The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	0	28464	4872840	tRNA	Salmonella_phage(50.0%)	23	NA	NA
WP_000823885.1|161_440_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|717_1302_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|1418_2510_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001394151.1|3278_6146_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001350505.1|6245_8165_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733715.1|8392_9463_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000059411.1|9473_10106_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001301101.1|10116_11535_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000841714.1|11854_13552_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_050481497.1|13630_14071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310727.1|14248_14503_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020169.1|14703_15438_+	flagellar brake protein YcgR	NA	NA	NA	NA	NA
WP_001301104.1|15439_16051_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051560.1|16150_17065_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340194.1|17159_18896_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197881.1|19281_20352_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266909.1|20361_21660_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190854.1|21989_23522_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|23573_24293_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|24513_26055_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|26200_26731_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457616.1|26776_28045_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|28044_28464_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 2
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	45171	48903	4872840		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332303.1|45171_45903_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_023486948.1|46123_46528_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|46580_46691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|47226_47550_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000444488.1|47652_48903_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
>prophage 3
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	52039	53410	4872840		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423743.1|52039_53410_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.2e-108
>prophage 4
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	58431	60409	4872840		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531594.1|58431_59568_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|59551_60409_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 5
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	63666	67407	4872840		Vibrio_phage(50.0%)	4	NA	NA
WP_000952737.1|63666_64506_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
WP_000291270.1|64521_65433_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251348.1|65461_66706_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|66705_67407_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 6
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	74695	74953	4872840		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|74695_74953_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 7
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	87258	88901	4872840		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267959.1|87258_88263_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	8.4e-05
WP_001257000.1|88259_88901_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 8
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	92173	93355	4872840		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|92173_92410_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|92620_93355_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 9
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	105712	106654	4872840		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|105712_106654_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 10
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	122537	122783	4872840		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|122537_122783_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 11
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	127444	128365	4872840		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|127444_128365_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 12
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	137673	138207	4872840		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|137673_138207_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 13
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	142342	143176	4872840		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|142342_143176_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 14
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	148046	150608	4872840	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_099548311.1|148046_149208_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	6.8e-51
WP_000409872.1|149258_150608_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
>prophage 15
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	157427	158492	4872840		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|157427_158492_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 16
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	173130	175404	4872840		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028083.1|173130_173625_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001326838.1|173645_174974_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|175230_175404_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 17
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	179708	192023	4872840		Klosneuvirus(20.0%)	13	NA	NA
WP_000420621.1|179708_180629_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|180628_180934_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209894.1|181085_181685_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062110.1|181681_184228_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	2.0e-71
WP_023486820.1|184227_185400_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120125.1|185529_186222_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_023486819.1|186194_187223_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001300633.1|187305_190050_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_000829664.1|190121_191195_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|191243_191417_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|191406_191637_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|191611_191800_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|191810_192023_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 18
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	212065	212725	4872840	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|212065_212725_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 19
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	216958	219013	4872840		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|216958_219013_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 20
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	231612	233520	4872840		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|231612_233520_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 21
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	250216	261186	4872840	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090506.1|250216_250984_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193841.1|251026_253639_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001307697.1|253904_255107_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|255275_256676_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977902.1|257278_258367_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|258551_259742_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109486.1|259963_260611_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001529773.1|260637_261186_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 22
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	275891	280433	4872840		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|275891_277640_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|277676_279941_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|280148_280433_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 23
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	285519	286608	4872840		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|285519_286608_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 24
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	290706	293921	4872840		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|290706_292989_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|293180_293921_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 25
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	300229	376713	4872840	integrase,transposase,tRNA,protease	Escherichia_phage(14.29%)	56	355400:355415	384396:384411
WP_000213098.1|300229_300847_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|300857_303302_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|303540_304833_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067770.1|304923_306267_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.8e-80
WP_001295343.1|306277_306889_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077052.1|307043_311072_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|311206_311701_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|312245_313211_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043621.1|313333_315100_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202201.1|315100_316822_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241677.1|316863_317568_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|317852_318071_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001529751.1|318560_319403_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839253.1|319487_319685_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054233.1|319701_320190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854686.1|320186_320570_-	toxin	NA	NA	NA	NA	NA
WP_001285602.1|320650_321031_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000271247.1|321041_321419_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	41.1	2.0e-15
WP_001300563.1|321591_322704_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000692298.1|323092_323314_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|323376_323853_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214307.1|323868_324354_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001234726.1|324445_325264_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_001119717.1|325363_325597_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001531238.1|326205_328722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000820576.1|328842_331689_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069825.1|332061_332934_-	GTPase family protein	NA	NA	NA	NA	NA
WP_032178653.1|333149_334094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154670580.1|334556_334811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001431807.1|335092_335332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985465.1|335371_337810_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.4	1.9e-74
WP_000228013.1|337809_339144_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000312833.1|339156_339813_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000634203.1|339809_340877_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	39.2	1.4e-18
WP_000108735.1|340895_343991_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.2	3.9e-53
WP_001122107.1|343990_344707_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000422743.1|345025_345451_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|345447_345798_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_001295213.1|346324_347347_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_000952425.1|348309_349482_+|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.8	1.2e-215
WP_000544809.1|349481_350276_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_047647237.1|351381_352059_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_000624622.1|352058_352406_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|352425_353997_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_024167628.1|354607_354814_-	methyltransferase	NA	NA	NA	NA	NA
WP_000622487.1|354918_356355_-	hypothetical protein	NA	NA	NA	NA	NA
355400:355415	attL	CTGATACGCTGATTGA	NA	NA	NA	NA
WP_001333439.1|356351_361310_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000282077.1|361972_362536_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335702.1|363356_364790_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|365008_365206_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032161888.1|365432_365729_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000279872.1|369620_370823_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000934034.1|371519_373796_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
WP_000520781.1|373826_374147_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_001351689.1|374469_374694_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|374766_376713_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
384396:384411	attR	CTGATACGCTGATTGA	NA	NA	NA	NA
>prophage 26
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	386010	387729	4872840		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|386010_387729_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 27
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	391316	394054	4872840		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255167.1|391316_392147_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|392143_392467_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|392592_393108_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|393325_394054_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 28
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	397414	406564	4872840		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149756.1|397414_398542_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|398582_399071_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|399130_399976_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|399972_400926_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|400935_402069_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126073.1|402163_403276_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|403626_404103_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|404190_405093_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|405153_405876_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|405859_406147_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|406306_406564_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 29
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	415130	416333	4872840		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|415130_416333_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 30
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	427668	429540	4872840		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|427668_429540_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 31
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	432755	441097	4872840		Synechococcus_phage(33.33%)	6	NA	NA
WP_001336208.1|432755_433418_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
WP_001295295.1|433548_434448_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209342.1|434453_436886_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_000114272.1|437031_437847_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168797.1|437998_439264_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|439504_441097_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 32
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	446094	451319	4872840		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|446094_446610_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|446662_446728_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|446962_447850_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|448148_448652_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843877.1|449055_449802_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|449940_450600_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569083.1|450596_451319_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
>prophage 33
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	455003	469814	4872840		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|455003_455264_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430057.1|455528_457811_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|457852_458530_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|458603_458870_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|459134_459395_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|459623_460709_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|460849_461812_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|461839_463990_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145126.1|464109_464592_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_000007101.1|464822_466187_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|466415_467087_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|467089_468085_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|468077_469814_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 34
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	481188	482097	4872840		Streptococcus_phage(100.0%)	1	NA	NA
WP_099548324.1|481188_482097_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 35
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	488578	498993	4872840	lysis	Enterobacteria_phage(57.14%)	9	NA	NA
WP_001295303.1|488578_489868_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
WP_000767389.1|489926_490403_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000586337.1|491148_492480_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	3.2e-20
WP_001171282.1|492984_493947_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001393987.1|494254_496087_-	ParB N-terminal domain-containing protein	NA	A5LH43	Enterobacteria_phage	97.8	1.0e-274
WP_001393986.1|496224_497682_-	trk system potassium uptake protein trkG	NA	NA	NA	NA	NA
WP_001228696.1|497878_498064_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135263.1|498280_498778_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
WP_000839596.1|498777_498993_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
>prophage 36
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	503116	504590	4872840	integrase	Enterobacteria_phage(66.67%)	3	490494:490508	504664:504678
490494:490508	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000545741.1|503116_503284_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|503323_503542_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|503519_504590_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
504664:504678	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 37
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	514393	520967	4872840		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891692.1|514393_515452_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_000604034.1|515454_516144_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101984.1|516143_516917_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|517083_517233_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147447.1|517361_518150_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096870.1|518217_519690_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|519950_520967_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 38
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	525320	528840	4872840		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|525320_526373_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|526688_527069_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|527182_528124_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|528120_528840_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 39
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	565017	565809	4872840		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|565017_565809_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 40
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	569187	572237	4872840		Acinetobacter_phage(50.0%)	2	NA	NA
WP_047646894.1|569187_570669_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.0	5.5e-45
WP_000207120.1|570818_572237_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	1.8e-61
>prophage 41
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	583280	589261	4872840		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000087946.1|583280_585329_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_001300431.1|585337_585910_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001310640.1|585902_588587_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186076.1|588583_589261_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 42
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	597514	598279	4872840		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|597514_598279_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 43
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	602559	606438	4872840	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|602559_604224_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|604491_606438_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 44
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	611204	612869	4872840		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|611204_612869_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 45
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	616964	618044	4872840		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|616964_618044_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 46
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	623927	627460	4872840		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|623927_624653_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207520.1|624770_625706_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367904.1|625789_627460_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.4	2.6e-75
>prophage 47
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	635953	638536	4872840	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|635953_638536_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 48
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	645546	647985	4872840		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231430.1|645546_646635_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|646773_647985_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 49
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	652799	653446	4872840		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939737.1|652799_653183_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	8.9e-24
WP_000034825.1|653236_653446_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 50
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	668872	670987	4872840		Morganella_phage(50.0%)	2	NA	NA
WP_000278509.1|668872_669301_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|669421_670987_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 51
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	674170	675391	4872840		Streptococcus_phage(100.0%)	1	NA	NA
WP_000029821.1|674170_675391_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
>prophage 52
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	690539	696582	4872840		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|690539_691355_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096692.1|691351_692485_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_023486883.1|692700_696582_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 53
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	701561	750135	4872840	integrase,transposase,lysis,protease	Enterobacteria_phage(52.38%)	43	736340:736386	750149:750195
WP_001393886.1|701561_702674_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_023486852.1|702750_702903_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130653.1|703355_704474_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682524.1|704539_704788_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|704852_705221_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351484.1|705314_705968_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|706075_707323_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786320.1|707390_708767_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
WP_000573945.1|708868_712012_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|712023_713247_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|713262_713595_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000770953.1|715282_715966_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253838.1|715955_717404_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103232.1|718140_720042_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	3.3e-26
WP_001160804.1|720069_720531_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_001289021.1|720550_724804_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_071608736.1|724810_725068_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.9	1.4e-12
WP_000889443.1|725100_725361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300892.1|725486_725648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095033723.1|727601_728764_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000383906.1|729279_731391_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001355527.1|731503_734476_+	phage receptor	NA	NA	NA	NA	NA
WP_001224564.1|734476_735367_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_023486762.1|735549_736329_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
736340:736386	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_047647167.1|736809_737763_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001393528.1|738797_739538_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355602.1|740213_740507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235988.1|740517_741222_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
WP_000654156.1|741231_741513_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_001395371.1|741509_742202_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	41.8	1.1e-40
WP_000453611.1|742612_743158_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001415975.1|743546_743741_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|744100_744394_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|744484_744667_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|744883_745381_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|745380_745596_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737293.1|746184_747267_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	3.5e-166
WP_001204791.1|747456_747840_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001393963.1|747925_748066_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001099705.1|748062_748425_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000488419.1|748494_748773_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000446905.1|748744_749116_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|748971_750135_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
750149:750195	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 54
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	756468	759599	4872840	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|756468_757335_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|757336_757549_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|757656_758178_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|758213_759599_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 55
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	769812	770958	4872840		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|769812_770958_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 56
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	777148	778930	4872840		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001355653.1|777148_778930_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 57
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	785304	793112	4872840		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000014739.1|785304_789585_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000561872.1|790014_792429_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|792425_793112_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 58
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	796248	796926	4872840		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|796248_796926_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 59
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	801465	804627	4872840		uncultured_virus(50.0%)	2	NA	NA
WP_000083958.1|801465_803970_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
WP_000806442.1|804285_804627_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
>prophage 60
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	812871	821433	4872840		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801850.1|812871_813831_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	6.5e-15
WP_001250088.1|813827_814790_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|815025_815670_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|815850_817725_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|817834_818440_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|818439_818769_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122013.1|818821_820753_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|820881_821433_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 61
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	828441	831591	4872840		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|828441_831591_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 62
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	840427	843974	4872840		Bacillus_phage(100.0%)	2	NA	NA
WP_001256192.1|840427_842209_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	3.1e-42
WP_001235622.1|842201_843974_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 63
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	847297	847993	4872840		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|847297_847993_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 64
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	851121	856168	4872840	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|851121_851394_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|851602_853957_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|854144_855419_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|855544_856168_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 65
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	877727	886708	4872840	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|877727_878198_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150457.1|878286_879390_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_000543535.1|879393_879843_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001326929.1|879993_880533_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|880831_881716_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|881892_882240_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|882368_883340_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|883350_885198_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|885225_885558_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|885580_886708_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 66
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	893660	903635	4872840		Bacillus_phage(60.0%)	7	NA	NA
WP_000893623.1|893660_894956_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_000113933.1|895013_895703_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|895892_897095_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698951.1|897091_900238_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001393815.1|900363_901548_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219309.1|901690_902599_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|902723_903635_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 67
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	907924	909040	4872840		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|907924_909040_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 68
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	916455	917613	4872840		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830738.1|916455_917613_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 69
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	924563	925331	4872840		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|924563_925331_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 70
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	930628	931738	4872840		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|930628_931738_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 71
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	935119	937080	4872840		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013494.1|935119_936133_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	9.2e-44
WP_000044314.1|936129_937080_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 72
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	942490	946770	4872840		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805902.1|942490_943573_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177905.1|943695_946770_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.9	0.0e+00
>prophage 73
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	951310	952210	4872840		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|951310_952210_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 74
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	955408	957295	4872840		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010300.1|955408_957295_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
>prophage 75
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	966844	967894	4872840		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|966844_967894_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 76
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	979851	1047963	4872840	integrase,holin,tail,transposase	Shigella_phage(37.14%)	63	1028621:1028680	1044048:1044107
WP_000131066.1|979851_981885_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	4.4e-21
WP_001335745.1|982013_982601_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|982614_984087_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|984100_985771_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|985983_986652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|986894_987590_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023929.1|987582_989010_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|989020_989740_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339609.1|990266_991121_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|991346_992672_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|992780_993017_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|993028_993622_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621008.1|994211_995045_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|1001348_1001450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|1001813_1002077_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1002076_1002217_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147280.1|1002251_1002479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|1003301_1003844_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|1003918_1004506_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|1004563_1005232_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_023486803.1|1005257_1007783_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001355572.1|1007772_1009416_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|1009384_1010095_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|1010407_1010737_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070699.1|1012015_1012705_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|1012701_1013658_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667035.1|1013654_1015853_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.9e-38
WP_000121346.1|1015862_1016819_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|1016797_1017208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023486806.1|1017868_1018612_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355484.1|1019439_1020213_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000904963.1|1020306_1020825_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	86.0	1.8e-80
WP_001115577.1|1020854_1021349_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	94.1	1.3e-80
WP_000805537.1|1021348_1021942_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.7	1.5e-54
WP_000289819.1|1021913_1022342_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.0	3.1e-25
WP_000982542.1|1022343_1022679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000905042.1|1022705_1023260_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	4.8e-87
WP_000433377.1|1023782_1028237_+	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	1.1e-43
1028621:1028680	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAAG	NA	NA	NA	NA
WP_099548337.1|1029488_1031060_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	7.1e-168
WP_000624622.1|1031079_1031427_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001704819.1|1031426_1032104_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000210155.1|1032431_1032758_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_001355692.1|1032754_1033408_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_072146855.1|1033407_1033902_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	7.3e-87
WP_000104967.1|1033898_1034840_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_001250269.1|1034829_1035009_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|1035184_1035736_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|1035728_1035989_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|1036086_1036779_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|1037056_1037353_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000900401.1|1037656_1037875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952425.1|1037915_1039088_+|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.8	1.2e-215
WP_000544809.1|1039087_1039882_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000135680.1|1040082_1040445_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|1040510_1041335_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000008202.1|1041462_1041999_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242749.1|1041989_1042352_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206733.1|1042351_1042657_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_077873866.1|1042572_1043007_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_000051888.1|1042883_1044047_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	2.6e-228
WP_000893277.1|1044251_1045505_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	9.8e-96
1044048:1044107	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_099548340.1|1045516_1046620_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-61
WP_000749863.1|1046907_1047963_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 77
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1077085	1080043	4872840		Catovirus(50.0%)	2	NA	NA
WP_001143106.1|1077085_1079530_+	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.2	7.2e-34
WP_000859525.1|1079647_1080043_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
>prophage 78
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1094020	1097930	4872840		Clostridioides_phage(50.0%)	5	NA	NA
WP_001355630.1|1094020_1094794_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000729704.1|1094979_1095240_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001225679.1|1095667_1096408_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|1096378_1097146_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001355631.1|1097351_1097930_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.9e-14
>prophage 79
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1114887	1122519	4872840		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001340895.1|1114887_1115619_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|1115683_1116151_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|1116147_1116870_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052709.1|1116903_1117659_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1117730_1119089_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|1119136_1119760_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|1119763_1120564_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648571.1|1120804_1121719_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|1121715_1122519_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
>prophage 80
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1129030	1130062	4872840		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|1129030_1130062_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 81
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1143067	1147183	4872840		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|1143067_1146550_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569420.1|1146586_1147183_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	6.7e-26
>prophage 82
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1156011	1156770	4872840		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|1156011_1156770_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 83
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1168619	1170044	4872840	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|1168619_1170044_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 84
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1173973	1174318	4872840		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1173973_1174318_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 85
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1180352	1181150	4872840		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1180352_1181150_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 86
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1186291	1193097	4872840	tRNA	Niemeyer_virus(50.0%)	6	NA	NA
WP_001355667.1|1186291_1188721_-	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	30.3	2.5e-39
WP_001294687.1|1188794_1189325_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396037.1|1189339_1190044_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|1190221_1190677_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000937443.1|1190713_1191640_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|1191678_1193097_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 87
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1203267	1204200	4872840	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339914.1|1203267_1204200_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.8	8.4e-60
>prophage 88
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1207462	1213930	4872840		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|1207462_1208389_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|1208497_1209160_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|1209200_1209737_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001355666.1|1209942_1212333_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001189582.1|1212379_1213930_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 89
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1221675	1223100	4872840		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1221675_1223100_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 90
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1231736	1232288	4872840		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923727.1|1231736_1232288_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 91
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1236533	1237577	4872840		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217351.1|1236533_1237577_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	4.8e-104
>prophage 92
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1263557	1265282	4872840		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|1263557_1265282_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 93
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1277984	1278683	4872840		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916323.1|1277984_1278683_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 94
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1285015	1290438	4872840		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035644.1|1285015_1287367_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.0e-37
WP_001117011.1|1287531_1290438_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 95
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1298182	1300936	4872840		Microcystis_phage(50.0%)	5	NA	NA
WP_000257184.1|1298182_1299031_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_000796359.1|1299055_1299655_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_001248983.1|1299690_1300158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998540.1|1300256_1300436_-	antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|1300456_1300936_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 96
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1308831	1314503	4872840		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|1308831_1310346_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|1310376_1311519_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|1311658_1312876_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001297614.1|1312949_1314503_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
>prophage 97
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1319972	1321121	4872840		Halovirus(100.0%)	1	NA	NA
WP_001355532.1|1319972_1321121_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.5	1.7e-49
>prophage 98
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1325564	1328381	4872840	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286842.1|1325564_1328381_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	3.5e-77
>prophage 99
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1335423	1344045	4872840	transposase	Enterobacteria_phage(33.33%)	6	NA	NA
WP_000681368.1|1335423_1336590_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000952425.1|1337259_1338432_+|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.8	1.2e-215
WP_000544809.1|1338431_1339226_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000809168.1|1339305_1339458_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	78.0	1.6e-13
WP_001118475.1|1340909_1342040_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.3	7.9e-28
WP_000516135.1|1342128_1344045_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
>prophage 100
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1359738	1361852	4872840		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219614.1|1359738_1361163_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188659.1|1361162_1361852_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 101
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1365084	1370439	4872840		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|1365084_1367022_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|1367232_1368900_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|1369206_1370439_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 102
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1377182	1378505	4872840		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|1377182_1378505_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 103
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1384140	1387016	4872840		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|1384140_1384302_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001355597.1|1384428_1385034_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|1385426_1387016_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 104
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1394913	1396193	4872840		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|1394913_1395453_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|1395455_1396193_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 105
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1399415	1404783	4872840		Tupanvirus(50.0%)	4	NA	NA
WP_000106034.1|1399415_1400441_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091585.1|1400579_1401494_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410147.1|1401708_1403070_+	MFS transporter	NA	NA	NA	NA	NA
WP_023486886.1|1403118_1404783_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.3	3.6e-13
>prophage 106
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1437113	1437572	4872840	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_023486887.1|1437113_1437572_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	46.6	1.4e-12
>prophage 107
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1453595	1455056	4872840		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208195.1|1453595_1455056_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 108
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1465532	1467209	4872840		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|1465532_1466129_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|1466606_1467209_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 109
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1470571	1471552	4872840		Escherichia_phage(100.0%)	1	NA	NA
WP_000338799.1|1470571_1471552_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	55.0	1.6e-101
>prophage 110
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1475466	1496959	4872840	integrase,transposase,tRNA	Enterobacteria_phage(57.14%)	19	1471740:1471754	1502786:1502800
1471740:1471754	attL	ATTATTTCACTGCCA	NA	NA	NA	NA
WP_001355523.1|1475466_1476171_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	43.1	1.2e-42
WP_000783700.1|1476748_1479082_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
WP_000844963.1|1479096_1479417_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_024173160.1|1479413_1479641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459282.1|1479745_1480195_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.3e-45
WP_001133040.1|1480187_1480487_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	6.9e-32
WP_001355524.1|1480479_1481034_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.0	6.6e-36
WP_024171719.1|1481030_1481297_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	4.7e-24
WP_001317493.1|1482578_1483361_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001295213.1|1483357_1484380_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_000984214.1|1484607_1484850_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_000090076.1|1484866_1485442_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	51.9	2.3e-39
WP_001299662.1|1486672_1487692_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_001355687.1|1487821_1489324_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|1489442_1490525_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|1490524_1491625_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|1491891_1493403_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|1493660_1494104_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|1494103_1496959_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
1502786:1502800	attR	ATTATTTCACTGCCA	NA	NA	NA	NA
>prophage 111
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1506125	1512222	4872840		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|1506125_1507061_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|1507073_1507535_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|1507607_1507994_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|1508199_1510896_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|1511036_1511090_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|1511274_1512222_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 112
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1515860	1518622	4872840		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|1515860_1517999_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|1518157_1518622_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 113
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1522938	1529426	4872840		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|1522938_1523937_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|1523969_1524965_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001355584.1|1524951_1525974_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205790.1|1525987_1527490_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|1527629_1528586_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|1528895_1529426_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 114
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1568779	1569943	4872840		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|1568779_1569943_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 115
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1573875	1586906	4872840	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076345.1|1573875_1576317_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001177644.1|1576355_1576781_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1576985_1578284_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1578387_1578585_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1578666_1579671_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1579673_1580933_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|1581018_1582299_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|1582374_1582683_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|1582768_1583719_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122513.1|1583711_1585559_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
WP_000990333.1|1585568_1586906_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 116
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1590821	1591367	4872840		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|1590821_1591367_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 117
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1598794	1599772	4872840		Tupanvirus(100.0%)	1	NA	NA
WP_000004770.1|1598794_1599772_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
>prophage 118
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1604692	1605226	4872840		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|1604692_1605226_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 119
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1609732	1611716	4872840		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|1609732_1611379_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|1611422_1611716_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 120
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1625992	1629204	4872840	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|1625992_1627450_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295074.1|1627686_1629204_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 121
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1650405	1651908	4872840		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|1650405_1651908_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 122
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1657042	1657831	4872840		Cedratvirus(100.0%)	1	NA	NA
WP_001193408.1|1657042_1657831_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 123
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1663419	1664969	4872840		Bacillus_virus(50.0%)	2	NA	NA
WP_001075518.1|1663419_1664178_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
WP_000611395.1|1664288_1664969_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	4.9e-09
>prophage 124
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1675585	1677571	4872840		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001355612.1|1675585_1677571_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	1.6e-148
>prophage 125
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1682816	1684964	4872840		Escherichia_phage(100.0%)	1	NA	NA
WP_077635527.1|1682816_1684964_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	2.4e-33
>prophage 126
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1694699	1696658	4872840		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078209.1|1694699_1696658_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 127
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1702241	1703591	4872840		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|1702241_1703591_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 128
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1707408	1711021	4872840		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|1707408_1707945_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|1708198_1711021_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 129
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1715208	1717756	4872840		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|1715208_1716288_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|1716340_1717756_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 130
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1724351	1724960	4872840		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|1724351_1724960_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 131
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1734084	1735200	4872840		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|1734084_1735200_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 132
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1755262	1758946	4872840		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|1755262_1758946_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 133
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1774720	1776310	4872840		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|1774720_1776310_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 134
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1781672	1783436	4872840		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|1781672_1781945_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|1782131_1782722_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|1782764_1783436_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 135
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1792653	1800982	4872840		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|1792653_1796877_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|1796953_1800982_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 136
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1805098	1808151	4872840		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|1805098_1806283_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|1807200_1808151_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 137
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1816649	1818494	4872840		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|1816649_1818494_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 138
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1835840	1843087	4872840		Serratia_phage(33.33%)	5	NA	NA
WP_000184868.1|1835840_1838138_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|1838188_1838509_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004481.1|1838523_1839603_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185137.1|1839911_1842413_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424840.1|1842424_1843087_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 139
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1860385	1864888	4872840		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|1860385_1861717_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|1861783_1862710_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|1862802_1863288_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|1863372_1863618_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|1864042_1864888_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 140
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1876462	1881323	4872840		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|1876462_1877161_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|1877157_1878531_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|1878636_1879311_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|1879459_1880443_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000122641.1|1880702_1881323_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
>prophage 141
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1897087	1900138	4872840		Escherichia_phage(100.0%)	1	NA	NA
WP_077249888.1|1897087_1900138_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 142
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1907455	1910235	4872840		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|1907455_1908241_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621647.1|1908274_1909171_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718901.1|1909338_1910235_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 143
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1927342	1929813	4872840		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|1927342_1928392_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|1928403_1929813_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 144
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1933927	1936714	4872840		uncultured_virus(100.0%)	1	NA	NA
WP_000250007.1|1933927_1936714_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	2.2e-71
>prophage 145
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1950570	1951185	4872840		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|1950570_1951185_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 146
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1960066	1963353	4872840		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|1960066_1960843_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|1960845_1961361_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001351992.1|1961364_1961634_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|1961712_1963353_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 147
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1975885	1977715	4872840		Catovirus(100.0%)	1	NA	NA
WP_001395096.1|1975885_1977715_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 148
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1983419	1987278	4872840		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|1983419_1985582_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|1985665_1986382_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|1986381_1987278_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 149
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	1997575	1999231	4872840		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000406041.1|1997575_1999231_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.5	1.4e-44
>prophage 150
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2007315	2013459	4872840		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612043.1|2007315_2008446_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145183.1|2008450_2009125_-	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2009102_2009984_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226602.1|2010002_2011070_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
WP_000006621.1|2011069_2012332_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866670.1|2012328_2013459_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 151
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2017501	2022913	4872840		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2017501_2017831_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2017961_2019227_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001299253.1|2019360_2020845_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238884.1|2020891_2022913_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
>prophage 152
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2031386	2033033	4872840		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012608.1|2031386_2033033_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 153
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2046416	2052269	4872840		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|2046416_2047307_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|2047331_2048297_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|2048301_2049807_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_001301979.1|2049814_2050234_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102315.1|2050400_2052269_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.3e-64
>prophage 154
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2055437	2056430	4872840		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845113.1|2055437_2056430_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 155
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2068384	2075992	4872840		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_000933736.1|2068384_2069755_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334104.1|2069916_2071746_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000867146.1|2072059_2073100_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|2073186_2074146_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|2074145_2075036_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|2075218_2075992_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 156
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2087756	2089094	4872840		Moraxella_phage(100.0%)	1	NA	NA
WP_000019348.1|2087756_2089094_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 157
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2099292	2106661	4872840		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|2099292_2099550_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|2099513_2099873_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2099889_2100030_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|2100259_2100340_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|2100636_2102040_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|2102044_2103145_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|2103144_2104218_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|2104246_2106661_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 158
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2111367	2112516	4872840		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2111367_2112516_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 159
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2116943	2117357	4872840		Cyanophage(100.0%)	1	NA	NA
WP_001243437.1|2116943_2117357_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 160
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2124273	2130863	4872840	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001705161.1|2124273_2125482_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	1.3e-206
WP_000703959.1|2125651_2125999_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|2125988_2126351_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148061.1|2126347_2126845_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|2126852_2128037_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|2128316_2128406_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001300753.1|2128970_2129069_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168475.1|2129174_2130863_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
>prophage 161
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2138169	2139504	4872840		Moraxella_phage(100.0%)	1	NA	NA
WP_002431302.1|2138169_2139504_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	9.6e-65
>prophage 162
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2148977	2151151	4872840		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692307.1|2148977_2149199_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186774.1|2149261_2149738_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206659.1|2149752_2150238_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	9.0e-13
WP_001706654.1|2150329_2151151_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	6.1e-46
>prophage 163
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2171512	2174367	4872840	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_000956749.1|2171512_2172328_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	31.6	3.8e-08
WP_085947916.1|2173274_2174367_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.9e-51
>prophage 164
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2181095	2187507	4872840	integrase,transposase	Enterobacteria_phage(66.67%)	4	2173796:2173810	2196925:2196939
2173796:2173810	attL	TCCCGGAAGTTCAGC	NA	NA	NA	NA
WP_085947916.1|2181095_2182189_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.9e-51
WP_001682626.1|2183071_2183890_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000952335.1|2184314_2185709_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	97.7	9.9e-222
WP_001683391.1|2186325_2187507_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.2	1.1e-160
2196925:2196939	attR	GCTGAACTTCCGGGA	NA	NA	NA	NA
>prophage 165
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2193784	2195176	4872840		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2193784_2195176_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 166
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2199612	2223344	4872840	integrase	Morganella_phage(35.71%)	27	2198425:2198438	2227457:2227470
2198425:2198438	attL	GCGTGGCCTGCTTT	NA	NA	NA	NA
WP_000280488.1|2199612_2201721_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135054.1|2201739_2202015_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|2202069_2202693_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870036.1|2202950_2204633_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_000924289.1|2204629_2205247_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001300958.1|2205537_2206362_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
WP_000617440.1|2207058_2207346_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000230716.1|2207605_2208061_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	67.2	2.9e-45
WP_000678612.1|2208140_2208341_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
WP_001363070.1|2208825_2209221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729823.1|2209240_2211358_-	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	57.9	1.3e-169
WP_000246976.1|2211342_2212686_-	DNA transfer protein	NA	A0A0M5M1J8	Salmonella_phage	71.4	1.0e-159
WP_014639841.1|2212690_2212993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064134.1|2213467_2214205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000987941.1|2214194_2214425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355493.1|2214601_2216953_-	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.2	2.2e-72
WP_001058745.1|2216965_2217568_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.9	3.6e-27
WP_000181940.1|2217560_2217782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|2217778_2218042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|2218038_2218233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001419054.1|2218225_2219293_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	8.6e-16
WP_000476150.1|2219286_2219469_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001395037.1|2219461_2220295_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	48.3	1.8e-21
WP_000412532.1|2220307_2220739_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_024169704.1|2220738_2220957_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001059729.1|2221428_2222079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355495.1|2222075_2223344_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	2.3e-193
2227457:2227470	attR	GCGTGGCCTGCTTT	NA	NA	NA	NA
>prophage 167
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2226685	2231248	4872840		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|2226685_2227141_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|2227121_2228342_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|2228513_2229182_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|2229398_2229635_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|2229655_2229823_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|2229920_2230730_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171873.1|2230768_2231248_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 168
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2238686	2240780	4872840		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364795.1|2238686_2239712_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
WP_023486876.1|2239796_2240780_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 169
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2244179	2254907	4872840		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587760.1|2244179_2245112_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	6.5e-36
WP_001307464.1|2245399_2246272_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|2246546_2247743_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646007.1|2247752_2248778_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982115.1|2249016_2250051_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483847.1|2250037_2250997_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|2251000_2252284_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001350558.1|2252293_2253838_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|2254082_2254514_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|2254655_2254907_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 170
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2270931	2281080	4872840	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_001346013.1|2270931_2271765_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072850.1|2271917_2272760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086405449.1|2272780_2276914_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	9.3e-26
WP_000779792.1|2277141_2277750_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|2277847_2279239_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582468.1|2279235_2281080_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
>prophage 171
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2305354	2306896	4872840		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|2305354_2306896_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 172
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2312215	2313211	4872840		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|2312215_2313211_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 173
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2317048	2319050	4872840	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_085947770.1|2317048_2318418_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001135738.1|2318497_2318650_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|2318837_2319050_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 174
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2322704	2325038	4872840		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|2322704_2325038_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 175
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2335082	2337067	4872840		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|2335082_2336066_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107012.1|2336062_2337067_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 176
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2383028	2383676	4872840		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|2383028_2383676_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 177
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2387069	2389204	4872840		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|2387069_2387495_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|2387507_2388797_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|2388850_2389204_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 178
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2392549	2394592	4872840		Indivirus(100.0%)	1	NA	NA
WP_001355503.1|2392549_2394592_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	5.2e-46
>prophage 179
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2405389	2408125	4872840		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149154.1|2405389_2408125_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 180
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2411500	2417152	4872840		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000015198.1|2411500_2415736_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
WP_001190062.1|2415938_2416340_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173631.1|2416345_2417152_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
>prophage 181
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2425045	2429177	4872840		Dickeya_phage(50.0%)	4	NA	NA
WP_001100469.1|2425045_2425711_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|2425931_2426177_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106551.1|2426278_2428477_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000964718.1|2428550_2429177_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 182
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2432183	2435002	4872840		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|2432183_2432852_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|2432844_2433903_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|2434147_2435002_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 183
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2440736	2442219	4872840		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082098.1|2440736_2441504_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416900.1|2441505_2442219_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 184
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2445760	2447571	4872840		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907792.1|2445760_2446831_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073599.1|2446827_2447571_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
>prophage 185
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2467582	2470030	4872840		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|2467582_2470030_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 186
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2481691	2484085	4872840		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081908.1|2481691_2484085_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 187
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2490119	2490989	4872840		Sodalis_phage(100.0%)	1	NA	NA
WP_000039073.1|2490119_2490989_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	1.3e-67
>prophage 188
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2497552	2501319	4872840		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|2497552_2498272_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|2498268_2499621_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|2499696_2501319_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 189
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2518223	2519060	4872840		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2518223_2519060_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 190
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2543307	2552848	4872840		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|2543307_2543871_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963792.1|2543956_2545177_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|2545243_2547334_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|2547384_2548017_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|2548318_2548723_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|2548777_2549647_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|2549700_2549919_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|2549912_2550935_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|2550934_2552848_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 191
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2558418	2566977	4872840		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_001209680.1|2558418_2558805_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
WP_047646938.1|2558804_2559164_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.8	1.1e-10
WP_000903373.1|2559171_2559459_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|2559584_2559959_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|2560055_2560526_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|2560622_2562737_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|2562807_2563992_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000773156.1|2564283_2566977_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
>prophage 192
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2575808	2577761	4872840		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|2575808_2577761_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 193
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2598976	2600448	4872840	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004473.1|2598976_2599924_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|2599938_2600448_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 194
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2610952	2615106	4872840		Bacillus_virus(50.0%)	4	NA	NA
WP_000078349.1|2610952_2611711_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
WP_001355543.1|2611718_2612822_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023486890.1|2612831_2614013_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738568.1|2614080_2615106_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 195
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2621610	2622495	4872840		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258895.1|2621610_2622495_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 196
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2633060	2634104	4872840		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2633060_2634104_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 197
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2650878	2653403	4872840	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|2650878_2651946_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|2652035_2653403_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 198
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2657369	2657867	4872840	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|2657369_2657867_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 199
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2661571	2665941	4872840		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108459.1|2661571_2663062_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|2663109_2663799_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209011.1|2663795_2664671_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|2664667_2665132_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_072145225.1|2665191_2665941_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	3.1e-73
>prophage 200
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2673311	2688106	4872840		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|2673311_2674241_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|2674336_2676673_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001397829.1|2676902_2677556_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|2677552_2678281_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|2678277_2678910_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|2679123_2679396_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|2679392_2680247_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|2680292_2680784_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|2680901_2681189_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809057.1|2681211_2682645_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|2682692_2683418_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|2683424_2683982_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|2683950_2684526_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030010.1|2684522_2685089_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	9.4e-54
WP_001295557.1|2685109_2686096_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922901.1|2686109_2687087_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|2687296_2688106_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 201
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2692174	2693653	4872840		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|2692174_2692453_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|2692681_2693653_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 202
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2700427	2703300	4872840	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|2700427_2702362_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|2702451_2703300_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 203
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2707382	2714021	4872840		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|2707382_2708726_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|2709356_2709809_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|2709836_2711324_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|2711348_2714021_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 204
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2719502	2721392	4872840		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2719502_2721392_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 205
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2727094	2734888	4872840		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189333.1|2727094_2727397_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
WP_000449030.1|2727447_2727891_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|2727870_2728389_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001300423.1|2728516_2729152_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147571.1|2729224_2730265_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|2730378_2730954_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|2730963_2731554_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246830.1|2731573_2731969_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249107.1|2731926_2733963_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809262.1|2734027_2734888_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 206
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2757896	2759042	4872840		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|2757896_2759042_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 207
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2767135	2769430	4872840		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861743.1|2767135_2769430_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	3.3e-158
>prophage 208
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2790009	2790975	4872840		Escherichia_phage(100.0%)	1	NA	NA
WP_001098794.1|2790009_2790975_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	34.1	2.3e-36
>prophage 209
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2803629	2819825	4872840	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_099548365.1|2803629_2806722_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.6	9.4e-156
WP_000212475.1|2806905_2807889_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450594.1|2808107_2808440_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627220.1|2808481_2809972_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000094721.1|2810278_2811799_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000018003.1|2811952_2812576_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001066494.1|2812863_2813628_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|2813881_2814388_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437375.1|2814466_2816308_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|2816502_2818248_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|2818358_2818574_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264352.1|2818811_2819825_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 210
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2826134	2827373	4872840	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|2826134_2827373_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 211
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2832510	2833944	4872840		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2832510_2833944_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 212
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2840300	2851263	4872840		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|2840300_2840954_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|2841215_2841386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|2841443_2842217_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188362.1|2842332_2843148_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_047646954.1|2843185_2844346_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	4.5e-87
WP_000831543.1|2844351_2845023_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|2845170_2846652_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917138.1|2846856_2847486_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	4.1e-18
WP_000833393.1|2847486_2847909_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444752.1|2847933_2848761_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|2848760_2849342_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|2849370_2851263_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 213
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2855090	2855483	4872840		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|2855090_2855483_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 214
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2858793	2868144	4872840		Bacillus_virus(33.33%)	7	NA	NA
WP_001281866.1|2858793_2861052_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.1e-84
WP_000965722.1|2861285_2862023_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059388.1|2862097_2863510_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095203.1|2863620_2865840_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848526.1|2865891_2866140_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691619.1|2866190_2867117_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|2867316_2868144_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 215
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2874220	2875105	4872840		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018784.1|2874220_2875105_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	9.8e-66
>prophage 216
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2924189	2924858	4872840		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000590263.1|2924189_2924858_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.2	1.8e-08
>prophage 217
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2940677	2941661	4872840		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001355482.1|2940677_2941661_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	8.1e-37
>prophage 218
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2945243	2951125	4872840	integrase,transposase	Klebsiella_phage(25.0%)	5	2942858:2942874	2951329:2951345
2942858:2942874	attL	CCGGACTCGGAATCGAA	NA	NA	NA	NA
WP_000691818.1|2945243_2945465_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_001398324.1|2945601_2945781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001395295.1|2947328_2947553_+|transposase	transposase	transposase	Q76S41	Shigella_phage	70.8	1.2e-17
WP_001395296.1|2948500_2949424_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	3.0e-166
WP_001218852.1|2949862_2951125_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
2951329:2951345	attR	CCGGACTCGGAATCGAA	NA	NA	NA	NA
>prophage 219
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2976965	2978120	4872840		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2976965_2978120_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 220
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2985944	2986853	4872840		Yersinia_phage(100.0%)	1	NA	NA
WP_000646940.1|2985944_2986853_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	5.2e-54
>prophage 221
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	2993333	2994011	4872840		Bacillus_virus(100.0%)	1	NA	NA
WP_000956899.1|2993333_2994011_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	8.4e-09
>prophage 222
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3011851	3013084	4872840		Catovirus(100.0%)	1	NA	NA
WP_001151603.1|3011851_3013084_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	3.3e-104
>prophage 223
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3021219	3025692	4872840		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195059.1|3021219_3024093_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	8.2e-263
WP_001394742.1|3024258_3025692_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	1.5e-31
>prophage 224
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3029497	3044888	4872840	tRNA	Brevibacillus_phage(14.29%)	13	NA	NA
WP_000806650.1|3029497_3030394_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	1.8e-30
WP_000715224.1|3030418_3031129_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_001394741.1|3031134_3032868_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.9e-60
WP_001701073.1|3032958_3034056_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|3034066_3035584_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192788.1|3035626_3036175_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001050745.1|3036296_3036422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3036423_3037872_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_032220702.1|3038307_3040227_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|3040226_3040715_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3040750_3042118_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001336279.1|3042153_3043470_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280196.1|3043487_3044888_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 225
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3069346	3070102	4872840		Clostridium_phage(100.0%)	1	NA	NA
WP_023486925.1|3069346_3070102_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 226
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3075325	3077820	4872840		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603502.1|3075325_3076087_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|3076401_3077820_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 227
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3087450	3094223	4872840		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|3087450_3088164_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082201.1|3088232_3088922_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|3089606_3090137_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957910.1|3090149_3092396_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|3092546_3093422_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|3093428_3094223_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 228
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3099699	3115137	4872840	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001138201.1|3099699_3102588_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
WP_001286051.1|3102580_3106123_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	8.9e-09
WP_000775955.1|3106122_3107949_+	RecBCD enzyme subunit RecD	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_000237947.1|3108010_3109342_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|3109573_3110827_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678647.1|3111295_3112393_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|3112631_3113438_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184261.1|3113488_3113932_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001300698.1|3113931_3115137_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
>prophage 229
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3126391	3127147	4872840		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3126391_3127147_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 230
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3132005	3132854	4872840		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|3132005_3132854_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 231
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3140388	3144503	4872840		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|3140388_3143145_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046812.1|3143201_3144503_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
>prophage 232
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3148535	3153456	4872840		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210878.1|3148535_3150173_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|3150260_3151559_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268460.1|3151618_3152491_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001199973.1|3152784_3153456_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 233
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3157868	3158654	4872840		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_023486974.1|3157868_3158654_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
>prophage 234
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3182657	3184690	4872840		Hokovirus(50.0%)	2	NA	NA
WP_001090386.1|3182657_3184085_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
WP_001173676.1|3184084_3184690_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
>prophage 235
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3187802	3200983	4872840		Escherichia_phage(50.0%)	11	NA	NA
WP_001295182.1|3187802_3188564_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3188557_3189184_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|3189323_3190463_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3190525_3191518_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001136934.1|3193062_3193839_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3193843_3194482_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|3194478_3195741_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|3195737_3196646_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|3196841_3197609_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|3197659_3198316_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_023486976.1|3198421_3200983_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
>prophage 236
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3218784	3219798	4872840		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300815.1|3218784_3219798_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	9.3e-28
>prophage 237
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3227273	3228239	4872840		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287431.1|3227273_3228239_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 238
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3233705	3235344	4872840		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000132231.1|3233705_3234203_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|3234282_3235344_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
>prophage 239
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3238904	3239090	4872840		Vibrio_phage(100.0%)	1	NA	NA
WP_000906486.1|3238904_3239090_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 240
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3252140	3258212	4872840		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|3252140_3253343_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|3253696_3254656_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_077637218.1|3254665_3255811_-	ribonucleoside-diphosphate reductase	NA	V9VI16	Lactococcus_phage	46.0	1.1e-93
WP_000080947.1|3257559_3257970_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|3257966_3258212_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 241
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3262148	3266200	4872840		Clostridium_phage(50.0%)	4	NA	NA
WP_000522415.1|3262148_3262598_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|3262598_3263261_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|3263281_3264682_-	GABA permease	NA	NA	NA	NA	NA
WP_001087612.1|3264919_3266200_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
>prophage 242
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3274805	3385479	4872840	integrase,holin,tail,terminase,transposase,portal,plate,tRNA,head	Enterobacteria_phage(60.71%)	112	3284862:3284878	3361474:3361490
WP_023486750.1|3274805_3276362_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	1.9e-19
WP_001062344.1|3276644_3277874_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.3	1.0e-206
WP_000162574.1|3278617_3279100_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600191.1|3279231_3279708_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|3279697_3279988_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3280049_3280391_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|3280539_3282201_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|3282286_3283165_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|3283287_3283881_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|3283935_3285222_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
3284862:3284878	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_001338897.1|3285242_3286034_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|3286200_3287562_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3287698_3287947_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3287965_3288514_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|3288544_3289312_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|3289353_3289701_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589847.1|3289776_3290259_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|3290274_3291501_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000976005.1|3292339_3292717_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168037.1|3292926_3293997_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|3294007_3295129_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200099.1|3295171_3296332_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010723158.1|3296430_3296478_-	phe operon leader peptide	NA	NA	NA	NA	NA
WP_000974887.1|3296645_3297635_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_001242988.1|3297701_3298004_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001001394.1|3298099_3298426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813365.1|3298444_3298786_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_023486737.1|3298796_3299075_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	8.1e-35
WP_000514277.1|3299086_3299329_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|3299325_3299439_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000543036.1|3299532_3299943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3299966_3300170_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|3300166_3300433_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|3300429_3300729_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000013459.1|3301052_3301283_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	88.2	1.0e-27
WP_000599378.1|3301355_3301721_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	5.1e-61
WP_047661184.1|3301727_3304550_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.9	0.0e+00
WP_023486984.1|3304626_3305586_+	stability/partitioning protein encoded within prophage	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	2.1e-178
WP_023486983.1|3305590_3305902_+	hypothetical protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.1e-48
WP_032220883.1|3306280_3307363_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
WP_023486981.1|3307359_3309564_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000087812.1|3310068_3311115_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_023486980.1|3311114_3312866_-|terminase	phage terminase ATPase subunit	terminase	A0A0A7NV54	Enterobacteria_phage	99.5	0.0e+00
WP_047647269.1|3313703_3314198_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.6e-89
WP_000865513.1|3314197_3314398_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.3e-31
WP_000104350.1|3314400_3314724_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_032328493.1|3314720_3315113_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.7e-70
WP_157774311.1|3315109_3315286_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.2	5.0e-22
WP_047647271.1|3315361_3315943_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	4.3e-102
WP_047647273.1|3315939_3316290_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	6.6e-58
WP_001111928.1|3316293_3317190_+|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.5e-154
WP_024170200.1|3317182_3317710_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	87.0	4.0e-83
WP_099548374.1|3317720_3320378_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	71.4	8.3e-278
WP_047647321.1|3320377_3320995_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.3	3.8e-85
WP_001447286.1|3320958_3321504_-	transferase	NA	NA	NA	NA	NA
WP_000979945.1|3321692_3322181_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_099548376.1|3322193_3325001_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	89.2	0.0e+00
WP_000333503.1|3324987_3325143_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_040035748.1|3325151_3325517_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	84.3	5.5e-47
WP_000290456.1|3325571_3326084_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_099548378.1|3326083_3327268_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	1.3e-222
WP_099548381.1|3327425_3328535_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	95.7	7.9e-198
WP_000488107.1|3328577_3328838_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032140709.1|3329029_3329170_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	65.2	3.8e-09
WP_157774312.1|3329380_3329602_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295213.1|3329615_3330638_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001317493.1|3330634_3331417_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000215751.1|3331520_3332327_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.2e-65
WP_000178456.1|3332477_3332819_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|3333089_3333827_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|3333961_3334942_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040169.1|3334938_3335670_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3335799_3338373_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|3344233_3345532_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001295360.1|3345528_3345852_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|3345897_3347253_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083005.1|3347366_3350027_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|3350058_3350757_-	DTW domain-containing protein YfiP	NA	NA	NA	NA	NA
WP_001098726.1|3350825_3351245_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3351451_3352489_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|3352536_3353226_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|3353530_3353914_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|3353969_3354557_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001351830.1|3354659_3355541_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|3355749_3357084_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001295363.1|3357215_3357953_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_001094462.1|3357937_3359560_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|3359815_3359971_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|3359967_3360543_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|3360575_3361226_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|3361225_3362182_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
3361474:3361490	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_000589070.1|3362178_3362658_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|3362855_3364655_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|3364670_3365645_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|3365917_3366598_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020749.1|3366594_3367500_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399393.1|3367511_3368240_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001295365.1|3368251_3368983_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986029.1|3368982_3369363_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|3369535_3369616_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_001196283.1|3369809_3370070_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_001351829.1|3370125_3370974_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190655.1|3371182_3371818_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001295367.1|3371842_3372379_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000734210.1|3372387_3373932_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_000970096.1|3374189_3378077_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
WP_001416677.1|3378634_3380062_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_023486944.1|3380226_3380940_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|3380929_3382264_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717691.1|3382324_3382663_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_047646848.1|3382707_3383898_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|3384225_3385479_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 243
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3391402	3392914	4872840		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493470.1|3391402_3392914_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 244
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3408141	3414479	4872840		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|3408141_3409356_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|3409383_3409770_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|3409786_3410110_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|3410205_3410721_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|3410737_3412588_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124474.1|3412589_3412925_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|3412936_3413137_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133595.1|3413195_3414479_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
>prophage 245
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3424690	3425122	4872840		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3424690_3425122_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 246
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3433952	3440249	4872840		Escherichia_phage(60.0%)	6	NA	NA
WP_000937912.1|3433952_3435323_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
WP_001299507.1|3435484_3436951_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|3437019_3438597_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|3438689_3439229_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000669402.1|3439244_3439760_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|3440075_3440249_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 247
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3446683	3450685	4872840		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|3446683_3447322_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|3447321_3448359_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|3448683_3449310_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|3449395_3450685_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 248
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3471769	3472483	4872840		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3471769_3472483_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 249
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3489771	3490722	4872840		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3489771_3490722_-	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 250
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3509351	3514471	4872840		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102886.1|3509351_3510221_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000405996.1|3510434_3510860_+	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000842944.1|3510846_3511296_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838944.1|3511356_3511932_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|3512027_3512927_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001397583.1|3513166_3514471_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	25.6	6.2e-08
>prophage 251
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3517949	3518741	4872840		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|3517949_3518741_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 252
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3521758	3523901	4872840		Bacillus_virus(50.0%)	2	NA	NA
WP_000021036.1|3521758_3522856_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001336044.1|3522989_3523901_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
>prophage 253
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3527555	3535188	4872840		Hokovirus(33.33%)	6	NA	NA
WP_000623140.1|3527555_3529283_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000487600.1|3529327_3529585_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|3529968_3530940_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|3531124_3531886_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001300494.1|3532115_3533102_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443661.1|3533172_3535188_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
>prophage 254
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3562070	3562805	4872840		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3562070_3562805_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 255
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3566623	3567544	4872840		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|3566623_3567544_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 256
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3571238	3578815	4872840		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283490.1|3571238_3572933_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|3573002_3573947_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|3574020_3575166_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001355656.1|3575221_3578815_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
>prophage 257
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3586740	3587673	4872840		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368140.1|3586740_3587673_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 258
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3605498	3606584	4872840		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|3605498_3606584_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 259
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3615120	3616257	4872840		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699147.1|3615120_3616257_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 260
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3622734	3624252	4872840		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|3622734_3624252_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 261
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3628463	3630324	4872840		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293595.1|3628463_3629237_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156149.1|3629433_3630324_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	8.9e-67
>prophage 262
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3640883	3644111	4872840		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_023486837.1|3640883_3641534_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
WP_001012899.1|3641620_3643453_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813859.1|3643511_3644111_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 263
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3677183	3682187	4872840		Tupanvirus(50.0%)	4	NA	NA
WP_000860273.1|3677183_3679166_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461657.1|3679165_3680134_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_001355579.1|3680137_3681277_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	30.1	5.0e-30
WP_000879112.1|3681584_3682187_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 264
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3685790	3690301	4872840	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001530718.1|3685790_3686996_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	27.3	2.1e-26
WP_001295288.1|3687052_3688342_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992954.1|3688359_3689163_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150333.1|3689203_3689389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140569.1|3689401_3690301_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 265
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3696193	3702340	4872840		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000779105.1|3696193_3697270_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
WP_000301050.1|3697732_3698383_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|3698436_3698691_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332037.1|3698690_3699821_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075164.1|3700054_3702340_-	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
>prophage 266
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3707784	3710412	4872840		Bacillus_virus(100.0%)	1	NA	NA
WP_001281218.1|3707784_3710412_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	1.1e-91
>prophage 267
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3725335	3730178	4872840		Bacillus_phage(50.0%)	2	NA	NA
WP_000559133.1|3725335_3727162_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
WP_000876011.1|3727328_3730178_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 268
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3734455	3740233	4872840		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865568.1|3734455_3735559_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.2e-117
WP_000406064.1|3735670_3736726_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710375.1|3736799_3737864_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884971.1|3737863_3738514_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_000422182.1|3738589_3740233_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 269
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3749453	3750071	4872840		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|3749453_3750071_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 270
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3757988	3759955	4872840	transposase	Enterobacteria_phage(100.0%)	2	NA	NA
WP_000952425.1|3757988_3759161_+|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.8	1.2e-215
WP_000544809.1|3759160_3759955_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
>prophage 271
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3764074	3771722	4872840		Vibrio_phage(50.0%)	7	NA	NA
WP_000050793.1|3764074_3765082_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
WP_000494183.1|3765220_3765505_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578092.1|3765629_3767390_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	4.2e-100
WP_001234850.1|3767538_3768234_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|3768261_3769452_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|3769784_3770129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194927.1|3770132_3771722_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 272
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3777476	3781777	4872840		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|3777476_3778043_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|3778454_3779168_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198828.1|3779206_3780193_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001091940.1|3780310_3781777_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
>prophage 273
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3796324	3797182	4872840		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|3796324_3797182_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 274
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3801252	3805038	4872840		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|3801252_3803244_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|3803275_3804112_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|3804369_3805038_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 275
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3831428	3840869	4872840		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|3831428_3832355_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783115.1|3832359_3833091_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3833071_3833179_-	protein YohO	NA	NA	NA	NA	NA
WP_023486965.1|3833238_3833970_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	3.7e-111
WP_001295431.1|3834191_3835877_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3835873_3836593_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|3836639_3837110_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|3837149_3837611_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001355588.1|3837735_3839736_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001355589.1|3839732_3840869_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	1.6e-161
>prophage 276
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3852500	3854534	4872840	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350533.1|3852500_3854534_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 277
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3865181	3868738	4872840		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001352238.1|3865181_3866000_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434038.1|3866051_3866798_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011958.1|3866771_3867737_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846230.1|3867733_3868738_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	6.4e-13
>prophage 278
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3881702	3888543	4872840	tRNA	Bacillus_phage(40.0%)	7	NA	NA
WP_000481293.1|3881702_3882356_+	HAD-IA family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	24.8	9.0e-08
WP_000807345.1|3882429_3883329_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001394463.1|3883742_3884060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|3884389_3885751_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000929408.1|3885897_3886230_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|3886420_3887143_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|3887139_3888543_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 279
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3902721	3904074	4872840		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469697.1|3902721_3904074_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	7.1e-07
>prophage 280
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3908799	3919368	4872840		Catovirus(20.0%)	8	NA	NA
WP_001295424.1|3908799_3909441_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|3909532_3910114_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252326.1|3910135_3911989_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001355593.1|3912440_3914024_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|3914682_3915822_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482901.1|3915827_3916271_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137174.1|3916273_3918436_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.1e-17
WP_000654503.1|3918528_3919368_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 281
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3923613	3930495	4872840		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|3923613_3924735_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043590.1|3924737_3925703_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.3e-87
WP_000479833.1|3925705_3926185_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699766.1|3926181_3927405_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079302.1|3927407_3928844_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	5.7e-47
WP_001355594.1|3929124_3930495_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	9.9e-33
>prophage 282
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3936207	3938670	4872840		Klebsiella_phage(50.0%)	2	NA	NA
WP_001115981.1|3936207_3937602_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183060.1|3937776_3938670_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
>prophage 283
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3944668	3952768	4872840		Tupanvirus(20.0%)	6	NA	NA
WP_001024185.1|3944668_3945676_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.6	2.2e-82
WP_001076405.1|3945696_3946902_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001297922.1|3946891_3948331_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.8	2.7e-57
WP_000096783.1|3948413_3949784_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.9	3.8e-32
WP_000043484.1|3949946_3951353_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704860.1|3951601_3952768_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
>prophage 284
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3960120	3961020	4872840		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|3960120_3961020_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 285
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3968259	3970725	4872840	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_085951439.1|3968259_3969533_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_032145576.1|3969561_3970725_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	9.7e-223
>prophage 286
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3975066	3977225	4872840		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692323.1|3975066_3975288_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|3975350_3975827_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860076.1|3975842_3976322_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001234530.1|3976403_3977225_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
>prophage 287
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3993801	3994257	4872840		Escherichia_phage(100.0%)	1	NA	NA
WP_000423152.1|3993801_3994257_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.6e-56
>prophage 288
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	3998652	4011019	4872840		Bacillus_phage(28.57%)	12	NA	NA
WP_001362894.1|3998652_3999324_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
WP_000826758.1|3999323_4000682_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_023486833.1|4000789_4001641_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824370.1|4002232_4003291_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
WP_001313057.1|4003857_4004223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365544.1|4004262_4004958_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157238.1|4005024_4006443_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786004.1|4006423_4006894_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212240.1|4006882_4007803_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|4007975_4008893_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|4008971_4009154_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001355498.1|4009324_4011019_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 289
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4028249	4108463	4872840	integrase,tail,transposase,portal,capsid	Enterobacteria_phage(68.29%)	83	4048027:4048086	4117872:4117996
WP_001355499.1|4028249_4029458_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
WP_000334609.1|4029497_4030169_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_000789493.1|4030277_4030511_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118901.1|4030507_4031713_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|4031899_4032313_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245699.1|4032346_4033834_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001015023.1|4033911_4034277_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000287768.1|4034276_4034687_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146098.1|4034701_4036114_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079829.1|4036368_4037943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087467.1|4038107_4038827_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001301374.1|4038872_4039424_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001295643.1|4039511_4040312_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128219.1|4040416_4041403_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|4041417_4042086_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272994.1|4042082_4042835_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001154273.1|4043064_4043787_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|4043854_4044079_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001302050.1|4044065_4044242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611338.1|4044537_4045194_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|4045190_4047023_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|4047079_4047628_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
4048027:4048086	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_071529678.1|4048622_4048904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|4049093_4049234_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|4049423_4049684_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|4049726_4050836_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_001397420.1|4050993_4052178_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	5.8e-223
WP_000290450.1|4052177_4052690_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|4052744_4053110_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|4053145_4053274_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_001394249.1|4053260_4056068_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.6	0.0e+00
WP_000979954.1|4056080_4056569_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_001418511.1|4056749_4057295_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_001397298.1|4057258_4057876_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.3	1.3e-85
WP_001397297.1|4057875_4060533_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	72.1	1.4e-280
WP_077697801.1|4061688_4062438_-|capsid	capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	96.6	8.1e-130
WP_050688142.1|4062391_4064101_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.7	0.0e+00
WP_000087812.1|4064100_4065147_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001519213.1|4065631_4066039_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	90.0	3.4e-21
WP_001163782.1|4066035_4066368_-	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	96.4	5.5e-54
WP_000211255.1|4066431_4066743_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	1.9e-48
WP_000686519.1|4066747_4067707_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	100.0	2.0e-181
WP_047661187.1|4067783_4070606_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000599382.1|4070612_4070978_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_001397290.1|4071050_4071281_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	93.4	2.2e-30
WP_000104305.1|4071603_4071903_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001397288.1|4071899_4072166_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	4.4e-30
WP_000985157.1|4072162_4072366_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000021655.1|4072899_4073013_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514274.1|4073009_4073252_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_001397286.1|4073263_4073542_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	4.8e-35
WP_001397285.1|4073552_4073903_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	80.2	7.3e-49
WP_000014504.1|4073924_4074128_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|4074199_4074337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|4074427_4074832_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|4074847_4075498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|4075527_4075875_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|4075880_4076882_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000440337.1|4077143_4078025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544809.1|4078822_4079617_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000952425.1|4079616_4080789_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.8	1.2e-215
WP_000054834.1|4081859_4082174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045627.1|4082199_4082733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001194747.1|4082805_4083240_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_000710651.1|4083850_4084669_-	DUF726 domain-containing protein	NA	NA	NA	NA	NA
WP_000515817.1|4084730_4085633_-	WYL domain-containing transcriptional regulator	NA	A0A0R6PH67	Moraxella_phage	31.5	9.7e-37
WP_000280683.1|4086012_4086339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000069517.1|4086387_4088988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256731.1|4089034_4089673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281555.1|4089662_4089863_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001121921.1|4090013_4091144_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	27.6	2.6e-15
WP_000462048.1|4091311_4092442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020410.1|4092948_4094115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998257.1|4094487_4096074_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.5	1.2e-87
WP_000173147.1|4096070_4097168_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000779018.1|4097164_4097848_+	YecA family protein	NA	NA	NA	NA	NA
WP_001077331.1|4097900_4101185_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	4.7e-65
WP_001290569.1|4101181_4101937_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001531847.1|4102594_4104046_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000995973.1|4104038_4106081_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000108717.1|4106268_4106652_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_077635545.1|4106661_4107444_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_001295213.1|4107440_4108463_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
4117872:4117996	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 290
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4114722	4116231	4872840		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189123.1|4114722_4116231_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 291
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4124672	4126187	4872840		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187794.1|4124672_4126187_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	7.4e-13
>prophage 292
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4136273	4141917	4872840		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001297437.1|4136273_4137935_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_023486807.1|4137980_4139582_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_000204313.1|4139600_4140461_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|4140463_4141513_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763864.1|4141527_4141917_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.0e-06
>prophage 293
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4147168	4148902	4872840	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|4147168_4148902_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 294
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4151956	4157569	4872840	tRNA	Escherichia_phage(33.33%)	5	NA	NA
WP_000176798.1|4151956_4154386_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	27.5	2.6e-60
WP_000564725.1|4154550_4155522_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|4155518_4156262_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|4156302_4156698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639274.1|4156750_4157569_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 295
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4161587	4168651	4872840		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|4161587_4162109_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024904.1|4162110_4162713_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072094247.1|4162783_4162849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580327.1|4162987_4163599_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|4163607_4164618_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|4164764_4165550_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|4165546_4166302_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001300644.1|4166380_4167313_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|4167328_4168651_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 296
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4172649	4174125	4872840		Cyanophage(100.0%)	1	NA	NA
WP_000301719.1|4172649_4174125_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
>prophage 297
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4182181	4186651	4872840		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944258.1|4182181_4182844_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|4182867_4183524_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|4183625_4183856_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168746.1|4183994_4184369_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879295.1|4184372_4185245_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|4185257_4185599_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812772.1|4185994_4186651_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
>prophage 298
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4194147	4196196	4872840		Moraxella_phage(100.0%)	1	NA	NA
WP_032220382.1|4194147_4196196_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	2.3e-86
>prophage 299
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4201526	4201736	4872840		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4201526_4201736_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 300
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4207376	4208933	4872840		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|4207376_4208933_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 301
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4212795	4220900	4872840	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_000855022.1|4212795_4214157_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
WP_000457334.1|4214230_4214410_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001295493.1|4215249_4215594_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|4215725_4217636_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220966.1|4217693_4218389_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290556.1|4218428_4219010_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|4219214_4220900_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 302
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4235429	4240006	4872840		Bacillus_phage(100.0%)	3	NA	NA
WP_000766131.1|4235429_4236920_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
WP_023486812.1|4237100_4238576_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|4238722_4240006_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 303
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4243324	4244179	4872840		Indivirus(100.0%)	1	NA	NA
WP_001186374.1|4243324_4244179_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 304
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4257211	4257853	4872840		Tupanvirus(100.0%)	1	NA	NA
WP_001135058.1|4257211_4257853_-	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	1.7e-19
>prophage 305
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4262779	4264741	4872840		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|4262779_4264741_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 306
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4270339	4270993	4872840		Planktothrix_phage(100.0%)	1	NA	NA
WP_001300558.1|4270339_4270993_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
>prophage 307
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4277757	4278978	4872840		Klosneuvirus(100.0%)	1	NA	NA
WP_000081986.1|4277757_4278978_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 308
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4286454	4287282	4872840		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|4286454_4287282_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 309
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4293611	4295873	4872840		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|4293611_4295873_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 310
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4307168	4325005	4872840	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_001144202.1|4307168_4309097_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|4309100_4309643_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|4309739_4309937_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|4309989_4310346_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|4310468_4310513_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000018596.1|4310796_4311780_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672380.1|4311794_4314182_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|4314186_4314486_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956528.1|4314586_4315567_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154168.1|4315629_4316181_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|4316180_4316930_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209795.1|4317007_4317472_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001300634.1|4317718_4318432_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175703.1|4318494_4319931_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|4319934_4320126_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082229.1|4320257_4321304_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|4321460_4322294_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|4322626_4325005_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
>prophage 311
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4345350	4350434	4872840		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|4345350_4345719_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|4345727_4347215_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948863.1|4347224_4347971_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
WP_000907979.1|4347945_4349217_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000577988.1|4349213_4350434_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 312
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4358723	4360990	4872840		Escherichia_phage(50.0%)	3	NA	NA
WP_001310861.1|4358723_4359392_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069979.1|4359388_4360174_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587524.1|4360177_4360990_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 313
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4366494	4375376	4872840		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|4366494_4367136_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|4367175_4368324_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182363.1|4368614_4369826_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|4369938_4370871_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|4370867_4371893_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|4372192_4372282_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_023486904.1|4372447_4373617_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|4373851_4374433_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|4374560_4375376_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 314
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4384178	4385677	4872840		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|4384178_4385075_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|4385155_4385677_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 315
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4392588	4393863	4872840	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|4392588_4393863_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 316
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4413738	4415550	4872840		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|4413738_4415550_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 317
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4425626	4426928	4872840		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|4425626_4426928_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 318
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4444689	4462430	4872840	integrase,transposase	Escherichia_phage(36.36%)	17	4447018:4447031	4459383:4459396
WP_000148710.1|4444689_4445304_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|4445346_4446201_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4446202_4446820_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|4446830_4449254_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
4447018:4447031	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
WP_000041677.1|4449314_4451741_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001300836.1|4451939_4452245_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|4452352_4453063_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|4453065_4453626_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|4453660_4454002_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|4454136_4454463_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_023486899.1|4454668_4455883_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.3	1.8e-46
WP_001394316.1|4455894_4456914_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001389342.1|4456971_4457100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876998.1|4457101_4458382_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	7.8e-157
WP_001296941.1|4458416_4458653_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_040036049.1|4458740_4461197_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
4459383:4459396	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
WP_085947771.1|4461268_4462430_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 319
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4469076	4470621	4872840		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|4469076_4470621_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 320
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4477505	4477796	4872840		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|4477505_4477796_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 321
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4484417	4485428	4872840		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000642435.1|4484417_4485428_-	alcohol dehydrogenase AdhP	NA	A0A0K0KVL7	Prochlorococcus_phage	27.1	4.5e-14
>prophage 322
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4488701	4490607	4872840		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285536.1|4488701_4489628_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_000193547.1|4489620_4490607_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 323
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4494923	4497323	4872840		Klosneuvirus(100.0%)	1	NA	NA
WP_001360132.1|4494923_4497323_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 324
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4504003	4510939	4872840		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_014639909.1|4504003_4506799_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
WP_099548396.1|4506843_4509216_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000628585.1|4509253_4510939_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 325
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4522903	4525132	4872840		Lactobacillus_phage(100.0%)	1	NA	NA
WP_001530084.1|4522903_4525132_+	DEAD/DEAH box helicase family protein	NA	Q9T1H9	Lactobacillus_phage	25.8	3.0e-23
>prophage 326
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4533302	4535918	4872840	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001704819.1|4533302_4533980_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4533979_4534327_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|4534346_4535918_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
>prophage 327
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4545705	4547124	4872840		Bacillus_phage(100.0%)	1	NA	NA
WP_000558033.1|4545705_4547124_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
>prophage 328
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4559941	4565362	4872840		Escherichia_phage(100.0%)	1	NA	NA
WP_032220191.1|4559941_4565362_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.0	2.3e-141
>prophage 329
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4579082	4580461	4872840		Klebsiella_phage(50.0%)	3	NA	NA
WP_000273128.1|4579082_4579403_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000843419.1|4579622_4580057_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|4580077_4580461_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 330
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4583462	4584353	4872840		Bacillus_phage(100.0%)	1	NA	NA
WP_000592802.1|4583462_4584353_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
>prophage 331
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4589719	4658399	4872840	tail,terminase,transposase,portal,capsid	Escherichia_phage(22.22%)	69	NA	NA
WP_000214712.1|4589719_4589923_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|4589957_4591418_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_023486864.1|4591506_4592790_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|4593393_4593507_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4593575_4593809_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_001204786.1|4595019_4595397_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	6.9e-53
WP_001265274.1|4595414_4596464_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_001325325.1|4596465_4596744_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_000887491.1|4597202_4597415_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001557860.1|4597459_4597567_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_095033723.1|4598530_4599693_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001300590.1|4600268_4601768_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_000550695.1|4601880_4602942_-	YncE family protein	NA	NA	NA	NA	NA
WP_001299369.1|4605321_4605987_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000531453.1|4606184_4607222_-	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_001351727.1|4607401_4607920_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_001076535.1|4607916_4608366_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000018633.1|4608366_4608600_-	YdcY family protein	NA	NA	NA	NA	NA
WP_000061178.1|4608685_4608859_-	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_001303494.1|4609053_4609149_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_001163875.1|4609245_4610670_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000555458.1|4610691_4611486_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001251313.1|4611475_4612417_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000220399.1|4612417_4613431_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
WP_000047424.1|4613448_4614594_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760586.1|4614838_4616245_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001020593.1|4616479_4616752_+	hypothetical protein	NA	A0A1D7XF78	Escherichia_phage	52.2	1.8e-18
WP_024233973.1|4616802_4617189_+	hypothetical protein	NA	C4MZ15	Escherichia_phage	47.3	7.9e-12
WP_028132421.1|4617497_4617917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024233971.1|4617980_4619660_+	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	27.8	7.9e-40
WP_140041310.1|4619670_4619922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361806.1|4620004_4620202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739960.1|4620194_4620548_-	DUF882 domain-containing protein	NA	A0A2K9VAY0	Citrobacter_phage	62.6	6.5e-37
WP_001097086.1|4620557_4620905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099548401.1|4621900_4622404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097342343.1|4622595_4622874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739961.1|4622975_4626725_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	53.9	1.5e-46
WP_049143000.1|4626715_4627159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739978.1|4627190_4627760_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_097739962.1|4627843_4628404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739963.1|4628454_4630884_-	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	33.6	6.3e-22
WP_097739964.1|4630895_4631237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739965.1|4631266_4631575_-	cytochrome	NA	NA	NA	NA	NA
WP_097739966.1|4631656_4632127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739979.1|4632185_4632926_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	70.9	2.7e-101
WP_097739967.1|4633380_4633659_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	55.4	8.4e-24
WP_097739968.1|4636197_4637034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739969.1|4637043_4637466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077137762.1|4637449_4637740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739970.1|4637932_4639936_-|capsid	phage major capsid protein	capsid	G8EXZ9	Synechococcus_phage	24.0	8.8e-30
WP_097739971.1|4639981_4641493_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	27.5	3.2e-32
WP_097739972.1|4641503_4641998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739973.1|4642070_4643978_-|terminase	terminase	terminase	D6PFE7	uncultured_phage	29.9	1.4e-32
WP_097739974.1|4644065_4644668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097739975.1|4644703_4644931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097739976.1|4645071_4645908_-	Rha family transcriptional regulator	NA	A0A1P8DTE1	Proteus_phage	39.3	5.9e-12
WP_032282368.1|4645999_4646179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096945297.1|4646299_4646767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113737.1|4648028_4648208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099548403.1|4648327_4649323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695756.1|4649338_4649581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024233631.1|4650293_4650848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097739977.1|4651206_4651986_+	hypothetical protein	NA	A7XFN5	Enterobacteria_phage	66.4	1.7e-85
WP_000813794.1|4652593_4652770_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|4652991_4653222_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001355676.1|4653313_4655275_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000429133.1|4655347_4655884_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071597387.1|4655936_4657151_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_099548411.1|4657190_4658399_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	2.3e-206
>prophage 332
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4670981	4671930	4872840		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|4670981_4671155_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|4671399_4671930_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 333
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4675868	4679771	4872840		Klosneuvirus(100.0%)	1	NA	NA
WP_000139565.1|4675868_4679771_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 334
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4689241	4690231	4872840		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|4689241_4690231_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 335
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4695191	4702462	4872840	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837921.1|4695191_4696325_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|4696465_4696900_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000081417.1|4697076_4698012_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123779.1|4698140_4699514_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	8.6e-53
WP_023486752.1|4699991_4700975_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|4701229_4702462_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 336
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4708788	4709304	4872840		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|4708788_4709304_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 337
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4726700	4727783	4872840		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057986.1|4726700_4727783_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 338
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4741787	4743053	4872840		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|4741787_4743053_-	4-aminobutyrate aminotransferase PuuE	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 339
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4755968	4761624	4872840		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|4755968_4756775_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000565726.1|4756842_4757196_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|4757562_4758351_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001335988.1|4758494_4759622_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|4759689_4761624_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 340
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4769441	4770032	4872840		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4769441_4770032_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 341
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4774956	4780248	4872840	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001355506.1|4774956_4777554_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	3.0e-86
WP_001031530.1|4777933_4778185_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|4778220_4779270_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559286.1|4779489_4780248_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
>prophage 342
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4787994	4790952	4872840		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|4787994_4789590_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|4789593_4790952_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 343
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4795638	4819567	4872840	integrase,tail	Escherichia_phage(26.32%)	29	4799734:4799747	4821291:4821304
WP_001394194.1|4795638_4796172_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	100.0	1.4e-96
WP_072015062.1|4798908_4800321_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	96.1	2.6e-198
4799734:4799747	attL	CCTGATTTCAGCCA	NA	NA	NA	NA
WP_000185912.1|4801145_4802195_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.8	6.1e-184
WP_000917766.1|4802345_4802543_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	5.2e-28
WP_000615424.1|4802762_4803506_-	protein phosphatase	NA	I6PCV8	Cronobacter_phage	42.3	7.7e-48
WP_000392434.1|4803502_4804267_-	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	40.2	1.7e-45
WP_099548406.1|4804411_4805101_-	antiterminator	NA	I6PDF8	Cronobacter_phage	46.4	1.5e-53
WP_001508568.1|4805097_4805457_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	4.6e-38
WP_001394182.1|4805469_4806519_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.6e-107
WP_024181071.1|4806520_4806793_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	7.2e-12
WP_000818167.1|4806908_4807394_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001277774.1|4807412_4807592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|4807807_4808020_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001397096.1|4808254_4808677_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	44.0	4.7e-18
WP_001394129.1|4809194_4809617_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.3	5.5e-67
WP_000450664.1|4809633_4810395_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	1.6e-117
WP_000788770.1|4810416_4811163_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.5	2.3e-116
WP_000095678.1|4811169_4812117_-	hypothetical protein	NA	U5P0A0	Shigella_phage	52.8	1.5e-83
WP_001394127.1|4812140_4812566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000471549.1|4812562_4812778_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001394126.1|4812827_4813544_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.1e-51
WP_001171946.1|4813826_4814045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001394125.1|4814067_4814442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123002074.1|4814431_4814815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001397095.1|4815205_4815394_+	dicB family protein	NA	NA	NA	NA	NA
WP_023486872.1|4815390_4815594_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001763171.1|4815674_4818146_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.7	4.5e-60
WP_000113182.1|4818210_4818459_+	excisionase	NA	NA	NA	NA	NA
WP_001394170.1|4818436_4819567_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	1.3e-102
4821291:4821304	attR	CCTGATTTCAGCCA	NA	NA	NA	NA
>prophage 344
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4827502	4829517	4872840		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|4827502_4828507_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|4828503_4829517_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 345
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4837927	4848467	4872840		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068089.1|4837927_4838545_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.7e-53
WP_001287378.1|4839148_4839562_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|4839705_4840614_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|4840815_4841829_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|4841920_4842826_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001362540.1|4842938_4843397_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|4843446_4844289_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|4845544_4846222_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|4846221_4846932_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|4846928_4848467_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 346
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4859722	4859953	4872840		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|4859722_4859953_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 347
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4863051	4867059	4872840		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811062.1|4863051_4863906_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.1	8.3e-46
WP_001257044.1|4863941_4864751_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200373.1|4864754_4865147_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456454.1|4865143_4865977_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804732.1|4865976_4867059_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 348
NZ_CP024232	Escherichia coli O6:H16 strain 2014EL-1346-6 chromosome, complete genome	4872840	4870195	4871143	4872840		Tupanvirus(100.0%)	1	NA	NA
WP_001298109.1|4870195_4871143_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 1
NZ_CP024237	Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence	152713	245	60303	152713	integrase,transposase	Stx2-converting_phage(30.0%)	58	235:294	41937:43274
235:294	attL	TGGATTTGCCCCTATATTTCCAGACACCTGTTATCACTTAACCCATTACTGGCCTGCTGC	NA	NA	NA	NA
WP_095033721.1|245_1525_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_000593828.1|3327_3954_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.1e-18
WP_000776983.1|3946_4720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836404.1|4676_5879_-	TolC family protein	NA	NA	NA	NA	NA
WP_001394310.1|5875_7006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000124138.1|8429_8795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000346363.1|11112_11910_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000124138.1|13110_13476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342360.1|13643_13898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001416056.1|14289_14445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032220289.1|14817_15306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001391303.1|15425_17879_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001391304.1|17844_18570_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000544814.1|19427_20225_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	98.5	4.7e-144
WP_000030204.1|24530_24839_-	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_001144037.1|24925_25570_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016960.1|25747_26554_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	1.7e-53
WP_001159871.1|26554_26860_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000829078.1|26861_27080_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343095.1|27601_27859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194544.1|27858_28401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300024.1|28665_29487_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004100285.1|29489_30578_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001699589.1|30582_31533_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001420717.1|31597_32542_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000998103.1|34393_35932_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.9	2.9e-291
WP_000612591.1|35981_36329_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001317493.1|36602_37385_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001295213.1|37381_38404_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_096850575.1|38470_38686_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	5.0e-32
WP_095033723.1|38956_40118_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_122994480.1|40373_40565_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095033721.1|40705_41984_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_085950855.1|42150_42844_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	7.5e-130
WP_140159966.1|42933_43161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047647237.1|43201_43879_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
41937:43274	attR	GCAGCAGGCCAGTAATGGGTTAAGTGATAACAGGTGTCTGGAAATATAGGGGCAAATCCACAAGCCAAAGGATGAGTCAAAAAAAACATATCTTTTTTTGTAACAGTTAAGTCAATCTTTTACAGGATGTTTGTACAAGTAAGTCGAATCCTTGTTTGGTGATGCCTCTAATTAGTTGAATCTGATGTATAATACGGGCTTTTGAGGTTATCTCATGGCCAGTGTTAATATTCATTGTCCCCGTTGTCAGTCAGCTCGGGTTTACCGCCATGGTCAGAACCTTAAAGGCCGTGACAGATTTCGCTGCCGTGACTGCCACCGTGTGTTTCAGCTCACTTATACTTATCAAGCACGTAAGCCGGGCATGAAAGAGCTGATCACTGAAATGGCCTTTAATGGTGCCGGGGTTCGCGATACCGCCAGGACACTGAAAATTGGTATTAACACCGTCATCCGGACTTTAAAAAACTCGCGCCAAAGCGAATAACTTCTTCGCCTGTTGCCCATGCTGATGTGGCGCTTATCTGCGAGCTTGATGAGCAATGGGGCTACGTTGGCAGTAAAGCCCGACAACACTGGCTCTGGTACGCGTACAACACCAAAACAGGCGGTGTACTGGCCTACACTTTTGGTCCCCGAACCGATCAAACGTGCCGGGAGCTACTGGCACTGCTTACACCCTTCAACATCGGCATGCTCACCAGCGATGACAGGGGCAGCTATGGCCGGGAGGTGCCGAAGAATAAGCATCTGACCGGAAAAATATTCACCCAACGCATTGAGCGTAATAATCTGACGCTACGCACCCGCATTAAGCGGTTGGCTCGTAAAACAATCTGCTTCTCACGCTCAGTTGAGATCCACGAAAAAGTGATCGGAGCGTTTATCGAAAAACATATGTTCTACTAATTGGATGCACTACCCCTTGTTTTTTATAGGCATATAAGATGAACTTTAAACACAATGAAGAAAAAGAAATAATAAAAATATATTCCTTTCAAGCCAGCTTATGTGTTTTTTGCAGGCTGCTGGTAGCCAGCAGCTTCAATTGATCCCCAAAATCAGGGAAACCTGCTGTGGCAAGTACATCTGCAACAATGTCTGCTTTGGTATGACCACGTTCAAGCCAAACGAGTTTGAGTTTGACTCCTGACTTTATAGTATTGTGCATATTCCGAGGTAATTCTGAATTACCAAATGGGCATTCAAAGGGTAACCGGCTCATTTAAACCGTCTGGTCTGTTTCCTCCGGCTCTACAAAAATAATGTCCATCATTTTTAATGGACACTATCGTATGAAACACCGGACCTGGATCACTGAAGCTTTACGTCTTCACT	NA	NA	NA	NA
WP_000624622.1|43878_44226_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|44245_45817_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000775238.1|46110_46272_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000872087.1|46479_46794_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	40.2	5.2e-14
WP_000127018.1|46790_47510_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845967.1|47506_47941_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_099548472.1|47995_48667_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_099548474.1|48694_49963_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	32.1	1.1e-20
WP_000005971.1|50026_50260_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290820.1|50316_50844_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	4.6e-47
WP_024173136.1|50908_51145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297832.1|51669_52233_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.9	3.0e-20
WP_000170687.1|52279_53641_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|53692_53923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027499.1|54922_55114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001463949.1|55110_55533_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_072105978.1|55584_55887_-	antirestriction protein	NA	NA	NA	NA	NA
WP_023486083.1|56421_57192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000274493.1|57236_57671_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104892.1|57684_57906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485601.1|57906_58590_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	7.9e-31
WP_001365314.1|59286_60303_-|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP024237	Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence	152713	89728	135653	152713	transposase	Stx2-converting_phage(23.53%)	45	NA	NA
WP_000381401.1|89728_91300_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|91319_91667_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047647237.1|91666_92344_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_000840475.1|92640_93201_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704511.1|93303_94164_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_001355702.1|94222_94846_-	conjugative relaxase	NA	NA	NA	NA	NA
WP_001529358.1|94845_97026_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001295213.1|97149_98172_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001317493.1|98168_98951_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000199908.1|99035_99773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366079.1|99975_100707_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000632667.1|100731_101253_-	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_032323087.1|101285_104054_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000138370.1|105152_105545_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_071594518.1|105498_105873_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001230775.1|106284_107013_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399782.1|106999_107566_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012113.1|107587_107899_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001098998.1|107903_108266_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000089263.1|108298_108526_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000283565.1|108662_109334_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_000124827.1|109527_109911_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_013188482.1|110233_110836_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001393327.1|111131_111953_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	1.7e-43
WP_000107522.1|112069_112357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272235.1|112512_112815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|113729_113888_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000845967.1|114874_115309_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001508949.1|115363_116035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001393231.1|116062_117331_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	32.1	5.2e-20
WP_001254933.1|117826_118978_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_013188479.1|120201_120576_-	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	3.7e-51
WP_001378495.1|120572_121349_-	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	6.5e-122
WP_000019162.1|121663_121936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032142224.1|123689_124061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|124369_125878_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_013188501.1|128228_128447_-	heat-stable enterotoxin ST-I group b	NA	NA	NA	NA	NA
WP_000471255.1|129435_129765_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	43.0	2.6e-08
WP_000780221.1|129745_130027_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_023486978.1|130349_131294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393279.1|131360_131711_-	plasmid stability family protein	NA	NA	NA	NA	NA
WP_000959870.1|131713_132676_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001365314.1|133142_134159_+|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_000343720.1|134274_135483_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_044307862.1|135479_135653_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	65.9	2.3e-11
