The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	271	9712	4733683		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|271_1198_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783115.1|1202_1934_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1914_2022_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|2081_2813_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3034_4720_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4716_5436_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|5482_5953_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|5992_6454_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001355588.1|6578_8579_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001333512.1|8575_9712_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 2
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	571194	588931	4733683	transposase	Salmonella_phage(28.57%)	16	NA	NA
WP_000598292.1|571194_571521_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001355548.1|571726_572941_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
WP_001394316.1|572952_573972_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001389342.1|574029_574158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|575415_576093_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|576092_576440_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|576459_578031_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_001296941.1|578181_578418_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_040036049.1|578505_580962_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_085947771.1|581033_582195_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001557860.1|583159_583267_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000887491.1|583311_583524_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000836768.1|585077_585311_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|585379_585493_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347500.1|586098_587382_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527809.1|587470_588931_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 3
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	970080	1007843	4733683	integrase,portal,terminase,tail,holin,tRNA	Escherichia_phage(28.57%)	46	978272:978286	1007945:1007959
WP_001297484.1|970080_971187_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|971222_971864_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423743.1|971867_973238_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.2e-108
WP_001265471.1|973406_974078_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|974077_975538_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|975613_976735_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|976783_978010_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|978259_979396_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
978272:978286	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|979379_980243_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001394135.1|980474_980741_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	81.7	9.2e-20
WP_000239880.1|980797_981466_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071597385.1|981520_981619_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	75.0	6.1e-06
WP_000985933.1|983079_983709_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	1.2e-102
WP_001072975.1|983708_983921_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_032231177.1|983917_986020_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.6	0.0e+00
WP_000373426.1|986019_986514_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
WP_000232223.1|986963_987329_-	hypothetical protein	NA	A0A220NRM9	Escherichia_phage	99.1	5.8e-57
WP_001228685.1|987412_987598_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_157186075.1|987819_987957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001700670.1|988520_989054_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.2	1.1e-99
WP_000193273.1|989109_989424_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_000839572.1|989428_989644_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193722.1|990511_991390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024152.1|991639_992026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532210.1|992039_992390_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.7	1.5e-54
WP_000904105.1|992379_992751_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.0e-36
WP_001265281.1|992763_993813_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	4.5e-110
WP_032289145.1|993814_994087_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	6.1e-11
WP_000481765.1|994188_995310_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	28.7	2.4e-32
WP_001179382.1|995320_995914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355535.1|996087_996207_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.8	1.2e-08
WP_000200161.1|996364_997411_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001151206.1|997895_998351_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	2.3e-63
WP_001262390.1|998391_999462_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693853.1|999533_999959_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|999955_1000210_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|1000289_1000709_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379589.1|1001006_1001162_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171936.1|1001321_1001540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072327945.1|1001562_1001877_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	6.2e-07
WP_000202162.1|1002704_1002926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449195.1|1003484_1003673_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083284.1|1003669_1003861_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048555.1|1003953_1006425_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	1.6e-57
WP_000003742.1|1006486_1006756_+	excisionase	NA	NA	NA	NA	NA
WP_000074976.1|1006724_1007843_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	4.5e-84
1007945:1007959	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 4
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	1386901	1394747	4733683	lysis	Enterobacteria_phage(66.67%)	7	NA	NA
WP_000586337.1|1386901_1388233_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	3.2e-20
WP_001171282.1|1388737_1389700_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001393987.1|1390007_1391840_-	ParB N-terminal domain-containing protein	NA	A5LH43	Enterobacteria_phage	97.8	1.0e-274
WP_032328194.1|1391966_1393436_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|1393632_1393818_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135263.1|1394034_1394532_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
WP_000839596.1|1394531_1394747_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
>prophage 5
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	1598091	1650798	4733683	integrase,lysis,protease,transposase,tRNA	Enterobacteria_phage(47.83%)	49	1587314:1587373	1659247:1660014
1587314:1587373	attL	GGTAGTGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTC	NA	NA	NA	NA
WP_001393886.1|1598091_1599204_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|1599280_1599433_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130653.1|1599885_1601004_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682524.1|1601069_1601318_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|1601382_1601751_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351480.1|1601844_1602498_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|1602605_1603853_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786320.1|1603920_1605297_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
WP_000573945.1|1605398_1608542_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|1608553_1609777_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|1609792_1610125_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|1610282_1611656_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|1611812_1612496_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253838.1|1612485_1613934_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_032327979.1|1614670_1616572_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	9.6e-26
WP_001160804.1|1616599_1617061_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_001289021.1|1617080_1621334_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_071608736.1|1621340_1621598_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.9	1.4e-12
WP_000889443.1|1621630_1621891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300892.1|1622016_1622178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072327956.1|1623141_1624278_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383906.1|1624548_1626660_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001355527.1|1626772_1629745_+	phage receptor	NA	NA	NA	NA	NA
WP_001224564.1|1629745_1630636_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177481.1|1630818_1631580_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001201820.1|1632093_1633047_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001393528.1|1634081_1634822_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355602.1|1635497_1635791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235988.1|1635801_1636506_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
WP_000654156.1|1636515_1636797_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_001395371.1|1636793_1637486_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	41.8	1.1e-40
WP_000453611.1|1637896_1638442_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001415975.1|1638830_1639025_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|1639384_1639678_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1639768_1639951_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|1640167_1640665_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|1640664_1640880_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737293.1|1641468_1642551_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	3.5e-166
WP_001204791.1|1642740_1643124_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001393963.1|1643209_1643350_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001099705.1|1643346_1643709_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000488419.1|1643778_1644057_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000446905.1|1644028_1644400_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|1644255_1645419_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_001310555.1|1646297_1647314_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000729160.1|1647667_1648534_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1648535_1648748_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|1648855_1649377_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1649412_1650798_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
1659247:1660014	attR	GACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCACTACCGACTACCGGTACCCGATATTGCGCCATTAAGGCTTTCGCCTGTTCAAAGGCTGGCGCAATATCTTCCGGTTTGAAGACCCGAATAGCTTTACAACCTAAACCTTCCGCTACTTTTACGTGGTCAACACCGTAGCCATTCACTTCACTGGAGTTGATATTCTCGAAAGCGAGTTGCACGCAGTAGTCCATGTCAAAAGCGCGTTGTGACTGACGAATCAGGCCGAGATAGGCGTTATTCACCAGCACATGGATGTACGGAATGTTGAACTGCGCGCCAACGGCTAACTCTTCAATCAGGAACTGGAAGTCAAAGTCGCCAGAAATCGCCACCACATTGCGTTTCGGATCAGCGGCACAAACCCCCAGCGCCGCCGGAATCGTCCAGCCTAACGGACCAGCCTGACCACAGTTGATCCAGTGGCGGTCTTTAAAGACATGCAGCATTTGTGCCGCAGCGATTTGTGACAGACCAATGGTGGTGACATAGCAAACATCGCGACCAAAGGCTTTGTTCATCTCTTCATACACGCGCTGCGGTTTCACCGGCACGTTGTCGAAATGGGTTTTGCGCAGCAAAGTGCGTTTGCGCTGCTGGCAGTCGGCGACCCATTCTTTACGACACGGCAGACGACCCGCTTTTTGCATCTCCTGCGCCACTTCAACCAGCAGTGTCAGCGCCGCTTTAGCATCAGAGACAATGCCGAGATC	NA	NA	NA	NA
>prophage 6
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	1880930	1891806	4733683	integrase	Vibrio_phage(33.33%)	11	1878474:1878489	1901220:1901235
1878474:1878489	attL	CAGCTACAGGGTCGTT	NA	NA	NA	NA
WP_032328363.1|1880930_1883036_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	4.2e-91
WP_054473707.1|1883035_1884502_-	DNA transfer protein	NA	B6SCW4	Bacteriophage	53.3	2.9e-107
WP_032235469.1|1884860_1885319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328654.1|1885551_1888308_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.1	8.9e-299
WP_032328337.1|1888320_1888923_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	1.2e-22
WP_000181940.1|1888915_1889137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|1889133_1889397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|1889393_1889588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001582517.1|1889580_1889799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000035054.1|1889960_1890164_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772646.1|1890591_1891806_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	2.2e-132
1901220:1901235	attR	AACGACCCTGTAGCTG	NA	NA	NA	NA
>prophage 7
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	2322324	2336182	4733683	integrase,transposase	Enterobacteria_phage(66.67%)	14	2321932:2321945	2327236:2327249
2321932:2321945	attL	GCGCTGGCGCGATT	NA	NA	NA	NA
WP_001355523.1|2322324_2323029_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	43.1	1.2e-42
WP_000783700.1|2323606_2325940_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
WP_000844963.1|2325954_2326275_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032327981.1|2326271_2326499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459282.1|2326603_2327053_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.3e-45
WP_001133040.1|2327045_2327345_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	6.9e-32
2327236:2327249	attR	GCGCTGGCGCGATT	NA	NA	NA	NA
WP_001355524.1|2327337_2327892_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.0	6.6e-36
WP_024171719.1|2327888_2328155_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	4.7e-24
WP_001317493.1|2329436_2330219_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001295213.1|2330215_2331238_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_000984214.1|2331465_2331708_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_000090076.1|2331724_2332300_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	51.9	2.3e-39
WP_001299662.1|2333530_2334550_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_001355687.1|2334679_2336182_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
>prophage 8
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	2421074	2488383	4733683	protease,integrase,tRNA,transposase	Stx2-converting_phage(18.75%)	59	2432101:2432118	2485082:2485099
WP_001232412.1|2421074_2422079_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2422081_2423341_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2423426_2424707_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2424782_2425091_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|2425176_2426127_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122513.1|2426119_2427967_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
WP_000990333.1|2427976_2429314_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|2429332_2429794_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001355561.1|2429765_2431313_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|2431311_2432451_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
2432101:2432118	attL	GAAGAGGATTTCAGCCCG	NA	NA	NA	NA
WP_010723271.1|2432433_2432487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|2433230_2433776_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|2433870_2434923_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|2435019_2435988_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236847.1|2436009_2439333_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001300174.1|2439482_2440985_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004770.1|2441203_2442181_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001192973.1|2442505_2444314_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|2444306_2445041_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|2445051_2445447_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|2445457_2445817_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001300820.1|2445879_2447013_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238369.1|2447101_2447635_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|2447631_2447949_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
WP_000239596.1|2448123_2448270_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|2448380_2448506_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|2448557_2449124_-	elongation factor P	NA	NA	NA	NA	NA
WP_004099820.1|2449165_2450194_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008049.1|2450588_2451458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|2451650_2452004_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|2452141_2453788_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2453831_2454125_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015821.1|2454400_2455657_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|2455672_2456149_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|2456485_2457922_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|2458039_2459341_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|2459456_2459795_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068922.1|2459770_2461468_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|2461504_2462080_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218741.1|2462438_2463629_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
WP_021517873.1|2464063_2465107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281244.1|2465249_2466923_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_021517875.1|2466988_2467186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766272.1|2467325_2467592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328150.1|2469207_2470287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328152.1|2470335_2471232_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000571845.1|2471655_2472402_-	porin family protein	NA	NA	NA	NA	NA
WP_001421562.1|2472631_2472802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032328154.1|2475793_2477329_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.4	9.5e-101
WP_001282653.1|2477345_2478101_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_021552170.1|2479043_2480168_+	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	30.3	4.6e-36
WP_032252217.1|2480124_2481627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190829.1|2482089_2482278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095033710.1|2482418_2483692_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.0e-176
WP_032327954.1|2484050_2484695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032252234.1|2484694_2484985_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001339397.1|2485767_2486445_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
2485082:2485099	attR	CGGGCTGAAATCCTCTTC	NA	NA	NA	NA
WP_000624622.1|2486444_2486792_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|2486811_2488383_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
>prophage 9
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	3854054	3862643	4733683	integrase,transposase	Stx2-converting_phage(42.86%)	8	3851669:3851685	3862847:3862863
3851669:3851685	attL	CCGGACTCGGAATCGAA	NA	NA	NA	NA
WP_000691818.1|3854054_3854276_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_001398324.1|3854412_3854592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001395295.1|3856139_3856364_+|transposase	transposase	transposase	Q76S41	Shigella_phage	70.8	1.2e-17
WP_000381401.1|3856528_3858100_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|3858119_3858467_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3858466_3859144_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001395296.1|3860018_3860942_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	3.0e-166
WP_001218852.1|3861380_3862643_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
3862847:3862863	attR	CCGGACTCGGAATCGAA	NA	NA	NA	NA
>prophage 10
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	4100255	4108194	4733683		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_001295182.1|4100255_4101017_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4101010_4101637_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|4101776_4102916_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4102978_4103971_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001136934.1|4105515_4106292_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|4106296_4106935_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|4106931_4108194_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
>prophage 11
NZ_CP024260	Escherichia coli strain F5656C1 chromosome, complete genome	4733683	4484388	4531686	4733683	head,integrase,terminase,tail,capsid,transposase,holin,plate,tRNA	Enterobacteria_phage(81.58%)	58	4490311:4490330	4516486:4516505
WP_000683789.1|4484388_4486395_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|4486553_4487774_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127751.1|4488038_4489217_+	arabinose transporter	NA	NA	NA	NA	NA
WP_000615834.1|4489213_4490209_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
4490311:4490330	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001420124.1|4491373_4491706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078916.1|4491883_4492024_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001299564.1|4492214_4492475_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032328495.1|4492517_4493627_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	2.4e-194
WP_001397420.1|4493784_4494969_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	5.8e-223
WP_000290450.1|4494968_4495481_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|4495535_4495901_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|4495936_4496065_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_001394249.1|4496051_4498859_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.6	0.0e+00
WP_000979954.1|4498871_4499360_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_044316995.1|4500460_4501306_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.8	2.0e-137
WP_000213447.1|4501309_4501660_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271913.1|4501656_4502238_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	5.6e-102
WP_032328494.1|4502234_4502870_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.6	2.6e-113
WP_000920594.1|4502862_4503330_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780572.1|4503467_4503875_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_032328493.1|4503871_4504264_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.7e-70
WP_000104350.1|4504260_4504584_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000865513.1|4504586_4504787_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.3e-31
WP_000063103.1|4504786_4505281_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632352.1|4505382_4506183_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	1.0e-138
WP_044316994.1|4506228_4507233_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	7.4e-179
WP_000599412.1|4509818_4510184_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	1.3e-59
WP_111986922.1|4510180_4510801_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	7.0e-10
WP_000714524.1|4510854_4511685_-	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	98.9	9.6e-132
WP_001036813.1|4511681_4511885_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_001274216.1|4511896_4512196_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	96.0	3.5e-44
WP_000153702.1|4512192_4512459_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	5.8e-30
WP_000985149.1|4512455_4512659_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	2.5e-25
WP_001583389.1|4512658_4512922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001363442.1|4513011_4513125_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	2.8e-10
WP_000514277.1|4513121_4513364_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_032328491.1|4513375_4513663_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000813363.1|4513673_4514015_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000200503.1|4514267_4514474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001705258.1|4514480_4514768_-	regulatory phage cox family protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	1.1e-23
WP_032327937.1|4514881_4515202_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	4.8e-15
WP_000023402.1|4515298_4516303_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001705257.1|4516461_4517619_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
4516486:4516505	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001289167.1|4517684_4518698_+	USG-1 protein	NA	NA	NA	NA	NA
WP_001283585.1|4518697_4519510_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_000364335.1|4519592_4520252_+	DedA family protein	NA	NA	NA	NA	NA
WP_000118404.1|4520407_4521322_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000584546.1|4521391_4522660_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000146992.1|4522649_4523312_+	cell division protein DedD	NA	NA	NA	NA	NA
WP_000262113.1|4523571_4524060_+	colicin V production protein	NA	NA	NA	NA	NA
WP_000334220.1|4524096_4525614_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000825700.1|4525708_4526278_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000748271.1|4526543_4527326_+	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000737621.1|4527546_4528329_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000965522.1|4528418_4529105_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000569958.1|4529101_4529818_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032327930.1|4529825_4530599_+	histidine ABC transporter ATP-binding protein HisP	NA	A0A2H4UUX5	Bodo_saltans_virus	25.1	2.0e-06
WP_000156149.1|4530795_4531686_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.9	8.9e-67
>prophage 1
NZ_CP024262	Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence	119846	0	49544	119846	transposase,protease	Escherichia_phage(25.0%)	50	NA	NA
WP_122994480.1|757_949_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095033721.1|1089_2368_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_085950855.1|2534_3228_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	7.5e-130
WP_140159966.1|3317_3545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001704819.1|3585_4263_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4262_4610_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|4629_6201_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_112059334.1|6121_6424_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001394776.1|7651_11746_+|protease	serine protease autotransporter toxin EatA	protease	Q9LA58	Enterobacterial_phage	39.5	3.3e-257
WP_001705742.1|14158_14800_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001159871.1|15843_16149_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|16150_16369_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343092.1|16813_17071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011387704.1|17070_17601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300024.1|17865_18687_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_064734538.1|18689_19778_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001699589.1|19782_20733_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001420717.1|20797_21742_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000115001.1|22658_23168_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	8.8e-19
WP_000865086.1|23544_23832_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	87.4	5.1e-40
WP_000483538.1|23831_24143_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	93.1	3.6e-47
WP_072328067.1|25114_25972_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|25964_26039_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083830.1|26275_26530_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001393319.1|26769_27360_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001393151.1|27511_28138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297500.1|28549_28759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840475.1|28889_29450_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704511.1|29552_30413_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000138370.1|32148_32541_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_071594518.1|32494_32869_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001230775.1|33280_34009_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399782.1|33995_34562_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012113.1|34583_34895_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001098998.1|34899_35262_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000089263.1|35294_35522_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_072328069.1|35658_36330_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001310555.1|36451_37468_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000124827.1|37722_38106_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_013188482.1|38428_39031_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001393327.1|39326_40148_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	1.7e-43
WP_000107522.1|40264_40552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272235.1|40707_41010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|41924_42083_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000845954.1|43069_43504_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_099524371.1|43558_44230_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_001393231.1|44257_45526_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	32.1	5.2e-20
WP_001254933.1|46021_47173_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_013188479.1|48396_48771_-	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	3.7e-51
WP_001378495.1|48767_49544_-	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	6.5e-122
>prophage 2
NZ_CP024262	Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence	119846	52565	54074	119846		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189123.1|52565_54074_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 3
NZ_CP024262	Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence	119846	57632	63850	119846	transposase	Escherichia_phage(40.0%)	8	NA	NA
WP_000471255.1|57632_57962_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	43.0	2.6e-08
WP_000780221.1|57942_58224_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_000710536.1|58546_59491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393279.1|59557_59908_-	plasmid stability family protein	NA	NA	NA	NA	NA
WP_000959870.1|59910_60873_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000219392.1|61339_62356_+|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_000343720.1|62471_63680_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_044307862.1|63676_63850_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	65.9	2.3e-11
>prophage 4
NZ_CP024262	Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence	119846	81235	84945	119846	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_095033721.1|81235_82515_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_000593828.1|84318_84945_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.1e-18
>prophage 5
NZ_CP024262	Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence	119846	99604	102414	119846	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_001310555.1|99604_100621_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000544814.1|101616_102414_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	98.5	4.7e-144
>prophage 6
NZ_CP024262	Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence	119846	107936	108743	119846	integrase	Macacine_betaherpesvirus(100.0%)	1	105324:105339	116815:116830
105324:105339	attL	TGTTATTGTCCGCCTC	NA	NA	NA	NA
WP_000016960.1|107936_108743_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	1.7e-53
WP_000016960.1|107936_108743_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	1.7e-53
116815:116830	attR	TGTTATTGTCCGCCTC	NA	NA	NA	NA
>prophage 7
NZ_CP024262	Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence	119846	116581	118894	119846	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998103.1|116581_118120_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.9	2.9e-291
WP_000612591.1|118169_118517_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|118513_118894_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
