932_108145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514852.1|108137_108383_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_099514419.1|109082_110639_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_099514420.1|110708_111932_-	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_099508077.1|112086_113373_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_099514421.1|113887_114106_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_099514423.1|115394_116801_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099514424.1|117116_117815_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	52.8	8.3e-60
WP_099514426.1|119245_119449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514428.1|121062_122085_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099514078.1|123399_124653_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	36.5	4.6e-45
WP_099514429.1|124649_125522_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.2	2.1e-52
WP_157934512.1|126155_126278_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
138146:138162	attR	GGCCGTGTTGTCGGCGA	NA	NA	NA	NA
>prophage 3
NZ_CP016618	Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence	712299	163275	218438	712299	transposase,integrase	Acinetobacter_phage(37.5%)	38	174654:174670	226839:226855
WP_099514456.1|163275_164232_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099514457.1|165308_166502_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	51.8	1.3e-108
WP_099514458.1|166501_167521_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	34.7	9.0e-47
WP_099514459.1|168438_169149_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099514461.1|169906_170170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514462.1|170473_170701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934516.1|171848_174965_+	AAA family ATPase	NA	NA	NA	NA	NA
174654:174670	attL	GCCATCAAGAGCGCAGA	NA	NA	NA	NA
WP_157934517.1|175090_175321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934518.1|175575_175812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514465.1|175950_177171_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_099514466.1|177167_178082_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_099514467.1|178158_178962_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_099514468.1|178974_181338_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_099514469.1|181474_181969_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.5	6.5e-19
WP_099514470.1|182145_182607_-	carbon monoxide dehydrogenase subunit G	NA	NA	NA	NA	NA
WP_099514471.1|182710_183172_-	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_099514855.1|183359_183683_+	XdhC/CoxI family protein	NA	NA	NA	NA	NA
WP_099514472.1|183688_184381_+	XdhC family protein	NA	NA	NA	NA	NA
WP_173909553.1|184377_185397_+	molybdopterin-binding protein	NA	NA	NA	NA	NA
WP_173909554.1|185393_185981_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_099514473.1|186250_188476_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	22.7	2.7e-19
WP_099514474.1|188481_189498_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_099514475.1|189494_190016_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	38.1	3.9e-22
WP_099514478.1|192094_193093_-	radical SAM protein	NA	NA	NA	NA	NA
WP_099514479.1|193259_196619_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	28.1	1.2e-15
WP_099514480.1|197375_197774_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_099514481.1|198207_198606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514483.1|198971_199670_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	55.6	1.2e-63
WP_099514484.1|199866_200274_-	DUF1236 domain-containing protein	NA	NA	NA	NA	NA
WP_099514485.1|200770_203101_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_157934519.1|203227_204607_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_099514487.1|204871_206644_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099514488.1|207244_207529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514489.1|207642_208143_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_099514492.1|209690_209960_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099514493.1|210213_210534_+	DUF2829 domain-containing protein	NA	A0A1X9HVT2	Ruegeria_phage	41.2	8.2e-15
WP_175608897.1|211624_211888_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099514495.1|217154_218438_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
226839:226855	attR	TCTGCGCTCTTGATGGC	NA	NA	NA	NA
>prophage 4
NZ_CP016618	Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence	712299	243009	292490	712299	transposase	Wolbachia_phage(22.22%)	38	NA	NA
WP_099508970.1|243009_244464_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.2	2.2e-59
WP_099514513.1|244673_245372_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	55.2	3.6e-63
WP_099514514.1|245393_245765_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099514515.1|246137_246434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099510511.1|246493_247036_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099510510.1|247032_247455_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099514516.1|248090_249821_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099514517.1|249855_251622_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_162299255.1|251763_253533_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099514520.1|254443_256207_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099514521.1|256203_257958_+	adenylate cyclase	NA	NA	NA	NA	NA
WP_099514522.1|259195_260221_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099508981.1|260334_261474_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099508982.1|261532_261811_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514523.1|262008_262407_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_099514524.1|262449_265821_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	24.9	1.5e-10
WP_157934521.1|266521_267733_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	35.9	1.8e-22
WP_157934522.1|268251_268617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934523.1|268855_269086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934524.1|269902_270568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934385.1|271339_272986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934525.1|273147_273321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514527.1|273604_274381_+	transglycosylase SLT domain-containing protein	NA	W6ARS2	Escherichia_phage	33.7	5.8e-06
WP_099514528.1|274456_275158_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099514529.1|275279_276329_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157934526.1|276813_277197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934527.1|277317_279390_+	hypothetical protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.6	2.6e-16
WP_099514533.1|279544_279739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514534.1|279784_280597_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.4	1.1e-23
WP_099514535.1|281015_281321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934528.1|281573_281732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514536.1|281896_282112_+	dodecin family protein	NA	NA	NA	NA	NA
WP_099514537.1|282189_282426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508970.1|282517_283972_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.2	2.2e-59
WP_099514538.1|284555_285200_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_099514539.1|287651_288362_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	36.7	4.8e-23
WP_099508092.1|288567_289608_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099513884.1|291143_292490_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP016618	Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence	712299	366932	417213	712299	transposase,integrase	Salmonella_phage(16.67%)	47	375929:375943	417922:417936
WP_099514595.1|366932_367990_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099514596.1|368927_369329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514597.1|369766_370117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934536.1|370546_371521_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_099514599.1|372824_373298_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_099514600.1|373372_374227_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_157934537.1|374709_375333_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
375929:375943	attL	CCCGGCAAAGCCCAG	NA	NA	NA	NA
WP_157934538.1|376567_376705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514603.1|378277_379246_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.4	8.5e-47
WP_099514604.1|379300_379909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514605.1|380351_380570_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099514863.1|380835_381813_-	agmatinase	NA	NA	NA	NA	NA
WP_099514606.1|382103_382973_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514607.1|383312_384125_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099514608.1|384114_384783_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_099514609.1|384779_385430_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_099514610.1|385811_386444_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_157934539.1|386942_387092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514613.1|387881_389210_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.0	2.3e-50
WP_099514614.1|389368_389734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514615.1|389893_390235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934540.1|390377_390605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175608899.1|390994_391237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514617.1|391501_391780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514618.1|392091_392418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514864.1|392673_393180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514620.1|394369_395173_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_099514621.1|395156_396188_-	DUF3182 family protein	NA	NA	NA	NA	NA
WP_157934541.1|396550_396799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514623.1|396890_398801_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	30.6	1.2e-63
WP_099514624.1|399471_401205_+	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	39.4	1.8e-95
WP_099509475.1|401191_402259_+|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	28.6	8.0e-06
WP_099514865.1|402627_403674_+	DUF4118 domain-containing protein	NA	NA	NA	NA	NA
WP_099514625.1|403610_404576_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_099514626.1|404553_405351_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	36.6	3.7e-32
WP_157934542.1|405969_406254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514866.1|406348_406972_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_157934266.1|407349_407523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934543.1|407855_408173_+	antA/AntB antirepressor family protein	NA	NA	NA	NA	NA
WP_099514629.1|408635_409934_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_099514630.1|410010_410421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514631.1|410616_410835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514633.1|411372_412380_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099514634.1|414629_415046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514635.1|415238_416150_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_099514636.1|416212_416593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514867.1|416895_417213_-|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
417922:417936	attR	CTGGGCTTTGCCGGG	NA	NA	NA	NA
>prophage 7
NZ_CP016618	Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence	712299	604618	663860	712299	transposase	Chrysochromulina_ericina_virus(16.67%)	48	NA	NA
WP_099514779.1|604618_605683_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099514780.1|605806_606508_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099514781.1|607299_608076_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_099514879.1|608114_608900_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	32.4	1.5e-22
WP_099514782.1|609221_610193_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_157934562.1|610214_610376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514880.1|610641_611694_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_099514783.1|611736_613542_-	DUF1446 domain-containing protein	NA	NA	NA	NA	NA
WP_099514784.1|613526_614291_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_099514785.1|614287_615535_-	CoA transferase	NA	NA	NA	NA	NA
WP_099514786.1|615659_616196_-	2,4'-dihydroxyacetophenone dioxygenase family protein	NA	NA	NA	NA	NA
WP_099514787.1|616192_616963_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_099514788.1|617007_617286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514789.1|617193_618018_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514790.1|618366_618573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934573.1|618593_618821_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_099514778.1|618945_619692_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_099514791.1|619913_621674_-	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099514792.1|621691_623986_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_099514793.1|623985_625110_-	thiolase family protein	NA	NA	NA	NA	NA
WP_173909561.1|625387_625969_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099509422.1|626110_626860_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_099514795.1|626872_627829_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_099514796.1|628060_629629_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_099514797.1|629639_631070_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_099514881.1|631149_632175_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_099514798.1|632241_632571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514799.1|632794_633067_-	DUF2312 domain-containing protein	NA	A0A0F6R615	Sinorhizobium_phage	47.2	7.7e-14
WP_099513509.1|633525_634356_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099514800.1|634712_634895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162299258.1|636766_637900_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_099514802.1|638101_639097_-	phasin family protein	NA	NA	NA	NA	NA
WP_157933989.1|639946_641434_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099508287.1|641430_642198_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.0	2.0e-43
WP_099514804.1|642348_643209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514443.1|645351_647571_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_099514444.1|647574_648525_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_099514882.1|648521_649157_-	aldehyde dehydrogenase iron-sulfur subunit	NA	A0A0P0IVM8	Acinetobacter_phage	32.5	1.9e-15
WP_099514522.1|649954_650980_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099514805.1|651592_654403_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.5	2.5e-78
WP_099514806.1|654600_655626_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099514807.1|656040_656718_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	6.2e-28
WP_099514883.1|656710_659263_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099514808.1|659262_660339_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_157934563.1|660502_660658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934564.1|662229_662517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934565.1|662510_662816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099514811.1|663026_663860_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP016620	Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence	593709	9137	74949	593709	transposase	Lactococcus_phage(18.18%)	59	NA	NA
WP_157933989.1|9137_10625_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099508287.1|10621_11389_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.0	2.0e-43
WP_099515704.1|11619_12060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515705.1|12873_13767_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515706.1|13854_15201_+	DUF1446 domain-containing protein	NA	NA	NA	NA	NA
WP_099515707.1|15202_15547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515708.1|15572_16544_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_099515709.1|16583_18632_+	D-(-)-3-hydroxybutyrate oligomer hydrolase	NA	NA	NA	NA	NA
WP_099515710.1|18932_19955_-	DUF2279 domain-containing protein	NA	NA	NA	NA	NA
WP_099515711.1|20281_22015_-	recombinase family protein	NA	E9P5U5	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	37.4	2.0e-94
WP_099514215.1|22007_22205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515712.1|24358_24949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515713.1|25201_25600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515714.1|26790_27888_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_099515715.1|28182_29466_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_099516115.1|29685_29901_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_157933989.1|30019_31507_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099508287.1|31503_32271_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.0	2.0e-43
WP_157934676.1|32535_34230_+	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099515717.1|34568_35549_+	quinone oxidoreductase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	9.6e-06
WP_099515718.1|35933_36233_+	DUF3303 family protein	NA	NA	NA	NA	NA
WP_157934677.1|36519_36687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515719.1|36721_37012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934678.1|37159_37810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516116.1|38094_39042_+	DUF1612 domain-containing protein	NA	NA	NA	NA	NA
WP_157934679.1|39776_40217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515721.1|42861_43524_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_099515722.1|43520_44546_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_099515723.1|44637_46272_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_099515724.1|46343_47762_+	DUF1254 domain-containing protein	NA	M1H738	Paramecium_bursaria_Chlorella_virus	39.4	4.3e-79
WP_099515725.1|48041_49373_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	1.7e-29
WP_099516117.1|50034_50484_+	DUF3597 domain-containing protein	NA	NA	NA	NA	NA
WP_099515726.1|50601_51252_-	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	41.0	7.0e-45
WP_099515727.1|51536_52664_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_157934680.1|52762_52969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934681.1|53164_53971_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	2.9e-16
WP_099515729.1|54003_54939_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_157934682.1|55209_55827_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157934683.1|55828_56338_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_099515732.1|56392_57085_+	NnrU family protein	NA	NA	NA	NA	NA
WP_099515733.1|57088_57529_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_099515734.1|57617_58010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515735.1|58399_59758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515736.1|59796_60612_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_099515737.1|60608_61223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934684.1|61480_62554_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_099516118.1|62657_63356_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.5	9.8e-45
WP_099515739.1|63626_65582_+	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_099516119.1|65682_66054_+	response regulator	NA	NA	NA	NA	NA
WP_157934685.1|66628_66850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099516120.1|67068_67566_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099515741.1|67633_68032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515742.1|69568_70351_+	maleate cis-trans isomerase	NA	NA	NA	NA	NA
WP_099514582.1|70557_70764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934534.1|70797_70965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515743.1|71186_71435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515744.1|71554_71875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508970.1|72442_73897_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.2	2.2e-59
WP_099515745.1|74238_74949_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	37.6	2.2e-28
>prophage 2
NZ_CP016620	Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence	593709	84648	137247	593709	transposase	Escherichia_phage(30.0%)	46	NA	NA
WP_099515756.1|84648_85359_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099515757.1|85739_86147_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_173909578.1|86175_86880_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_099515758.1|87400_88387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515759.1|88489_89572_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_099515760.1|89641_90718_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_099515761.1|91268_92363_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_099515762.1|92670_92925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515763.1|92985_93876_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515764.1|94513_94816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515765.1|95008_95707_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	54.3	3.0e-62
WP_162299285.1|95825_97556_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.3	4.8e-08
WP_099515767.1|98148_98784_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_099516124.1|99690_100617_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_099515768.1|100639_101572_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_099515769.1|101592_104109_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.0	7.2e-13
WP_099515770.1|104114_104990_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_099515771.1|105116_106367_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515772.1|106441_107167_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515773.1|107257_108034_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	34.1	1.1e-09
WP_099515774.1|108114_108813_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	54.7	8.0e-63
WP_157934689.1|109704_109860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099516125.1|110467_112270_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_099515775.1|112393_115846_-	response regulator	NA	B5LWN8	Feldmannia_species_virus	32.1	1.2e-05
WP_099515776.1|116191_116383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934690.1|116521_116827_+	response regulator	NA	NA	NA	NA	NA
WP_099515778.1|116826_117222_+	response regulator	NA	NA	NA	NA	NA
WP_099515779.1|117250_117550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515780.1|117598_117805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934691.1|117891_118047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515781.1|118079_118778_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	53.9	3.0e-62
WP_099515782.1|120019_120571_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_099516126.1|120814_122314_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515783.1|123171_124302_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_099515784.1|124301_125345_-	SIS domain-containing protein	NA	M1I1B8	Acanthocystis_turfacea_Chlorella_virus	29.1	1.4e-18
WP_099515785.1|125384_126998_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_099515786.1|126994_128038_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_099515787.1|128034_129006_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_099516127.1|129133_129856_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099515788.1|129868_131452_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515789.1|131528_132488_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515790.1|132490_133372_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515791.1|133392_134310_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_099515792.1|134314_135325_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	7.4e-09
WP_099515793.1|135327_136296_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	8.6e-23
WP_099515794.1|136536_137247_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP016620	Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence	593709	201154	330282	593709	protease,transposase,terminase,integrase	Escherichia_phage(15.0%)	110	283469:283528	337175:338231
WP_099515839.1|201154_201856_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099515841.1|202603_203098_+	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_099515842.1|203094_204060_+	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_099515843.1|204167_204443_+	response regulator	NA	NA	NA	NA	NA
WP_099516134.1|206173_207184_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_157934703.1|207345_207522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515845.1|207588_207840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934704.1|208347_208821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515848.1|209277_209463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515849.1|209491_210166_+	GTP cyclohydrolase I	NA	A0A1C3NFQ1	Phage_NCTB	40.4	5.7e-42
WP_099516135.1|210220_210670_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_099509797.1|210728_211118_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_173909580.1|211623_212418_-	DUF1194 domain-containing protein	NA	NA	NA	NA	NA
WP_099515850.1|212454_213447_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_173909493.1|213469_213697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515851.1|214012_214192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515852.1|214315_215998_+	histidine kinase	NA	NA	NA	NA	NA
WP_099515853.1|218162_218345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515854.1|218493_218751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934705.1|218821_219040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515856.1|219398_219644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515859.1|222827_224321_-	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_099515860.1|224466_225354_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099515861.1|225482_226730_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515862.1|226827_227715_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_099515863.1|227722_228538_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_099515864.1|228557_229874_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	22.1	1.4e-15
WP_099515865.1|229961_230954_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_099516137.1|231067_232987_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_099515866.1|233012_235181_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_099515867.1|235278_236322_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.3	1.9e-12
WP_162299287.1|236318_237794_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	23.4	9.4e-13
WP_099515869.1|237928_239245_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_099515870.1|239344_240370_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_099515871.1|240366_241221_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_162299288.1|241306_243961_+	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_099515873.1|243972_244938_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	27.7	5.6e-14
WP_099515874.1|245398_247075_-	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	39.4	7.7e-96
WP_099515875.1|248181_248880_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.0	3.2e-64
WP_099515876.1|249542_250460_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099516138.1|250668_251622_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099515877.1|251618_252383_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.1e-17
WP_099515878.1|252461_253379_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515879.1|253548_254259_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099515880.1|254408_255395_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099515881.1|255443_256424_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099515882.1|256662_257406_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	6.0e-16
WP_099515883.1|257438_258437_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157934707.1|258667_258961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099515885.1|259787_260498_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_099515886.1|260533_261337_-	universal stress protein	NA	NA	NA	NA	NA
WP_099513339.1|262075_262255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515887.1|262241_264314_+	recombinase family protein	NA	NA	NA	NA	NA
WP_099515888.1|264638_264893_-	hypothetical protein	NA	A0A2I7RHB5	Vibrio_phage	53.5	5.7e-11
WP_157934708.1|264885_265257_-|terminase	terminase small subunit	terminase	A0A088C409	Shewanella_sp._phage	45.3	1.2e-17
WP_099515890.1|267134_267903_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099515891.1|268179_268941_-	transglycosylase SLT domain-containing protein	NA	W6ARS2	Escherichia_phage	33.7	5.7e-06
WP_157934709.1|270667_270844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934383.1|271484_271901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515893.1|271961_272228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513402.1|272262_272502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515894.1|272515_272881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515895.1|273810_274488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516139.1|274609_274873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934710.1|274889_275150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515897.1|275577_276267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515898.1|276288_276495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515899.1|277502_277760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516140.1|277900_279160_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_099516141.1|279436_280480_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_099515900.1|280601_280814_+	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_099515901.1|280935_281292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515902.1|281527_281851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515904.1|282741_282990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934712.1|283269_283488_+	hypothetical protein	NA	NA	NA	NA	NA
283469:283528	attL	CTAGAGCATCGGACGGTTAAACGGACGCATATCCGGCAGCCTTAAGGTAGTTCCAGCACT	NA	NA	NA	NA
WP_099515905.1|284895_285771_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_099515906.1|285767_287366_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_099515907.1|287375_288374_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_099515908.1|288532_289513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515910.1|291279_291447_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_099515911.1|291852_293454_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515912.1|293476_294457_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157934713.1|296018_296654_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157934714.1|296706_298137_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099516142.1|298139_299792_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.6e-16
WP_099515915.1|299820_300165_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_157934715.1|301180_301627_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.3	3.8e-10
WP_099516143.1|301887_302532_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.7	1.4e-37
WP_099515917.1|303921_305187_+	porin	NA	NA	NA	NA	NA
WP_157934716.1|305219_305795_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157934717.1|306128_306563_+	VanZ family protein	NA	NA	NA	NA	NA
WP_157934718.1|307721_307994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515921.1|308262_309594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515922.1|309642_310014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515923.1|310677_311631_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K7N4	Mycobacterium_phage	26.2	1.9e-14
WP_099513993.1|311816_313004_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J790	uncultured_Caudovirales_phage	28.5	1.9e-08
WP_157934460.1|312994_315301_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099513992.1|315275_315662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934719.1|316079_316805_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_099515924.1|316801_317389_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_099510067.1|320118_320778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099512825.1|320823_322179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157934720.1|323133_324087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515926.1|324425_324710_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	43.9	2.7e-09
WP_157934721.1|325054_325996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515928.1|326103_326322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099508288.1|326467_328006_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.5	9.5e-117
WP_099508289.1|328019_328766_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.0	5.7e-59
WP_099515929.1|328816_329251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515930.1|329247_330282_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	NA	NA	NA	NA
337175:338231	attR	AGTGCTGGAACTACCTTAAGGCTGCCGGATATGCGTCCGTTTAACCGTCCGATGCTCTAGGCTTAGGAGTGAGACCTCTCCTAGCGAGCATTTCAATGCGCATTGTCACCGCCGTCGCCGTACTTGTACTCGCACTTGCTTCTCACGCTGCTCAGGCCCAAGGACAGGCGACAAAGGGGGCGGCAAATGGCTCCGTAGCTGCAAAGACGTTCAGCCCCGAAGAGGGCGCTGCCATGGCCGAGGCCCAACGCAAGAAGTCGGAAGCGCTGGAACGCACTCGCGACGAGAAGCTGAAAAGGACAACGAAGAGTATCTGTGTCGGCTGCTGACCGCTCTCTGGCAGCAAGTCGAGAAGGAACTGGCCAAGAGGTTTGCGCCTATTGCAGCTTGCGGCGAGCGAGAAAGAATTACCTCGGGCGATACCATTGCTGAACCTCCTGGGACAGGACAGAATTCCGCTCCAGTCCAATGCAGGTGATGTCATGCAGGCCGTATTTATCGCCTCCCTTTTTGTCAGCGTGACCCTAACCACCTTCATGCTGGCCGTCAGTCTGACGAATCTCGTAGGGCCGATGCTCGGCCTGACGGTCCACTAAAGCGCTTTTGATCTGGACTTGAATCGCTTCGGGTGGTCTGTGCGTTGACTGGGATATGGCCCGGGAGGCAAACCATGCCCCAGCCCTATTCTCCTGATCTGCGTGAGCGTGTTCTTGTCGCCTGTGCGCGTGGCGACCTTCCTCAGGTTGAGATTGCCCGCCGCTTCCAGGTCTGCCCCGCCACCGTCTCGAACTGGCGCCGCCAAGAGCGCGAGGAGGGCCGACGCTGTCCCAAGCCGCACAGCGGCGGCGTGCCCTCGCGCCTGGATGCAGCAGCTCTGGAGGTGCTGCGTCAGCTCGTGGCCGAAGACAATGACGCGCTGCTGCGCGAGTACCGCGAGCGCCTGGCCGAGCGAACGGGCGTGACGGTGTGTCTGGCGGTGATCTGCGAGGCGCTCAAGCGGCTCAAGCTGCGTCCGAAAAAAAGACCCTTCGGGCGGCCGAGCAGGAGCGGCCCGAGA	NA	NA	NA	NA
>prophage 4
NZ_CP016620	Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence	593709	367129	439611	593709	transposase	Ochrobactrum_phage(18.18%)	57	NA	NA
WP_099515955.1|367129_368164_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099515956.1|368407_369526_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_099515957.1|369718_370375_-	glyoxalase	NA	NA	NA	NA	NA
WP_099515958.1|370426_370840_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_099515959.1|370961_372170_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_099515960.1|372319_373630_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_099515961.1|373890_374628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515962.1|374653_375946_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_099515963.1|376559_377072_+	response regulator	NA	NA	NA	NA	NA
WP_157934728.1|377146_377290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515964.1|377554_377989_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_099515965.1|378011_379106_-	calcium/proton exchanger	NA	NA	NA	NA	NA
WP_099514567.1|379345_380869_-	heme peroxidase	NA	NA	NA	NA	NA
WP_099515966.1|381544_382528_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099515967.1|382683_383703_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	37.8	7.8e-67
WP_099516147.1|383881_385303_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_099515968.1|385532_388904_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	29.3	6.3e-12
WP_162299290.1|389063_392345_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_099516148.1|392675_393623_-	DUF1612 domain-containing protein	NA	NA	NA	NA	NA
WP_099515970.1|394317_395379_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	34.4	4.5e-41
WP_099515971.1|395378_396599_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	58.1	4.0e-126
WP_099515972.1|397614_398970_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	4.6e-30
WP_099515973.1|399173_399458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515974.1|399454_399796_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_099515975.1|400066_400987_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	45.8	2.7e-26
WP_157934729.1|401035_401341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934730.1|401471_401861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515978.1|401847_402960_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_099515979.1|403285_405775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099515981.1|408049_409195_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_099515665.1|409590_409914_-	cytosolic protein	NA	NA	NA	NA	NA
WP_099515366.1|409981_410452_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_099515367.1|410624_411461_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	28.5	1.8e-05
WP_099515982.1|411639_412479_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_175608903.1|413484_414297_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099515667.1|414324_414567_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_099515369.1|414664_415276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099515983.1|415766_417866_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	29.3	5.8e-08
WP_099515984.1|418090_418732_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_099516149.1|419425_420124_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.6	1.1e-43
WP_099511788.1|420493_421263_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099515985.1|422048_422795_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_099513669.1|423473_424289_-	DUF1194 domain-containing protein	NA	NA	NA	NA	NA
WP_099513670.1|424325_425318_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_099515987.1|425342_425570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934732.1|426670_428044_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_099515989.1|429419_430574_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	3.9e-22
WP_099515990.1|430566_431502_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_099515991.1|431498_432335_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_173909581.1|432385_433651_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_099515992.1|433991_434690_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.5	8.3e-44
WP_099515993.1|434802_435003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934733.1|435100_435382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099516151.1|435504_436260_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_173909582.1|436600_436963_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_099515995.1|438265_438784_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_099515996.1|438900_439611_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016620	Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence	593709	445430	503318	593709	transposase,terminase	Escherichia_phage(18.18%)	51	NA	NA
WP_099516002.1|445430_446129_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	53.9	3.7e-60
WP_099516003.1|446210_446696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516005.1|447131_447617_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	44.3	1.6e-22
WP_099516006.1|448329_448836_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099516007.1|449064_449523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162299291.1|449677_450154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099516008.1|450624_451029_+	DoxX family protein	NA	NA	NA	NA	NA
WP_099516009.1|454134_454758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516010.1|455635_456031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516011.1|456396_456894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516012.1|458551_458896_-	integration host factor subunit beta	NA	Q2A099	Sodalis_phage	40.2	4.3e-09
WP_099516013.1|458996_459278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099516014.1|460203_460932_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.8e-50
WP_099516015.1|461236_461449_-|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	73.5	2.4e-18
WP_099516154.1|461909_462140_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_099516016.1|462837_463212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099516155.1|463952_465917_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.8	4.7e-36
WP_099516017.1|466571_468221_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.5	7.9e-170
WP_099509915.1|468264_468579_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	58.5	2.3e-22
WP_099516019.1|470656_471442_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_099516020.1|471534_471753_+	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_162299292.1|472028_472595_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099516022.1|472916_473633_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	49.3	1.6e-50
WP_099516156.1|473679_474246_+	VUT family protein	NA	A0A1P8DJD3	Virus_Rctr71	55.8	1.1e-38
WP_162299293.1|474409_475390_+	DMT family transporter	NA	NA	NA	NA	NA
WP_099516024.1|475922_476381_-	translation initiation factor 2	NA	NA	NA	NA	NA
WP_099516025.1|476760_477303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099513308.1|477526_478822_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_157934736.1|479134_479665_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_099516027.1|480503_480761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157934737.1|481133_481886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516029.1|481985_482330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157934738.1|482311_482461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099516030.1|484335_484707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162299295.1|485158_485428_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	46.1	1.0e-13
WP_099516032.1|486022_486481_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_099516033.1|487068_489966_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_099516034.1|490354_491500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516035.1|491865_492903_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099516036.1|493019_494012_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_099516037.1|494182_494860_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_099516157.1|494870_495152_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099516039.1|496039_496534_+	cytochrome c	NA	NA	NA	NA	NA
WP_099516040.1|496601_496880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516041.1|497015_497561_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_099516042.1|498303_498873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099514059.1|499649_500339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099516043.1|501010_501352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099516044.1|501462_501732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516045.1|501869_502148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516046.1|502325_503318_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
