The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	37461	116611	4852165	lysis,terminase,head,capsid,tail,integrase,protease,holin,portal,transposase	Enterobacteria_phage(48.33%)	91	64776:64822	116625:116671
WP_001300563.1|37461_38574_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956461.1|38766_38919_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_059214587.1|39142_39847_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000682533.1|40062_40311_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360934.1|40376_40760_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351472.1|40838_41492_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153159.1|41748_42996_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002430232.1|43154_44537_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_099587714.1|44781_47919_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.7e-59
WP_059258988.1|47930_49154_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_059258986.1|49169_49502_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_059258983.1|49524_50907_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_099587715.1|51063_51747_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	3.9e-30
WP_059258979.1|51736_53185_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.5	1.0e-11
WP_059258977.1|53621_54080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077871724.1|54462_54720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119047693.1|55253_55505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059258975.1|55509_55947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077871722.1|56324_56486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383893.1|57029_59255_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_059258971.1|59255_62228_+	phage receptor	NA	NA	NA	NA	NA
WP_059225453.1|62228_63119_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177448.1|63307_64069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059218863.1|64196_64688_+	hypothetical protein	NA	NA	NA	NA	NA
64776:64822	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|65245_66199_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|66448_67198_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000937469.1|67743_68004_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.7	3.2e-17
WP_122995109.1|68060_68729_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885633.1|68783_69368_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.3e-103
WP_099587716.1|69367_72328_-	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_052920618.1|72392_72992_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_099587717.1|73061_76457_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001351519.1|76517_77150_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	5.5e-95
WP_099587718.1|77086_77830_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.0e-145
WP_001152612.1|77835_78534_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847327.1|78533_78863_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	9.6e-59
WP_099587719.1|78859_81409_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.9	0.0e+00
WP_000459457.1|81401_81836_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_099587720.1|81817_82240_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.2e-71
WP_000381395.1|82972_84544_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|84563_84911_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|84910_85588_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000683105.1|85710_86106_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_099587721.1|86102_86681_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	1.0e-79
WP_000753019.1|86692_87046_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_099587722.1|87057_87453_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.0e-54
WP_000063260.1|87494_88520_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_099587723.1|88575_88908_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000123236.1|88917_90237_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_099587724.1|90217_91819_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.9e-310
WP_000198149.1|91815_92022_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_099587725.1|92018_93944_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|93918_94464_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_099587726.1|94852_95047_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_096941708.1|95234_95852_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	90.9	1.2e-99
WP_099587728.1|96001_96439_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.2	3.6e-69
WP_099587729.1|96435_96933_-	lysozyme	NA	A5LH83	Enterobacteria_phage	98.8	3.2e-90
WP_000839584.1|96932_97148_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	2.0e-33
WP_042005245.1|97337_98069_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592546.1|98420_99380_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|99572_100097_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|100252_100630_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|100715_100856_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099715.1|100852_101215_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_073533433.1|101211_101502_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	2.1e-46
WP_000224916.1|101494_101665_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054342.1|101664_102120_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|102116_102218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|102334_103132_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|103141_103693_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_099587730.1|104157_105684_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	1.0e-30
WP_001299444.1|105741_105891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070450.1|105938_106271_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|106338_106641_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788813.1|106637_107339_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_157760415.1|107335_108265_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	1.4e-110
WP_000184665.1|108921_109149_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712396.1|109259_109952_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000380252.1|110032_111094_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|111071_111449_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_023148105.1|111840_112131_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995443.1|112206_112503_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_000100847.1|112508_113294_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_033808535.1|113290_113971_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	3.0e-131
WP_000149544.1|113967_114150_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_024175668.1|114122_114308_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	1.7e-25
WP_099587732.1|114324_114606_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	6.1e-46
WP_042110340.1|114704_114923_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	2.2e-35
WP_000488407.1|114970_115249_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|115220_115592_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|115447_116611_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
116625:116671	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 2
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	317682	365675	4852165	plate,transposase	Stx2-converting_phage(25.0%)	42	NA	NA
WP_099587746.1|317682_318845_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.7	2.5e-53
WP_059256654.1|319430_320474_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_059234400.1|320477_321296_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000061297.1|321306_322320_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000893293.1|322693_323947_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.5e-96
WP_001285285.1|323958_325062_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	1.1e-61
WP_000749853.1|325349_326405_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	4.2e-116
WP_000174680.1|326505_326907_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_059216054.1|326964_328209_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291989.1|328301_328760_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292996.1|329020_330478_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077871721.1|331029_332262_-	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_099587747.1|332336_333281_+	DUF4424 family protein	NA	NA	NA	NA	NA
WP_059218775.1|333480_334095_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_099587748.1|334091_335231_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	30.6	3.8e-30
WP_072179122.1|335476_335929_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059217800.1|335925_336981_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_099588151.1|337110_337878_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_059256729.1|337822_339562_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598761.1|339667_339946_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030481.1|339938_340295_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_059216059.1|340351_341101_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	1.2e-19
WP_001225662.1|341413_342154_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_025237577.1|342124_342892_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|343096_343675_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_099587749.1|343914_346359_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_002430282.1|346400_346847_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000015778.1|347025_347796_+	amidohydrolase	NA	NA	NA	NA	NA
WP_059258803.1|348349_349486_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000807558.1|349675_350005_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_000381395.1|350037_351609_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|351628_351976_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|351975_352653_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001017804.1|352754_353048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099587750.1|353044_357367_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.2	3.6e-28
WP_000860986.1|357385_357817_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_077871717.1|357813_359766_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.9	7.0e-24
WP_001142955.1|359975_360494_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037393.1|361139_361640_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059217724.1|361934_363401_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032278988.1|363407_363821_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059260056.1|363824_365675_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	610782	706227	4852165	lysis,terminase,head,capsid,tail,integrase,portal,tRNA,transposase	Enterobacteria_phage(31.82%)	102	617589:617614	709399:709424
WP_001300563.1|610782_611895_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118445.1|612157_613288_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	3.6e-28
WP_000516135.1|613376_615293_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000833521.1|615667_616072_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102345.1|616098_616812_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528545.1|616959_617526_+	acetate uptake transporter	NA	NA	NA	NA	NA
617589:617614	attL	CGGATGCGGCGTGAACGCCTTATCCG	NA	NA	NA	NA
WP_001094685.1|617734_618322_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130184.1|618436_619390_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.2e-10
WP_059257946.1|619670_621101_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000906164.1|621170_621947_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_000738743.1|622099_622396_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_054409896.1|622608_623895_-	threonine synthase	NA	NA	NA	NA	NA
WP_059257948.1|623895_624828_-	homoserine kinase	NA	NA	NA	NA	NA
WP_054409900.1|624829_627292_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|627372_627438_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_059257954.1|627651_628338_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|628737_628878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|628973_629690_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_059257955.1|629885_631238_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219553.1|631295_632720_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.1	5.9e-12
WP_059257956.1|632719_633409_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.4	8.8e-30
WP_000875489.1|633421_633895_-	protein CreA	NA	NA	NA	NA	NA
WP_000371660.1|634106_634976_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_054409906.1|634972_635620_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_054410007.1|635671_636184_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068677.1|636329_636656_-	trp operon repressor	NA	NA	NA	NA	NA
WP_059214681.1|636745_638683_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046764.1|638889_640557_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	3.7e-42
WP_000093821.1|640677_641910_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.2e-82
WP_001029698.1|641930_643313_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132970.1|643361_644330_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124621.1|644435_645080_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_059257957.1|645107_646124_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224873.1|646200_646920_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|646976_648200_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477805.1|648251_649574_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.0	8.0e-80
WP_002430325.1|649700_650480_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143197.1|650737_652288_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_054409914.1|652259_653123_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_054409916.1|653270_654053_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000531524.1|654049_655123_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|655245_655407_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_044710474.1|655533_656139_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_025237715.1|656530_658117_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	9.1e-30
WP_097485514.1|658336_658585_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	1.6e-37
WP_123009266.1|658944_659964_-	peptidase M85	NA	NA	NA	NA	NA
WP_099587773.1|660190_662563_-	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
WP_097485517.1|662774_663044_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_099587774.1|663045_664359_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_099587775.1|664423_665023_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.5e-110
WP_099587776.1|665090_668486_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.8	0.0e+00
WP_141116377.1|668546_669179_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.6	1.0e-93
WP_099587778.1|669115_669859_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	8.6e-148
WP_099587779.1|669864_670563_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_001471428.1|670562_670892_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	8.4e-55
WP_099587780.1|670888_673468_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.4	0.0e+00
WP_024228736.1|673460_673886_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	9.8e-64
WP_099587781.1|673867_674290_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	1.3e-68
WP_099588152.1|674305_675046_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.7	4.0e-129
WP_099587782.1|675053_675449_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	96.9	3.2e-69
WP_099587783.1|675445_675979_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	70.8	7.4e-61
WP_099587784.1|675990_676344_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	2.2e-61
WP_099587785.1|676355_676709_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	86.4	2.7e-51
WP_099587786.1|676751_677714_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.2	7.4e-176
WP_000624622.1|679344_679692_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|679691_680369_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001358596.1|680538_680871_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_099587787.1|680880_682200_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	94.5	2.2e-223
WP_001316285.1|682180_683782_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_000198149.1|683778_683985_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_021559951.1|683981_685907_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	97.2	0.0e+00
WP_021559710.1|685878_686385_-	hypothetical protein	NA	O64316	Escherichia_phage	48.1	8.1e-33
WP_052924637.1|686801_686996_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	2.2e-26
WP_099587788.1|687286_687544_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	3.3e-38
WP_099587789.1|687540_688038_-	DNA-binding protein	NA	S4TSR0	Salmonella_phage	98.8	6.9e-93
WP_099587790.1|688235_688673_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	96.6	3.6e-69
WP_001135298.1|688669_689167_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	3.8e-91
WP_000839596.1|689166_689382_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|689449_690502_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|690652_690856_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_099587791.1|691109_691862_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.4	4.5e-136
WP_099587792.1|691875_692865_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	3.3e-195
WP_099587793.1|692872_693670_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	2.2e-149
WP_000767105.1|693689_694079_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210154.1|694075_694402_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001373735.1|694398_695052_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	4.7e-126
WP_099587794.1|695051_695546_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	5.6e-87
WP_000061519.1|695542_696361_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_000620696.1|696357_696582_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_099587795.1|696578_697730_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	98.4	2.0e-212
WP_000515860.1|697726_698278_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001191669.1|698270_698531_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001311077.1|698628_699321_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000135680.1|700043_700406_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_021532169.1|700471_701296_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	7.8e-150
WP_099587798.1|701423_701960_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	1.4e-99
WP_059339258.1|701950_702316_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_099587799.1|702312_702933_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	90.8	2.8e-112
WP_059339260.1|702932_703127_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	95.3	6.5e-31
WP_001570646.1|703759_704506_+	hypothetical protein	NA	J9Q719	Salmonella_phage	37.4	3.2e-09
WP_001570645.1|704502_704916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099587800.1|704991_706227_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	96.8	2.1e-231
709399:709424	attR	CGGATGCGGCGTGAACGCCTTATCCG	NA	NA	NA	NA
>prophage 4
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	1211110	1284283	4852165	lysis,terminase,head,plate,tail,capsid,protease,holin,portal,integrase,tRNA	Escherichia_phage(37.78%)	84	1235485:1235531	1266586:1266632
WP_000208242.1|1211110_1211641_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293346.1|1211650_1212982_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	2.2e-45
WP_010342312.1|1213048_1213975_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872905.1|1214067_1214553_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_149012927.1|1214903_1215530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296623.1|1215568_1215814_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084280.1|1216238_1217084_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	5.7e-15
WP_000136774.1|1217106_1218615_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250632.1|1218812_1219823_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796308.1|1219919_1220666_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323550.1|1220670_1221099_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655995.1|1221110_1221410_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155267.1|1221619_1222060_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000834911.1|1222160_1222760_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216333.1|1222867_1223635_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001026700.1|1223668_1224262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024165365.1|1224258_1225761_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	5.6e-13
WP_001175923.1|1225791_1226775_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000077983.1|1226807_1227818_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000090274.1|1227804_1229268_-	xylulokinase	NA	NA	NA	NA	NA
WP_000065503.1|1229273_1229915_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_000027396.1|1230114_1231053_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010342322.1|1231190_1231946_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_044707936.1|1232050_1233040_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001355350.1|1233359_1234322_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076754.1|1234503_1235406_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
1235485:1235531	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|1235642_1235861_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882969.1|1235942_1237106_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_000978889.1|1237105_1237585_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_099587837.1|1237599_1240047_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.0	0.0e+00
WP_000785970.1|1240039_1240159_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|1240191_1240467_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|1240524_1241043_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_099587838.1|1241055_1242246_-|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	99.0	5.3e-224
WP_099587839.1|1242545_1243652_+	DUF3800 domain-containing protein	NA	U5N3F3	Enterobacteria_phage	95.7	4.3e-204
WP_089537083.1|1243751_1244144_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	61.4	5.5e-37
WP_099587840.1|1244329_1246147_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	58.9	1.5e-113
WP_001285328.1|1246157_1246688_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	97.7	6.2e-100
WP_099587841.1|1246680_1247589_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	1.3e-161
WP_099587842.1|1247593_1247941_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	98.3	1.1e-57
WP_099587843.1|1247937_1248573_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	3.8e-112
WP_001001786.1|1248639_1249092_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_099587844.1|1249084_1249552_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	9.7e-81
WP_001300730.1|1249514_1249688_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040652.1|1249659_1250085_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	1.6e-66
WP_001712252.1|1250072_1250498_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
WP_042064036.1|1250512_1251010_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_000123124.1|1251009_1251291_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846409.1|1251294_1251498_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988639.1|1251497_1252007_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_099587845.1|1252106_1252844_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	99.2	1.8e-129
WP_001248583.1|1252847_1253921_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_001085948.1|1253979_1254834_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156872.1|1255007_1256780_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_099587846.1|1256779_1257814_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	96.5	1.4e-196
WP_099587847.1|1258244_1260452_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099587848.1|1260682_1262971_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.0	0.0e+00
WP_099587849.1|1262960_1263236_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.1e-44
WP_001113273.1|1263232_1263457_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	6.5e-35
WP_001277904.1|1263456_1263759_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	99.0	5.9e-47
WP_000557701.1|1263758_1263983_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217670.1|1264046_1264547_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|1264716_1264989_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|1265125_1265419_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985242.1|1265488_1266469_+|integrase	site-specific integrase	integrase	Q858U3	Yersinia_virus	100.0	4.7e-186
WP_059259712.1|1266655_1267156_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
1266586:1266632	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033724.1|1267305_1268007_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580409.1|1268003_1269377_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.2	3.2e-15
WP_044712301.1|1269547_1270222_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002460606.1|1270291_1270912_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	1.0e-61
WP_099587850.1|1271175_1272231_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000753602.1|1272384_1273218_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_149012926.1|1273411_1276462_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_059259645.1|1276474_1277377_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829019.1|1277373_1278009_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027704.1|1278005_1278935_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001314326.1|1279800_1280019_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_032278934.1|1280417_1280696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197774.1|1280757_1280970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|1281054_1281345_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000897299.1|1281345_1281657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010342110.1|1281885_1282794_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059259649.1|1282859_1283801_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560979.1|1283845_1284283_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	1533491	1547577	4852165	integrase	Enterobacteria_phage(90.0%)	15	1536189:1536211	1547738:1547760
WP_059259250.1|1533491_1534529_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.3	1.4e-68
WP_072178993.1|1534602_1535223_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_099587863.1|1535222_1536023_-|integrase	site-specific integrase	integrase	Q7M297	Enterobacteria_phage	70.0	2.9e-109
1536189:1536211	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_063078412.1|1536687_1539021_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_000856729.1|1539035_1539356_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459302.1|1539491_1539947_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|1539939_1540227_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980222.1|1540219_1540810_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	4.1e-60
WP_001149160.1|1540806_1541073_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_063078413.1|1541625_1542360_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	8.8e-129
WP_000638635.1|1542356_1542857_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446136.1|1542930_1543503_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_001393214.1|1543875_1544883_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_021501220.1|1544989_1546324_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_001392828.1|1546404_1547577_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	89.9	1.7e-203
1547738:1547760	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 6
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	2570428	2577569	4852165		Escherichia_phage(66.67%)	6	NA	NA
WP_099587915.1|2570428_2571067_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	4.9e-83
WP_000590375.1|2571063_2572326_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	3.7e-135
WP_059221372.1|2572322_2573231_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	6.6e-118
WP_099587916.1|2573426_2574194_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	1.8e-68
WP_059258517.1|2574244_2574901_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	44.9	2.1e-49
WP_025238495.1|2575007_2577569_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	3.5e-31
>prophage 7
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	2648810	2750736	4852165	terminase,integrase,capsid,head,tail,plate,holin,portal,tRNA	Enterobacteria_phage(76.27%)	113	2664285:2664300	2711481:2711496
WP_099587924.1|2648810_2651144_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_000856729.1|2651158_2651479_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_099587925.1|2651614_2652070_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	2.3e-63
WP_001244665.1|2652062_2652350_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_001149160.1|2652892_2653159_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283029.1|2653710_2654445_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_000638628.1|2654441_2654942_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446132.1|2655014_2655587_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_039023248.1|2655841_2656882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094249644.1|2656884_2658174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094249643.1|2658245_2659442_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.9	7.2e-104
WP_000162574.1|2660201_2660684_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_059258476.1|2660815_2661292_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000014575.1|2661281_2661572_+	RnfH family protein	NA	NA	NA	NA	NA
WP_000115842.1|2661583_2662090_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_001203437.1|2662157_2662499_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_059258474.1|2662647_2664309_-	DNA repair protein RecN	NA	NA	NA	NA	NA
2664285:2664300	attL	TGCTGATGGTCAGTTG	NA	NA	NA	NA
WP_001059177.1|2664394_2665273_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002461510.1|2665394_2665988_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077629426.1|2666041_2667328_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_024165303.1|2667347_2668139_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_059258472.1|2668305_2669667_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|2669915_2670164_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_059258470.1|2670182_2670731_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264780.1|2670761_2671529_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065254.1|2671571_2671919_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_059236572.1|2671995_2672478_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000368161.1|2672493_2673717_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212382.1|2673709_2674228_-	YfiR family protein	NA	NA	NA	NA	NA
WP_010337216.1|2674368_2674734_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168028.1|2674943_2676014_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.2e-89
WP_000225199.1|2676024_2677146_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_059258468.1|2677188_2678349_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_012599914.1|2678447_2678495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974887.1|2678662_2679652_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_001242988.1|2679718_2680021_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001001391.1|2680116_2680443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813368.1|2680461_2680803_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	4.3e-54
WP_000159462.1|2680813_2681092_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000514277.1|2681103_2681346_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021648.1|2681342_2681456_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	4.3e-11
WP_022631068.1|2681549_2681960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2681983_2682187_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|2682183_2682450_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104296.1|2682446_2682746_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	2.8e-41
WP_022631069.1|2683071_2683302_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	88.2	1.0e-27
WP_021549223.1|2683374_2683764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099587927.1|2683760_2686601_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686512.1|2686677_2687637_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.9e-179
WP_000211253.1|2687641_2687953_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	99.0	1.2e-50
WP_099587928.1|2688016_2688352_+	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	94.4	2.8e-50
WP_097178037.1|2688412_2688937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095653.1|2689109_2689703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000598767.1|2689712_2690093_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000087812.1|2690635_2691682_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001376476.1|2691681_2693433_-|terminase	ATPase subunit of terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
WP_001694523.1|2693587_2694424_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	2.5e-119
WP_001677415.1|2694447_2695500_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	91.7	1.4e-183
WP_000632332.1|2695545_2696346_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.4e-124
WP_000063075.1|2696448_2696943_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	9.2e-90
WP_000864901.1|2696942_2697143_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104342.1|2697145_2697469_+|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	100.0	4.2e-51
WP_000072327.1|2697465_2697858_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_032083488.1|2697854_2698262_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	2.0e-66
WP_000920588.1|2698399_2698867_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	3.8e-85
WP_099587929.1|2698859_2699495_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.6	1.5e-113
WP_001366983.1|2699491_2700073_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
WP_099587930.1|2700069_2700420_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	9.2e-60
WP_001111951.1|2700423_2701320_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
WP_099587931.1|2701312_2701921_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.4	2.6e-86
WP_099587932.1|2701917_2703552_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.6	2.8e-143
WP_021549529.1|2703551_2704154_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.5	2.4e-100
WP_032344430.1|2704125_2704566_-|tail	phage tail fiber protein	tail	A0A0F7LDZ0	Escherichia_phage	59.2	2.6e-43
WP_000905083.1|2704945_2705545_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.9	6.8e-87
WP_000979945.1|2705571_2706060_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_099587933.1|2706072_2708880_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.0	0.0e+00
WP_000763327.1|2708866_2708995_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|2709030_2709396_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290466.1|2709450_2709963_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	96.5	3.3e-90
WP_099587934.1|2709962_2711147_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	9.0e-224
WP_099587935.1|2711304_2712405_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.2	1.3e-205
2711481:2711496	attR	TGCTGATGGTCAGTTG	NA	NA	NA	NA
WP_000488107.1|2712447_2712708_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078918.1|2712898_2713039_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001519189.1|2713174_2713471_+	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_001353016.1|2713660_2713858_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000215751.1|2713802_2714609_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.2e-65
WP_000178456.1|2714759_2715101_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197669.1|2715371_2716109_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_044709370.1|2716243_2717224_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_001037496.1|2717220_2717952_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_059258466.1|2718081_2720655_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	3.4e-127
WP_054412346.1|2726556_2727855_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.1	4.3e-46
WP_077871707.1|2727851_2728175_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_059244493.1|2728218_2729574_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_059258154.1|2729687_2732348_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002461520.1|2732379_2733078_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098724.1|2733146_2733566_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.5	3.7e-15
WP_044709878.1|2733772_2734810_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_072248880.1|2734888_2735257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059219108.1|2735435_2736827_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_054412338.1|2737070_2738000_-	electron transfer flavoprotein	NA	NA	NA	NA	NA
WP_001237163.1|2738020_2738785_-	electron transfer flavoprotein	NA	NA	NA	NA	NA
WP_000347811.1|2738781_2739942_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010342840.1|2740452_2741619_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_054412335.1|2741741_2743049_+	MFS transporter	NA	NA	NA	NA	NA
WP_059258156.1|2743100_2744315_+	CoA transferase	NA	NA	NA	NA	NA
WP_000127388.1|2744524_2745439_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000013025.1|2745484_2746174_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.1e-56
WP_059258157.1|2746478_2746862_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	1.2e-33
WP_025238551.1|2746928_2747516_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_059258158.1|2747618_2748500_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219189.1|2748532_2749867_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_010318577.1|2749998_2750736_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	3199832	3209279	4852165		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569309.1|3199832_3200759_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783146.1|3200763_3201495_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001216963.1|3201475_3201583_-	protein YohO	NA	NA	NA	NA	NA
WP_099587965.1|3201642_3202374_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	96.0	8.5e-108
WP_059258363.1|3202595_3204281_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	97.5	3.5e-298
WP_002461811.1|3204277_3204997_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950403.1|3205043_3205514_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	96.8	2.2e-80
WP_000643193.1|3205556_3206018_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	89.5	8.4e-69
WP_099587966.1|3206148_3208146_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	85.1	0.0e+00
WP_059257731.1|3208142_3209279_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	94.1	8.8e-160
>prophage 9
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	3257288	3325205	4852165	terminase,integrase,head,tail,capsid,protease,holin,portal,tRNA	Enterobacteria_phage(46.38%)	79	3252681:3252698	3325075:3325092
3252681:3252698	attL	TCACGCGTTGGCGCACAA	NA	NA	NA	NA
WP_000129169.1|3257288_3258188_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	1.5e-13
WP_059219458.1|3258521_3259067_-	cytolethal distending toxin type II subunit CdtC	NA	M1SNM4	Escherichia_phage	90.1	8.3e-92
WP_059236512.1|3259081_3259891_-	cytolethal distending toxin type II nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	94.1	5.0e-141
WP_072179090.1|3259887_3260664_-	cytolethal distending toxin type II subunit CdtA	NA	G1BEM3	Escherichia_phage	93.8	1.1e-126
WP_000476034.1|3261323_3262685_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	98.4	2.3e-215
WP_054412170.1|3262832_3263165_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137864.1|3263352_3264075_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	3.7e-31
WP_059258394.1|3264071_3265475_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	4.1e-34
WP_059217479.1|3265471_3266878_-	MFS transporter	NA	NA	NA	NA	NA
WP_098401025.1|3266878_3269956_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_059258401.1|3269956_3273079_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_099587970.1|3273078_3274326_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_059219450.1|3274694_3275768_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	97.5	1.4e-196
WP_059219449.1|3275745_3275964_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	3.7e-35
WP_000545733.1|3276003_3276171_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_059219448.1|3276243_3276528_-	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	90.4	7.5e-44
WP_024238365.1|3276527_3276749_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	2.1e-33
WP_077870778.1|3276847_3277129_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	97.8	6.1e-46
WP_099587971.1|3277139_3277487_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	3.0e-26
WP_059273626.1|3277483_3278164_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	8.7e-131
WP_000100845.1|3278160_3278946_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_001518556.1|3278951_3279248_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000358700.1|3279322_3279466_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_001198858.1|3279458_3279599_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065373.1|3279671_3280040_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_059222278.1|3280235_3280685_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	80.5	2.2e-61
WP_000930321.1|3280819_3281158_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_059222277.1|3281160_3281466_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	96.0	2.5e-45
WP_059222276.1|3281780_3282431_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	99.5	5.4e-122
WP_000276885.1|3282511_3282697_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_059222275.1|3282812_3283109_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	99.0	4.0e-48
WP_053294713.1|3283141_3284041_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	3.2e-173
WP_000788878.1|3284037_3284739_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|3284735_3285026_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229808.1|3285098_3285305_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_000814618.1|3285312_3285723_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	2.0e-69
WP_099587972.1|3285719_3285902_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	95.0	2.4e-27
WP_000567000.1|3285898_3286069_+	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_059242596.1|3286061_3286682_+	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	97.6	5.7e-97
WP_059217943.1|3286678_3286885_+	protein ninH	NA	Q716C0	Shigella_phage	98.5	2.8e-32
WP_099587973.1|3286862_3287528_+	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	95.5	9.7e-127
WP_059222269.1|3287739_3288699_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|3289035_3289158_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|3289172_3289862_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_059222268.1|3290069_3290783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284524.1|3292510_3292726_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_032274775.1|3292725_3293223_+	lysozyme	NA	A5LH83	Enterobacteria_phage	98.8	1.9e-90
WP_123057731.1|3293439_3293646_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	89.7	6.0e-27
WP_059222296.1|3293900_3294455_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	87.0	1.5e-85
WP_001569616.1|3294954_3295464_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	32.2	3.6e-12
WP_099587974.1|3295435_3297364_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	2.5e-260
WP_000259002.1|3297347_3297554_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_059222294.1|3297550_3299143_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	2.7e-183
WP_099587975.1|3299132_3300638_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	1.1e-98
WP_099587976.1|3300674_3301022_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.2e-21
WP_000522651.1|3301079_3302108_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201526.1|3302159_3302534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024008569.1|3302526_3302880_+|head,tail	phage head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	65.0	4.5e-38
WP_059272229.1|3302891_3303470_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	2.5e-78
WP_000683112.1|3303466_3303862_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_099588159.1|3303869_3304610_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.7	2.0e-128
WP_032329098.1|3304625_3305048_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_099587977.1|3305029_3305455_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.1e-62
WP_099587978.1|3305447_3308009_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.4	0.0e+00
WP_000847354.1|3308005_3308335_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	8.1e-58
WP_024241847.1|3308334_3309033_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_099587979.1|3309038_3309782_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	6.6e-148
WP_059274999.1|3309718_3310321_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	6.8e-87
WP_059257279.1|3310363_3310885_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	66.1	1.0e-62
WP_099587980.1|3311018_3314432_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.5	0.0e+00
WP_099587981.1|3314501_3315101_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	8.2e-109
WP_099588160.1|3315165_3318129_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	92.3	2.6e-54
WP_000631342.1|3318125_3319028_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	64.3	1.4e-99
WP_099587982.1|3319036_3319618_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.1	1.3e-98
WP_099587983.1|3319933_3320569_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	71.3	8.6e-56
WP_064763529.1|3320643_3321288_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	63.7	3.5e-65
WP_099587984.1|3321594_3322917_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	76.2	7.7e-200
WP_102204210.1|3323509_3323566_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_099587985.1|3323852_3325205_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.9e-07
3325075:3325092	attR	TCACGCGTTGGCGCACAA	NA	NA	NA	NA
>prophage 10
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	3403100	3454157	4852165	terminase,integrase,head,tail,capsid,holin,portal,transposase	Enterobacteria_phage(38.3%)	57	3388089:3388103	3459818:3459832
3388089:3388103	attL	TGGCATAAAAACCGT	NA	NA	NA	NA
WP_000533623.1|3403100_3404126_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	6.8e-103
WP_000096344.1|3404125_3404329_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000560212.1|3406983_3407205_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_001133037.1|3407773_3407983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054413035.1|3407983_3408622_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.7	2.8e-06
WP_000379569.1|3408633_3408786_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_054413029.1|3409055_3409772_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	2.2e-52
WP_000471549.1|3409821_3410037_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_059260010.1|3410033_3410459_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_054413025.1|3410530_3411601_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.1	1.0e-61
WP_054413023.1|3411641_3412064_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	1.1e-62
WP_021559922.1|3412306_3412891_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059260009.1|3412911_3413355_-	acetyltransferase	NA	NA	NA	NA	NA
WP_099588007.1|3413997_3415086_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_000813254.1|3415157_3415313_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_054413019.1|3415480_3415759_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_054413017.1|3415760_3416816_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	46.7	1.3e-85
WP_054413016.1|3416816_3417182_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.2e-39
WP_054413014.1|3417178_3417868_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.3e-60
WP_054413140.1|3418776_3420615_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	93.2	0.0e+00
WP_000411809.1|3421050_3421257_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_054413138.1|3421260_3421818_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	82.1	3.3e-51
WP_054413136.1|3421829_3422144_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	76.9	1.2e-39
WP_001682408.1|3422200_3422878_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3422877_3423225_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3423244_3424816_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_059236931.1|3424979_3425513_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	6.2e-100
WP_125317456.1|3426029_3426215_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	4.1e-19
WP_059260008.1|3426711_3427026_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032275416.1|3427106_3427331_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	76.1	1.9e-18
WP_000235446.1|3427722_3428232_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_099588010.1|3428203_3430132_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.1e-262
WP_000259002.1|3430115_3430322_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_054413003.1|3430318_3431911_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_099588011.1|3431900_3433406_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	2.1e-100
WP_000256840.1|3433442_3433790_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|3433847_3434876_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|3434927_3435302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054412997.1|3435294_3435648_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	4.3e-41
WP_000975035.1|3435662_3436238_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
WP_000683071.1|3436234_3436630_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_054412995.1|3436637_3437390_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	2.2e-127
WP_000479086.1|3437403_3437835_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|3437861_3438275_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_099588012.1|3438255_3440829_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	76.9	0.0e+00
WP_000847354.1|3440825_3441155_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	8.1e-58
WP_024241847.1|3441154_3441853_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_099588013.1|3441858_3442602_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.2e-149
WP_059274999.1|3442538_3443141_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	6.8e-87
WP_099588014.1|3443183_3443657_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	72.5	4.6e-62
WP_099588015.1|3443837_3447251_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.0	0.0e+00
WP_099588016.1|3447312_3448554_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	89.5	5.8e-72
WP_099588017.1|3448555_3448825_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	1.2e-43
WP_122988840.1|3448935_3449013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298831.1|3449034_3449625_+	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	58.9	2.3e-23
WP_059234940.1|3449674_3452047_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
WP_099588018.1|3452884_3454157_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.5e-168
3459818:3459832	attR	TGGCATAAAAACCGT	NA	NA	NA	NA
>prophage 11
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	3967980	3976136	4852165	integrase,tRNA,transposase	Enterobacteria_phage(50.0%)	8	3963022:3963037	3983035:3983050
3963022:3963037	attL	TTTAATTTCACCGCTC	NA	NA	NA	NA
WP_000836970.1|3967980_3969099_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.7	7.9e-113
WP_010340763.1|3969239_3969674_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	2.7e-29
WP_059258769.1|3969677_3969923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059221914.1|3970962_3971403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099588056.1|3971443_3972502_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M3LR35	Mannheimia_phage	23.8	2.9e-08
WP_071987653.1|3972962_3973598_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	53.0	2.4e-34
WP_072244032.1|3974067_3974703_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	47.9	1.4e-45
WP_099588057.1|3975200_3976136_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	4.5e-146
3983035:3983050	attR	GAGCGGTGAAATTAAA	NA	NA	NA	NA
>prophage 12
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	4131581	4284851	4852165	lysis,terminase,head,plate,tail,capsid,protease,holin,portal,integrase,tRNA,transposase	Shigella_phage(30.61%)	168	4233740:4233758	4286747:4286765
WP_085949839.1|4131581_4132190_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505869.1|4132306_4133398_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_059256581.1|4133558_4135478_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733744.1|4135705_4136776_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_054410473.1|4136786_4137419_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_010340955.1|4137429_4138848_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_054410474.1|4138982_4140674_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000060156.1|4142231_4143254_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054410475.1|4143253_4144240_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_059259558.1|4144236_4144995_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.1	2.3e-15
WP_000904005.1|4145004_4145817_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000576811.1|4145813_4146668_+	ModD protein	NA	NA	NA	NA	NA
WP_010340962.1|4146693_4148664_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511318.1|4148713_4148968_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_059228801.1|4149168_4149903_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_002462038.1|4149904_4150516_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_059259560.1|4150615_4151530_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000338383.1|4151625_4153362_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_059251002.1|4153420_4154491_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_059259562.1|4154500_4155799_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190846.1|4156128_4157661_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|4157811_4158531_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406417.1|4158752_4160294_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943450.1|4160439_4160970_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_001019911.1|4161192_4161807_-	YagU family protein	NA	NA	NA	NA	NA
WP_000693760.1|4162402_4162804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738417.1|4163024_4163318_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	88.7	6.5e-43
WP_000737250.1|4164199_4165297_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.4	3.3e-156
WP_000807619.1|4165779_4166241_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_025237142.1|4166317_4166977_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_024164782.1|4167048_4167342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002462028.1|4167467_4168157_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101044.1|4168180_4168993_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|4168996_4169263_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_099588068.1|4169648_4174076_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001068152.1|4174549_4174678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000725791.1|4174679_4175024_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_002462020.1|4175033_4175363_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001065864.1|4175576_4175795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059216628.1|4176733_4177681_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_059216629.1|4177896_4178559_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_076739731.1|4178805_4179396_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	38.9	3.3e-17
WP_059216630.1|4179872_4180415_+	transferase	NA	NA	NA	NA	NA
WP_054413128.1|4180594_4180981_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	78.2	8.9e-48
WP_095573847.1|4181018_4181162_-	hypothetical protein	NA	M1FJ79	Enterobacteria_phage	84.8	1.3e-12
WP_107192250.1|4181192_4181411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817715.1|4181560_4182460_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059216632.1|4182597_4183518_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072251074.1|4183640_4183805_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.1e-23
WP_001547431.1|4186418_4187957_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|4188006_4188354_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_072157534.1|4188350_4188731_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_099588164.1|4188845_4188995_+	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_097730548.1|4189248_4189824_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.3	7.3e-54
WP_099588069.1|4189823_4190426_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	85.0	1.4e-92
WP_099588070.1|4190397_4190826_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.7	3.7e-26
WP_032241159.1|4190827_4191145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052908571.1|4191415_4192000_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.2e-113
WP_099588071.1|4191990_4193049_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	99.4	3.3e-201
WP_157760416.1|4193035_4193461_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	98.6	2.6e-80
WP_001544766.1|4193460_4194009_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	1.1e-96
WP_099588073.1|4194008_4195088_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.5e-206
WP_123057903.1|4195084_4196413_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.0	3.9e-244
WP_099588075.1|4196473_4198309_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	3.8e-306
WP_000661047.1|4198450_4198720_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4198719_4199076_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_099588076.1|4199075_4200572_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.6	8.5e-272
WP_000497751.1|4200555_4200726_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|4200734_4201295_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_099588077.1|4201291_4201798_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	98.8	1.1e-90
WP_099588078.1|4201772_4202183_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	1.3e-73
WP_000927719.1|4202179_4202503_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|4202505_4202706_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_046076246.1|4202755_4203961_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	1.3e-222
WP_001193635.1|4203975_4204626_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.6	2.4e-117
WP_000466255.1|4204603_4205845_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_053274863.1|4205844_4206027_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	5.0e-25
WP_072011717.1|4206038_4207535_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929184.1|4207768_4208263_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_097320829.1|4208388_4208739_-	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	87.1	1.5e-57
WP_089537316.1|4209576_4210038_-|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	90.1	1.1e-68
WP_021540768.1|4210021_4210498_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	98.1	4.9e-88
WP_001120496.1|4210501_4210828_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_099588079.1|4211156_4212092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047653682.1|4212226_4212694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097320834.1|4212713_4213061_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.8	2.7e-56
WP_097320837.1|4213078_4214068_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.1e-193
WP_099588080.1|4214075_4214873_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767113.1|4214892_4215282_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_099588081.1|4215278_4215605_-	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	97.2	2.5e-51
WP_001373735.1|4215601_4216255_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	4.7e-126
WP_099588082.1|4216254_4216749_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.1e-85
WP_000104942.1|4216745_4217687_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|4217676_4217856_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|4218031_4218583_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649480.1|4218626_4218827_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_099588083.1|4218917_4219592_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	4.6e-132
WP_000549626.1|4219826_4220033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|4220004_4220439_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000939946.1|4220932_4221178_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_099588084.1|4221158_4222286_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	1.4e-122
WP_099588085.1|4222436_4224308_-	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_099588086.1|4224317_4226864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000444485.1|4227285_4228536_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.1e-22
WP_059259566.1|4228706_4229360_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_054412802.1|4229369_4229831_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001516209.1|4229884_4230991_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_099588165.1|4231026_4231668_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_025237149.1|4231671_4233042_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	1.2e-107
WP_001265484.1|4233209_4233881_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
4233740:4233758	attL	GCTCTACCCGGATGCTGAA	NA	NA	NA	NA
WP_000735428.1|4233880_4235341_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_059244940.1|4235416_4236538_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_025237152.1|4236662_4237892_-	peptidase T	NA	NA	NA	NA	NA
WP_000531605.1|4238141_4239278_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_059217927.1|4239261_4240125_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.7	5.1e-11
WP_001357468.1|4240357_4240522_-|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	87.2	8.5e-16
WP_099588087.1|4240738_4241329_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_024262848.1|4241512_4242139_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.8	5.9e-25
WP_099588088.1|4242239_4243298_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_099588089.1|4243423_4244059_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	76.0	4.7e-62
WP_062859942.1|4244330_4244600_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	1.6e-43
WP_099588090.1|4244601_4245915_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	95.7	4.5e-75
WP_099588091.1|4249445_4250093_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	3.1e-109
WP_099588092.1|4249990_4250734_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	3.7e-143
WP_099588093.1|4250738_4251437_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	6.4e-129
WP_001114907.1|4251436_4251778_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	1.2e-40
WP_099588094.1|4251770_4254998_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	93.1	0.0e+00
WP_071590020.1|4255044_4255305_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001312914.1|4255346_4255733_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_001682408.1|4256427_4257105_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4257104_4257452_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4257471_4259043_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_047627858.1|4259203_4259548_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	1.6e-56
WP_099588096.1|4259544_4259994_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.9	6.7e-63
WP_001147814.1|4259990_4260329_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|4260337_4260655_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766109.1|4260731_4261949_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_099588097.1|4261963_4262563_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	80.0	1.6e-88
WP_099588098.1|4262555_4263782_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	1.2e-202
WP_099588099.1|4263929_4265687_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.1	0.0e+00
WP_099588100.1|4265686_4266169_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	8.7e-85
WP_099588101.1|4266676_4266973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052931673.1|4267042_4267243_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	66.1	2.0e-11
WP_025237239.1|4267759_4268293_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	4.3e-101
WP_052931675.1|4268356_4268707_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	84.5	9.6e-33
WP_000839572.1|4268711_4268927_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_072250181.1|4269726_4270545_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_059236952.1|4270687_4271059_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	85.0	7.2e-55
WP_059274539.1|4271048_4271426_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	4.5e-36
WP_099588102.1|4271426_4272482_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	6.4e-88
WP_059274501.1|4272483_4272762_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_059236936.1|4272929_4273142_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.5e-20
WP_059274496.1|4273690_4274464_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059274497.1|4274819_4275230_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	68.4	2.4e-43
WP_059274498.1|4275237_4275999_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.4	1.7e-111
WP_059274499.1|4276022_4276769_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.1	9.0e-113
WP_072250167.1|4276775_4277738_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	58.3	2.3e-84
WP_059217916.1|4277761_4278187_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_059217915.1|4278209_4278506_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	46.4	4.3e-10
WP_099588103.1|4278629_4279106_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_032205458.1|4279423_4279576_+	DUF1391 family protein	NA	NA	NA	NA	NA
WP_059274551.1|4279587_4279962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993340.1|4279947_4280094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449200.1|4280491_4280680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090222.1|4280676_4280868_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_099588104.1|4280961_4283433_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|4283494_4283764_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|4283732_4284851_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
4286747:4286765	attR	GCTCTACCCGGATGCTGAA	NA	NA	NA	NA
>prophage 13
NZ_CP024282	Escherichia albertii strain 2014C-4356 chromosome, complete genome	4852165	4441895	4569399	4852165	lysis,terminase,head,plate,tail,capsid,protease,holin,portal,integrase,tRNA,transposase	Escherichia_phage(32.79%)	117	4515634:4515651	4560255:4560272
WP_000375136.1|4441895_4442555_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_024164819.1|4442646_4442976_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048219.1|4442972_4443251_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000116313.1|4443344_4444535_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|4444592_4444910_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_099588121.1|4444954_4445368_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847777.1|4445540_4446203_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424182.1|4446298_4446757_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_059215651.1|4446788_4448843_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.0e-20
WP_001261228.1|4448965_4449412_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000875014.1|4449421_4451587_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000839162.1|4451546_4452176_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288703.1|4452393_4452903_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_024164823.1|4453258_4454311_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877164.1|4454385_4454838_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_059259926.1|4455023_4456784_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002462364.1|4456852_4457371_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|4457439_4457607_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759093.1|4457863_4458427_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000444171.1|4458426_4460064_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_025237262.1|4460068_4461322_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_059256544.1|4461522_4463430_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	2.4e-53
WP_059225157.1|4463441_4465550_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224295.1|4465793_4466903_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220656.1|4466899_4467442_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_010341567.1|4467615_4468626_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_059259927.1|4469038_4471651_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.7	3.1e-19
WP_059259928.1|4471916_4473119_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117893.1|4473287_4474688_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.3	3.1e-82
WP_099588122.1|4475290_4476361_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.3	6.6e-101
WP_000462676.1|4476545_4477736_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_059259930.1|4477957_4478605_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_002462368.1|4478631_4479180_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000926035.1|4479360_4481208_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_059259931.1|4481468_4485929_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_010329756.1|4485928_4486633_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288860.1|4486613_4487936_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_010329757.1|4487932_4488718_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_099588123.1|4488853_4489633_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_059215621.1|4489609_4490503_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_054412551.1|4490656_4491403_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|4491399_4491582_-	protein YcaR	NA	NA	NA	NA	NA
WP_054412549.1|4491633_4492866_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570517.1|4492902_4493889_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551258.1|4493885_4495634_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.1	1.2e-59
WP_099588124.1|4495670_4497935_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	23.8	1.4e-12
WP_000167336.1|4498140_4498425_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|4498584_4500258_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000124000.1|4500368_4501052_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000445276.1|4501241_4502519_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_054412541.1|4502589_4503678_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	5.9e-81
WP_059259936.1|4504166_4505927_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_000642550.1|4506331_4507189_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292823.1|4507243_4509526_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|4509845_4510064_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882966.1|4510145_4511309_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_000978889.1|4511308_4511788_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_059239050.1|4511802_4514250_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	92.3	0.0e+00
WP_000785970.1|4514242_4514362_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4514394_4514670_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4514727_4515246_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_099588125.1|4515258_4516449_-|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	98.5	4.0e-224
4515634:4515651	attL	ACGGAAACCGTCGCGGCG	NA	NA	NA	NA
WP_059239054.1|4516581_4516995_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	51.1	4.3e-24
WP_059239055.1|4518959_4519490_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	97.7	3.6e-100
WP_044713600.1|4519482_4520391_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	1.3e-161
WP_000127163.1|4520395_4520743_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_044711439.1|4520739_4521375_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	87.3	7.9e-94
WP_099588166.1|4521365_4522535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099588126.1|4522617_4523052_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	26.8	4.4e-11
WP_023148832.1|4523273_4523726_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_000917188.1|4523718_4524186_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_099588127.1|4524293_4524719_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	8.0e-66
WP_099588128.1|4524706_4525132_-	protein lysA	NA	U5N096	Enterobacteria_phage	94.3	9.8e-56
WP_001144101.1|4525146_4525644_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_099588129.1|4525643_4525925_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	98.9	6.9e-42
WP_000846409.1|4525928_4526132_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|4526131_4526641_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203439.1|4526740_4527484_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_099588130.1|4527487_4528561_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH4	Enterobacteria_phage	99.2	7.4e-201
WP_099588131.1|4528619_4529474_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.2	1.7e-136
WP_000156861.1|4529647_4531420_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_099588132.1|4531419_4532454_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	2.1e-200
WP_099588133.1|4532783_4533323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157760414.1|4533323_4534241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554767.1|4534608_4534815_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	94.0	9.0e-31
WP_099588167.1|4534814_4535267_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	95.3	1.8e-79
WP_099588135.1|4535266_4537552_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_097178643.1|4537541_4537817_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	98.9	2.5e-44
WP_001113264.1|4537813_4538038_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000789846.1|4538037_4538328_-	DUF5405 family protein	NA	M1RZ07	Escherichia_phage	78.5	6.1e-33
WP_000185626.1|4538324_4538570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099588136.1|4538584_4538797_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	91.4	1.9e-28
WP_000217671.1|4538860_4539361_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_001064716.1|4539628_4539823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001248439.1|4539800_4540265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001100582.1|4540274_4540631_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	83.9	3.2e-52
WP_024164825.1|4540734_4541034_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	80.8	1.3e-38
WP_000023391.1|4541127_4542123_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067976.1|4542154_4542952_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.7e-21
WP_000918346.1|4543158_4544592_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109304.1|4544801_4545950_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165868.1|4546266_4546893_+	hydrolase	NA	NA	NA	NA	NA
WP_000534713.1|4546928_4547792_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|4547793_4548411_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_059259937.1|4548421_4550866_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	7.8e-222
WP_000886690.1|4551104_4552397_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.5	3.9e-95
WP_000067755.1|4552487_4553831_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_002462419.1|4553841_4554453_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_059259938.1|4554611_4558553_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.4	1.5e-86
WP_000228473.1|4558687_4559182_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537396.1|4559726_4560692_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	7.2e-62
4560255:4560272	attR	CGCCGCGACGGTTTCCGT	NA	NA	NA	NA
WP_059259941.1|4560812_4562579_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202158.1|4562579_4564301_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.5	3.8e-21
WP_001241660.1|4564345_4565050_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4565334_4565553_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_025237287.1|4566771_4569048_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.3e-166
WP_000520793.1|4569078_4569399_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	5.3e-14
>prophage 1
NZ_CP024285	Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence	127606	154	44986	127606	transposase,integrase	Stx2-converting_phage(35.29%)	50	41816:41830	48628:48642
WP_000381395.1|154_1726_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1745_2093_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|2092_2770_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_157760418.1|3004_4321_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
WP_000337398.1|4320_4935_+	IncI1-type conjugal transfer protein TraV	NA	NA	NA	NA	NA
WP_001189160.1|4901_6104_+	IncI1-type conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_001037987.1|6132_6717_+	IncI1-type conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_000698351.1|6813_8976_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_000653334.1|9040_9703_+	plasmid IncI1-type surface exclusion protein ExcA	NA	NA	NA	NA	NA
WP_000062603.1|9774_9984_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001275298.1|10616_10913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331364.1|11535_11688_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_000121274.1|11979_13188_+	IncI1-type conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_000151583.1|13206_14277_+	IncI1-type conjugal transfer protein TrbB	NA	NA	NA	NA	NA
WP_001289276.1|14269_16561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001354015.1|16597_19297_-	IncI1-type relaxase NikB	NA	NA	NA	NA	NA
WP_001281051.1|19307_19640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157095.1|19872_20208_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001077049.1|20293_21142_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000148285.1|21721_21973_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001348086.1|22003_22201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078704.1|22223_23162_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.6e-66
WP_001247862.1|23226_23493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|23586_24021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117609.1|24749_25250_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.9	9.3e-05
WP_000978012.1|25712_26309_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_001276261.1|26305_27025_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845897.1|27021_27456_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145453.1|27510_29469_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	3.6e-20
WP_000006014.1|29527_29761_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001276110.1|29818_30346_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001027519.1|31115_31307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006907871.1|31303_31726_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_072132163.1|31772_32075_-	antirestriction protein	NA	NA	NA	NA	NA
WP_015059345.1|32170_32743_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274403.1|33436_33871_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104887.1|33882_34104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086178.1|34104_34788_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
WP_000273918.1|35172_36075_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|36492_36741_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|36737_37175_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_099588210.1|37174_38338_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.3	6.7e-123
WP_001682408.1|38337_39015_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|39014_39362_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|39381_40953_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001278818.1|41157_41574_-	recombinase	NA	NA	NA	NA	NA
WP_000688514.1|41566_42547_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
41816:41830	attL	TTCAGCATTATAAAT	NA	NA	NA	NA
WP_000030199.1|42960_43269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|43355_44000_-	ParA family protein	NA	NA	NA	NA	NA
WP_033904598.1|44179_44986_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	2.4e-55
48628:48642	attR	TTCAGCATTATAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP024285	Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence	127606	54032	107145	127606	transposase,integrase	uncultured_virus(21.43%)	55	64085:64098	109281:109294
WP_001138064.1|54032_56999_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|57001_57562_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|57687_58038_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|58240_59254_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|59402_60194_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000131886.1|60360_61260_+	aminoglycoside N-acetyltransferase AAC(3)-VIa	NA	NA	NA	NA	NA
WP_000535481.1|61466_61787_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	47.9	1.0e-17
WP_000719078.1|61842_63480_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.6	1.8e-174
WP_001137772.1|63668_65198_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
64085:64098	attL	GCGCTTCCTGTTCG	NA	NA	NA	NA
WP_001137513.1|65465_66701_+|transposase	IS256-like element ISEc58 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.8e-42
WP_000679427.1|66918_67266_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|67259_68099_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|68226_68727_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|68902_69685_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|69674_71198_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|71299_72160_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|72162_73878_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|73916_74624_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|74620_74857_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|74853_75216_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|75233_76928_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|76979_77402_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|77437_77713_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|77726_78077_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|78148_78583_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|79585_79828_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|79859_80537_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|80615_81815_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000493383.1|81846_82707_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000896474.1|82691_83369_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001057996.1|83686_84535_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
WP_000969996.1|84574_84856_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079941.1|84852_85122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000907875.1|86030_87062_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001324596.1|88034_88298_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
WP_000483804.1|88266_88503_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_001303319.1|88944_89478_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000213857.1|89731_90415_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_000776428.1|90428_90995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136192.1|91262_91517_+	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_000008893.1|91559_92012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|92678_93952_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000742600.1|94021_95089_+	type IV pilus biogenesis lipoprotein PilL	NA	NA	NA	NA	NA
WP_000539807.1|95088_95526_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_000748143.1|95539_97222_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_000752774.1|97214_98510_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_001247336.1|98496_98949_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000362202.1|98959_100513_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_001208805.1|100525_101623_+	pilus biosynthesis protein PilR	NA	NA	NA	NA	NA
WP_000959785.1|101640_102255_+	pilus assembly protein PilX	NA	NA	NA	NA	NA
WP_000014116.1|102264_102825_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_099588213.1|102809_103466_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001389385.1|103465_104890_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_071527775.1|105638_105857_-	shufflon protein D'	NA	NA	NA	NA	NA
WP_001139957.1|105990_107145_+|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.3e-46
109281:109294	attR	CGAACAGGAAGCGC	NA	NA	NA	NA
>prophage 1
NZ_CP024287	Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence	124142	0	12484	124142	transposase	Stx2-converting_phage(100.0%)	16	NA	NA
WP_137445725.1|834_1344_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|1758_2142_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000332496.1|2331_3018_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_001254386.1|3111_3339_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_089634697.1|3372_3738_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|3752_4064_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399792.1|4085_4652_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_149001176.1|4662_5367_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000002778.1|6785_7376_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001352845.1|7329_7560_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_001038342.1|7571_7823_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_089634700.1|7819_8335_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_099588274.1|8469_8691_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_000381395.1|9868_11440_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|11459_11807_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|11806_12484_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 2
NZ_CP024287	Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence	124142	34082	36498	124142		Xanthomonas_phage(50.0%)	4	NA	NA
WP_000205759.1|34082_34829_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	1.1e-09
WP_000139359.1|34883_35444_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001311693.1|35581_35794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233871.1|36036_36498_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.7	5.5e-20
>prophage 3
NZ_CP024287	Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence	124142	40520	41369	124142		Vibrio_phage(100.0%)	1	NA	NA
WP_001058012.1|40520_41369_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	39.6	1.0e-27
>prophage 4
NZ_CP024287	Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence	124142	45709	100436	124142	transposase,integrase	uncultured_Caudovirales_phage(23.08%)	51	47432:47447	104747:104762
WP_000124023.1|45709_48697_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	1.7e-295
47432:47447	attL	AAAATCACGGAAATTC	NA	NA	NA	NA
WP_052943198.1|48670_49459_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_001082319.1|49458_50262_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000105382.1|50661_52098_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001067858.1|52406_53111_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_049884581.1|56286_58038_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_044502556.1|58086_59376_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	3.3e-171
WP_011117598.1|59388_59814_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.8e-50
WP_011117599.1|59848_60385_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011117600.1|60596_61409_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011117601.1|61471_61840_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011117602.1|61913_63671_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_011117603.1|63691_64054_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_001286342.1|64129_64675_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024159726.1|64683_65394_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	3.1e-94
WP_001175594.1|65494_65818_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044502555.1|65922_66960_+	permease	NA	NA	NA	NA	NA
WP_000521603.1|67252_67870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818556.1|68061_69618_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000194575.1|69880_70471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343085.1|70470_70728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350638.1|71081_73220_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|73381_73798_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|73794_74025_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000111771.1|74320_74611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963206.1|74600_75500_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000698737.1|75549_77775_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000952217.1|77776_78865_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000813630.1|79442_79661_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_097492536.1|79662_79968_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_024197775.1|79968_80775_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	98.3	2.9e-56
WP_016238649.1|81461_82163_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	32.2	1.7e-25
WP_001401628.1|82813_84019_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	88.9	2.1e-204
WP_001233384.1|84015_84987_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	1.4e-113
WP_000549075.1|86331_87330_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_024210471.1|87326_88238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099588280.1|88314_89538_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000993248.1|89584_90103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280973.1|90115_90970_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000729190.1|91104_92286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000575188.1|92282_94511_+	thiazole biosynthesis protein ThiF	NA	NA	NA	NA	NA
WP_001401624.1|94528_94684_-	impB/mucB/samB family protein	NA	I6RSM4	Salmonella_phage	70.6	8.8e-15
WP_000109071.1|94683_95121_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|95117_95366_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_137445743.1|95783_96686_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|96689_96995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099588282.1|97071_97755_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	4.3e-29
WP_001104869.1|97755_97977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099588283.1|97870_98425_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_099588284.1|98470_99247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|99323_100436_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
104747:104762	attR	AAAATCACGGAAATTC	NA	NA	NA	NA
>prophage 5
NZ_CP024287	Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence	124142	104820	105384	124142		Vibrio_phage(100.0%)	1	NA	NA
WP_099588285.1|104820_105384_+	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.9	1.8e-20
>prophage 6
NZ_CP024287	Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence	124142	108536	110499	124142	integrase	Enterobacteria_phage(100.0%)	2	108512:108525	114382:114395
108512:108525	attL	CTATCACTTATTTA	NA	NA	NA	NA
WP_099588287.1|108536_109331_+|integrase	site-specific integrase	integrase	Q7M297	Enterobacteria_phage	59.1	7.9e-75
WP_000053332.1|109488_110499_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.1	6.2e-16
114382:114395	attR	CTATCACTTATTTA	NA	NA	NA	NA
>prophage 7
NZ_CP024287	Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence	124142	114060	121086	124142	transposase	Stx2-converting_phage(60.0%)	7	NA	NA
WP_000813680.1|114060_115491_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.5	1.2e-28
WP_099588289.1|115684_117079_+	porin	NA	NA	NA	NA	NA
WP_099588290.1|117324_118101_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001295212.1|118161_118809_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
WP_000624622.1|118808_119156_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099588291.1|119175_120747_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_077631319.1|120810_121086_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	67.1	2.3e-26
>prophage 1
NZ_CP024288	Escherichia albertii strain 2014C-4356 plasmid unnamed6, complete sequence	19118	1818	10488	19118	transposase,tail,plate	Shigella_phage(63.64%)	13	NA	NA
WP_001547431.1|1818_3357_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|3406_3754_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_072157534.1|3750_4131_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_099588164.1|4245_4395_+	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_032155681.1|4645_4981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099588070.1|4982_5411_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.7	3.7e-26
WP_099588069.1|5382_5985_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	85.0	1.4e-92
WP_099588295.1|5984_6812_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	93.5	2.4e-50
WP_052908571.1|6815_7400_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.2e-113
WP_099588071.1|7390_8449_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	99.4	3.3e-201
WP_157760416.1|8435_8861_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	98.6	2.6e-80
WP_001544766.1|8860_9409_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	1.1e-96
WP_099588073.1|9408_10488_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.5e-206
