The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	245015	283127	3999012	integrase,transposase	uncultured_Caudovirales_phage(38.46%)	40	240578:240592	261606:261620
240578:240592	attL	TAAAGGTGATGCGCT	NA	NA	NA	NA
WP_000736404.1|245015_245726_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	9.1e-06
WP_000573062.1|245726_247637_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000417085.1|247641_248562_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_002024550.1|248591_249707_+	TniQ family protein	NA	NA	NA	NA	NA
WP_005116093.1|249699_251148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000192758.1|251251_252319_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	58.7	7.1e-95
WP_001172025.1|252420_253374_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.1	2.4e-62
WP_000174605.1|253391_254096_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.9	1.3e-92
WP_000068656.1|254101_255145_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000670219.1|255152_255626_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.2	3.9e-37
WP_000372102.1|255632_255953_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	63.7	2.1e-26
WP_001275666.1|256010_256445_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	56.5	2.9e-39
WP_001219642.1|257267_257675_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000041516.1|257770_258667_+	cation transporter	NA	NA	NA	NA	NA
WP_004726826.1|258670_259183_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000137809.1|259204_260494_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_000340224.1|260556_261231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210271.1|261301_263320_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.1	1.1e-80
261606:261620	attR	AGCGCATCACCTTTA	NA	NA	NA	NA
WP_001037424.1|263346_263700_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001258304.1|263733_264060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004369.1|264514_264934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|265031_265871_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|265998_266499_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|267005_267770_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000993245.1|268007_268220_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|268285_268522_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|268518_268884_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|268901_270587_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|270625_271051_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|271078_271354_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|271369_271735_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|271806_272262_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|272399_272642_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|272673_273324_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|273429_274629_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|274660_275545_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|275682_276090_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000656305.1|277896_278274_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|278474_279134_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001143757.1|280121_283127_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.1	0.0e+00
>prophage 2
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	587315	652504	3999012	portal,transposase,capsid,integrase,tail,head,terminase,plate,holin,tRNA	uncultured_Caudovirales_phage(33.33%)	73	580497:580514	635993:636010
580497:580514	attL	TTTTAATAATAATTATTT	NA	NA	NA	NA
WP_001043524.1|587315_589187_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_001175201.1|589210_589690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001115787.1|589694_589997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000645707.1|590031_590646_-	septation protein IspZ	NA	NA	NA	NA	NA
WP_001161539.1|590690_591542_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_000637023.1|591549_592461_-	bestrophin	NA	NA	NA	NA	NA
WP_085920667.1|592522_593242_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000006958.1|593342_594596_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
WP_001985897.1|594661_595627_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_001270222.1|595635_597537_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000051669.1|597588_597918_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_000667229.1|598016_599150_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
WP_000147160.1|599325_599895_-	LemA family protein	NA	NA	NA	NA	NA
WP_001121110.1|599981_601010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177136.1|601163_602201_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_059262584.1|602646_603714_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	37.5	2.6e-44
WP_000218943.1|603741_604038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059262583.1|604034_604256_-	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	40.3	6.7e-08
WP_059262581.1|604265_605003_-	3'-5' exonuclease	NA	A0A0A1IWL5	Pseudomonas_phage	31.7	2.1e-21
WP_059262579.1|605012_605366_-	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	62.7	3.3e-33
WP_000049862.1|605353_605671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005136254.1|605674_606193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001178667.1|606195_606627_-	DUF2528 family protein	NA	NA	NA	NA	NA
WP_057097136.1|606694_607030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059262576.1|607026_609765_-	toprim domain-containing protein	NA	A0A2H4JDT6	uncultured_Caudovirales_phage	62.3	0.0e+00
WP_032040900.1|609858_610050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786717.1|610142_610484_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000556347.1|610528_610744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789360.1|610844_611090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057097134.1|611092_611287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085940413.1|611602_612693_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000190074.1|612790_613525_+	hypothetical protein	NA	A0A2H4J8P0	uncultured_Caudovirales_phage	48.3	5.6e-51
WP_059262828.1|613596_614343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130087.1|614653_614854_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_000113724.1|614850_615090_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_059262830.1|615219_616533_-	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	43.6	4.9e-98
WP_000979754.1|616533_616974_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	54.1	3.0e-39
WP_059262832.1|616979_619520_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	53.0	4.9e-211
WP_079393827.1|619533_619647_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_059262834.1|619673_620015_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	50.0	2.5e-17
WP_032013880.1|620082_620601_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	59.1	7.2e-53
WP_059262837.1|620613_621789_-|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	68.4	5.9e-151
WP_059262839.1|621894_624351_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.9	2.2e-30
WP_059262842.1|624353_624962_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	40.8	2.6e-33
WP_059262844.1|624961_625864_-|plate	baseplate J/gp47 family protein	plate	S4TNY7	Salmonella_phage	49.7	5.5e-72
WP_059262846.1|625860_626208_-	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	57.8	1.8e-23
WP_059262847.1|626204_626831_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	42.7	6.8e-21
WP_059262849.1|626903_627353_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.9	1.1e-28
WP_059262851.1|627349_627877_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	50.0	9.7e-37
WP_059262853.1|627873_628704_-	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	41.8	6.2e-46
WP_000571491.1|628700_628970_-|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	38.5	7.7e-06
WP_001114936.1|628966_629317_-	membrane protein	NA	NA	NA	NA	NA
WP_059262855.1|629325_629535_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	56.7	1.3e-16
WP_059262857.1|629535_629988_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	45.8	5.6e-25
WP_059262859.1|630090_630792_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	34.8	2.9e-28
WP_059262860.1|630802_631792_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	53.8	3.3e-94
WP_059262862.1|631844_632672_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	50.4	1.8e-58
WP_171254512.1|632809_634618_+|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	58.7	4.1e-204
WP_059262864.1|634617_635616_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	52.8	6.4e-98
WP_000194110.1|636933_638202_+	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	24.8	1.3e-07
635993:636010	attR	TTTTAATAATAATTATTT	NA	NA	NA	NA
WP_000990839.1|638270_641021_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_001046506.1|641045_641972_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_000548427.1|642039_642930_+	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_032025844.1|642952_643981_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_000989966.1|643977_644733_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_032059466.1|644729_645497_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016653554.1|645504_646518_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_032044173.1|646518_647403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099527930.1|647462_648227_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_005130854.1|648256_649186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251492.1|649223_649442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099527948.1|649665_650673_+	stealth conserved region 3 domain-containing protein	NA	NA	NA	NA	NA
WP_000986451.1|650725_652504_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
>prophage 3
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	794503	837962	3999012	capsid,coat,terminase	Acinetobacter_phage(86.0%)	65	NA	NA
WP_000028947.1|794503_794713_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
WP_000130785.1|794709_795318_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	57.0	3.6e-43
WP_000765548.1|795314_795974_-	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	59.0	9.8e-79
WP_000993558.1|795970_796909_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	82.3	7.5e-141
WP_000453627.1|796918_797209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991217.1|797208_797475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021797.1|797494_797872_-	hypothetical protein	NA	A0A068CDD9	Acinetobacter_phage	38.3	7.7e-12
WP_000065151.1|798066_800334_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
WP_000370477.1|800466_800682_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
WP_000105769.1|800696_801479_-	helix-turn-helix domain-containing protein	NA	J7I4M9	Acinetobacter_phage	77.1	3.7e-101
WP_001217698.1|801606_801783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051086.1|801779_802046_+	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	77.3	6.2e-32
WP_001109646.1|802095_802254_+	hypothetical protein	NA	A0A1B1P9H5	Acinetobacter_phage	98.1	7.9e-19
WP_000501092.1|802253_803081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059262743.1|803080_804400_+	AAA family ATPase	NA	A0A2H4J6D5	uncultured_Caudovirales_phage	74.1	1.4e-164
WP_000116153.1|804396_804621_+	hypothetical protein	NA	A0A0P0I4B7	Acinetobacter_phage	98.6	2.1e-33
WP_059262741.1|804617_804845_+	hypothetical protein	NA	A0A0P0IL13	Acinetobacter_phage	96.0	2.3e-35
WP_059262739.1|804841_805099_+	hypothetical protein	NA	A0A2H4J6Z3	uncultured_Caudovirales_phage	62.8	1.5e-22
WP_171266117.1|805095_805272_+	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	86.2	5.7e-18
WP_000826377.1|805268_805925_+	hypothetical protein	NA	A0A0N7IRF9	Acinetobacter_phage	100.0	2.1e-129
WP_000801875.1|805921_806287_+	hypothetical protein	NA	A0A1J0MGQ3	Acinetobacter_phage	64.5	1.4e-34
WP_000066269.1|806279_806459_+	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
WP_001278405.1|806524_806710_+	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_001204257.1|806702_807035_+	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
WP_025470181.1|807038_807488_+	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	65.4	1.2e-14
WP_001123238.1|807478_807790_+	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.1e-59
WP_000206496.1|807786_808188_+	hypothetical protein	NA	A0A1B1P9J0	Acinetobacter_phage	97.7	5.0e-70
WP_006582143.1|808187_808481_+	hypothetical protein	NA	A0A1B1P9I9	Acinetobacter_phage	99.0	2.7e-49
WP_038405950.1|808490_808760_+	hypothetical protein	NA	A0A0D4DC03	Acinetobacter_phage	96.6	2.1e-43
WP_057061341.1|808770_809304_+	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	36.9	2.2e-20
WP_006582108.1|809703_809907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162831993.1|809914_810085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059262768.1|810077_810356_+	DUF968 domain-containing protein	NA	A0A0D4DC07	Acinetobacter_phage	56.8	1.5e-20
WP_059262770.1|810531_811014_+	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	73.8	2.6e-65
WP_032050951.1|811315_811933_+	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	50.0	9.2e-55
WP_032050952.1|811978_812497_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.1	7.8e-31
WP_059262772.1|812480_813794_+|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	82.1	4.8e-218
WP_059262774.1|813801_815205_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	51.6	6.4e-128
WP_059262776.1|815170_816256_+|capsid	minor capsid protein	capsid	A0A1B1P9B7	Acinetobacter_phage	94.2	5.4e-191
WP_002016231.1|816252_816465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059262778.1|816574_817381_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	58.1	9.8e-65
WP_059262780.1|817393_818548_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	56.2	2.7e-100
WP_000048012.1|818587_819001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059262783.1|819004_819397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059262784.1|819399_819780_+	hypothetical protein	NA	A0A1B1P9E3	Acinetobacter_phage	85.9	7.9e-57
WP_057691400.1|819784_820207_+	hypothetical protein	NA	A0A1B1P9D5	Acinetobacter_phage	82.1	5.0e-60
WP_001251831.1|820208_820604_+	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	93.1	8.8e-67
WP_001056874.1|820763_821294_+	Rha family transcriptional regulator	NA	A0A1B1P9D9	Acinetobacter_phage	63.6	1.2e-55
WP_000858628.1|821290_821488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000632855.1|821554_821755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059262684.1|821862_822213_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	90.6	2.2e-53
WP_059262682.1|822212_823175_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	48.8	4.0e-89
WP_059262680.1|823227_824145_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	96.1	2.8e-164
WP_025079739.1|824215_824725_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	83.8	6.4e-62
WP_001099270.1|825381_825573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918373.1|825562_825943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059262786.1|826056_826566_+	hypothetical protein	NA	A0A0S0N7I7	Pseudomonas_phage	35.4	6.7e-19
WP_099527932.1|826636_831505_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	51.1	6.4e-292
WP_000277446.1|832077_832476_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000368382.1|832475_832982_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	98.2	3.8e-91
WP_000835153.1|832978_833341_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	78.3	1.4e-50
WP_059262695.1|833333_836780_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	97.8	0.0e+00
WP_000138204.1|836846_837203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083663.1|837199_837418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208716.1|837407_837962_+	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	79.9	1.3e-79
>prophage 4
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	1292407	1308343	3999012	transposase	Acinetobacter_phage(90.91%)	11	NA	NA
WP_001988464.1|1292407_1293433_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.1	5.7e-25
WP_001187843.1|1293546_1294095_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	1.5e-96
WP_000893677.1|1294357_1295857_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.0	1.2e-278
WP_001076822.1|1295858_1298234_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.7	0.0e+00
WP_001164227.1|1298240_1299224_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	99.4	1.0e-188
WP_000066126.1|1299234_1299930_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608308.1|1299939_1300746_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_001982145.1|1300755_1301805_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281154.1|1302161_1304894_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.7	0.0e+00
WP_000960544.1|1304972_1307672_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.8	0.0e+00
WP_000566783.1|1307767_1308343_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	4.2e-110
>prophage 5
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	1353057	1372608	3999012	integrase,transposase	Acinetobacter_phage(79.17%)	32	1350317:1350331	1367727:1367741
1350317:1350331	attL	GGTCAAATCTTTAGC	NA	NA	NA	NA
WP_000110172.1|1353057_1353870_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
WP_001010536.1|1353866_1354640_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000128669.1|1354636_1355572_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_000135937.1|1355869_1356856_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	97.9	2.9e-183
WP_000123991.1|1356852_1357122_-	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	100.0	4.7e-48
WP_001288394.1|1357123_1357348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290367.1|1357344_1357557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085940413.1|1357679_1358770_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000130785.1|1358948_1359557_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	57.0	3.6e-43
WP_000765548.1|1359553_1360213_-	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	59.0	9.8e-79
WP_000993558.1|1360209_1361148_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	82.3	7.5e-141
WP_000453627.1|1361157_1361448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991217.1|1361447_1361714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021797.1|1361733_1362111_-	hypothetical protein	NA	A0A068CDD9	Acinetobacter_phage	38.3	7.7e-12
WP_000065151.1|1362305_1364573_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
WP_002042732.1|1364705_1364921_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	98.6	5.5e-31
WP_000370562.1|1364936_1365683_-	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	79.7	3.3e-107
WP_001100148.1|1365788_1365977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166816.1|1365985_1366261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001070070.1|1366447_1366621_+	hypothetical protein	NA	A0A0P0J0G1	Acinetobacter_phage	96.5	1.8e-24
WP_000200304.1|1366617_1367361_+	replication protein	NA	A0A0P0HSN8	Acinetobacter_phage	91.6	1.1e-46
WP_000106165.1|1367360_1368686_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	98.2	1.3e-247
1367727:1367741	attR	GCTAAAGATTTGACC	NA	NA	NA	NA
WP_001001967.1|1368930_1369107_+	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	86.2	1.7e-17
WP_000826377.1|1369103_1369760_+	hypothetical protein	NA	A0A0N7IRF9	Acinetobacter_phage	100.0	2.1e-129
WP_000801875.1|1369756_1370122_+	hypothetical protein	NA	A0A1J0MGQ3	Acinetobacter_phage	64.5	1.4e-34
WP_000066269.1|1370114_1370294_+	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
WP_001278405.1|1370359_1370545_+	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_001204257.1|1370537_1370870_+	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
WP_025470181.1|1370873_1371323_+	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	65.4	1.2e-14
WP_001123238.1|1371313_1371625_+	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.1e-59
WP_000206496.1|1371621_1372023_+	hypothetical protein	NA	A0A1B1P9J0	Acinetobacter_phage	97.7	5.0e-70
WP_059262625.1|1372131_1372608_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	41.0	2.4e-26
>prophage 6
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	1375914	1409041	3999012	capsid,terminase	Acinetobacter_phage(97.06%)	42	NA	NA
WP_001136767.1|1375914_1376370_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.0	1.0e-82
WP_000378508.1|1376431_1376866_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
WP_059262627.1|1376834_1377476_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	97.7	1.5e-124
WP_002132557.1|1377534_1378005_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	85.3	2.4e-71
WP_000102080.1|1377994_1379422_+|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_001286362.1|1379418_1380870_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.8	8.5e-285
WP_000179763.1|1380871_1381975_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_000965231.1|1381983_1382412_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000004363.1|1382510_1382753_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_001139861.1|1382970_1383162_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000770049.1|1383275_1384043_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_000214189.1|1384070_1385027_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
WP_057262468.1|1385091_1385757_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	99.5	1.6e-113
WP_000008492.1|1385761_1386151_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	9.5e-66
WP_057262465.1|1386152_1386521_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	97.5	5.5e-63
WP_059262628.1|1386529_1386934_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	94.7	8.1e-68
WP_059262630.1|1386905_1387274_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	86.1	6.5e-56
WP_059262632.1|1387275_1387674_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	92.4	1.6e-68
WP_001277694.1|1387675_1387894_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	94.4	4.3e-31
WP_059262684.1|1387989_1388340_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	90.6	2.2e-53
WP_059262682.1|1388339_1389302_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	48.8	4.0e-89
WP_059262680.1|1389354_1390272_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	96.1	2.8e-164
WP_025079739.1|1390342_1390852_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	83.8	6.4e-62
WP_001040173.1|1391398_1391665_-	Arc family DNA-binding protein	NA	A0A0P0IVR2	Acinetobacter_phage	100.0	6.8e-39
WP_000806811.1|1391724_1391949_+	Arc family DNA-binding protein	NA	A0A0P0I460	Acinetobacter_phage	100.0	1.4e-32
WP_001048886.1|1391945_1392932_+	phage antirepressor Ant	NA	A0A0R6PJV6	Moraxella_phage	51.0	1.6e-24
WP_059262699.1|1393058_1393997_-	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	74.1	1.4e-126
WP_002004813.1|1394067_1394223_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000085187.1|1394330_1394567_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001118913.1|1394587_1395070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072874.1|1395066_1395783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059262703.1|1395831_1396545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099527937.1|1396605_1401405_+	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	84.5	0.0e+00
WP_000277446.1|1401977_1402376_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000368382.1|1402375_1402882_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	98.2	3.8e-91
WP_000835153.1|1402878_1403241_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	78.3	1.4e-50
WP_059262695.1|1403233_1406680_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	97.8	0.0e+00
WP_000138204.1|1406746_1407103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083663.1|1407099_1407318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208716.1|1407307_1407862_+	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	79.9	1.3e-79
WP_000079982.1|1408028_1408550_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_001197971.1|1408846_1409041_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	95.2	1.8e-28
>prophage 7
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	2247363	2301092	3999012	transposase,integrase,tRNA	Faecalibacterium_phage(33.33%)	53	2267617:2267676	2284686:2285772
WP_000204682.1|2247363_2248449_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000011679.1|2248697_2248928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000699303.1|2248963_2249710_-	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_001187976.1|2249895_2250486_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_000550334.1|2250531_2251122_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_000248280.1|2251336_2251744_+	OsmC family protein	NA	NA	NA	NA	NA
WP_000211068.1|2251797_2253786_-	transketolase	NA	NA	NA	NA	NA
WP_001209545.1|2254309_2255476_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.4	5.5e-125
WP_000458766.1|2255599_2255740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192618.1|2256106_2256292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001050731.1|2256355_2256916_-	FxsA family protein	NA	NA	NA	NA	NA
WP_059262713.1|2257314_2258139_+	OXA-51 family carbapenem-hydrolyzing class D beta-lactamase OXA-92	NA	NA	NA	NA	NA
WP_001109738.1|2258210_2258756_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000340965.1|2258752_2259346_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001128330.1|2259575_2260121_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_001149484.1|2260125_2261586_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001985406.1|2261644_2262703_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001985405.1|2262790_2263792_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000030993.1|2263838_2264051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001061891.1|2264114_2264465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713430.1|2264911_2265448_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001988464.1|2265685_2266711_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.1	5.7e-25
WP_000422636.1|2266811_2267591_+	aminoglycoside O-phosphotransferase APH(3')-VIa	NA	E4ZFP6	Streptococcus_phage	35.1	1.5e-30
2267617:2267676	attL	GGCAGAGTAAAACTTGAAGTGCGACATAAACCACCTAATTAATTTAAAGGGTTTATGGAG	NA	NA	NA	NA
WP_001988464.1|2267670_2268696_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.1	5.7e-25
WP_005115797.1|2269385_2271923_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000738477.1|2271919_2272939_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000905609.1|2273515_2273695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568087.1|2273734_2274586_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161298841.1|2274692_2275610_+	EamA family transporter	NA	NA	NA	NA	NA
WP_098733269.1|2276011_2277087_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	4.4e-44
WP_000378386.1|2277627_2279043_+	cytosine permease	NA	NA	NA	NA	NA
WP_001161759.1|2279100_2279538_-	PACE efflux transporter	NA	NA	NA	NA	NA
WP_001010553.1|2279627_2280527_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108033.1|2281110_2282343_-|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	42.4	1.9e-83
WP_001124739.1|2282773_2283637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001988464.1|2283665_2284691_-|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.1	5.7e-25
WP_000037165.1|2285002_2285563_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000713973.1|2285748_2286294_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
2284686:2285772	attR	CTCCATAAACCCTTTAAATTAATTAGGTGGTTTATGTCGCACTTCAAGTTTTACTCTGCCTTATTAATTTTTTAAATTTCCATATTCTATTTTAAAAACAAATAGTTAAGATAAAAATAAGACTCCTTTTATCGAAAATTCATATTAGAATTAAAATTCTACTAAATCAAATAGAATATTTTAAAAATTTAAAAATAATCTTGAGTAGCATTTATAATATTCACTTGAATAAAATTATGTTTTTGATTATGATTAATTTGATTAAAATTTTAAAATCTATATCAAGTAATAATTAGTTTCAATTATATGGAAATTTAATGTCAAAAAAAGAAGATATTATAAATACTGCTTTAGAACTTTTTAACCAAATTGGTTACAATGCTACAGGGGTAGACAAAATTATTGCTGAATCAAATGTAGCCAAGATGACTTTCTACAAATATTTTCCCTCTAAAGAAAGTTTAATCATGGAATGCCTACATCATCGAAATATTAATATACAAAATTCAATTTATGAAAAATTAAGCTTACATCCAGATGTGAGTCCAATTGAGAAAATACATCTAATTTTTAATTGGTATATTGACTGGATTAATAGTAAGAATTTTAATGGTTGCCTATTCAAAAAGGCTTTTATTGAAGTGTCTAAACAATACACCTCAATTCGTGAACCATTTCAAGAATATACAAACTGGCTTATAAATTTATTAAATAGTTTATTAGTAGAGCTAGATATTAAAGACCCTACTCCACTTACTCATATCATCATTTCAATTATTGATGGTATTATTATTGATGGGACAATTGATAAAGATCTGATTGATCCTTCTAAGAAATGGCAATATATTGAGTATTTAATTAAAACTGAAAATCTCTAATATTTTTTATGTATAAAATAATACTTTAAAAATTCAATTATATATTTTTCTATTATTAAATTAGAATATAATATTTAAAAATATTTTTAAATTAAAATAAATAAAATTTGTTTGGTAGATAATTTTCTACCTTTTTAGACAAACTCATATTAGAATTCTGCAACCTTATTGTCTCCCACATCTCTATGAAAAAGTTTTTAGGCAATTCT	NA	NA	NA	NA
WP_000907230.1|2286455_2287205_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000418050.1|2287235_2287706_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000264535.1|2288036_2289368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132006.1|2289418_2290162_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
WP_000347804.1|2290175_2290853_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000110649.1|2290855_2291698_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000830363.1|2291792_2292686_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001265503.1|2293222_2293987_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_001986597.1|2294332_2295568_+	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
WP_000205197.1|2295580_2296804_+	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
WP_000753093.1|2296803_2298216_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000079420.1|2298230_2299061_+	methionine transporter	NA	NA	NA	NA	NA
WP_001007364.1|2299074_2299908_+	methionine transporter	NA	NA	NA	NA	NA
WP_171266118.1|2299913_2300192_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_002002847.1|2300159_2301092_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	3.2e-59
>prophage 8
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	2486782	2553293	3999012	plate,transposase	Enterobacteria_phage(20.0%)	60	NA	NA
WP_002002847.1|2486782_2487715_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	3.2e-59
WP_001279164.1|2487961_2488114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100514392.1|2488280_2488397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002017914.1|2488852_2488972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032071356.1|2489130_2489724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133266.1|2489958_2490561_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000073989.1|2491200_2492982_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_005115822.1|2492974_2494768_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001171041.1|2494984_2495368_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_001112269.1|2495445_2496051_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_000062822.1|2496037_2497003_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000377856.1|2497056_2498346_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000390385.1|2498386_2499595_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000130574.1|2499607_2501146_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000386291.1|2501148_2501940_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001156942.1|2501939_2502713_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000077461.1|2502721_2503783_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001177936.1|2503806_2504307_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_001016799.1|2504323_2505079_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001984048.1|2505091_2505406_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000431128.1|2505414_2506353_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000892952.1|2506618_2508721_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000470954.1|2508764_2510144_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000203777.1|2510593_2512165_+	APC family permease	NA	NA	NA	NA	NA
WP_000932294.1|2512317_2513898_+	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_000214021.1|2514056_2515346_+	fosfomycin efflux MFS transporter AbaF	NA	NA	NA	NA	NA
WP_000177078.1|2515412_2516165_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000415230.1|2516209_2517472_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000615330.1|2517471_2517702_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_001258339.1|2517702_2518806_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000859578.1|2518802_2519735_-	4-hydroxyproline epimerase	NA	NA	NA	NA	NA
WP_000174668.1|2519903_2520587_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106975.1|2521004_2521913_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000065199.1|2521969_2522905_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000720057.1|2523764_2524199_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000004112.1|2524360_2524813_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_000342966.1|2525002_2525290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001007559.1|2525716_2526376_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_085916980.1|2526692_2527148_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000204305.1|2527226_2528384_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000813825.1|2528517_2529696_-	cyanate transporter	NA	NA	NA	NA	NA
WP_000646734.1|2529695_2530178_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	39.8	5.4e-18
WP_085920601.1|2530193_2530841_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000460192.1|2531013_2531865_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000972583.1|2531867_2532821_-	M15 family metallopeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
WP_000046446.1|2532828_2533431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083629.1|2533443_2534250_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000471444.1|2534267_2535632_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000020713.1|2535648_2536743_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000987834.1|2536766_2539448_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.9	1.3e-81
WP_000168112.1|2539666_2539930_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001072410.1|2539946_2540714_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000557241.1|2540716_2541676_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_059262735.1|2541713_2545538_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000591871.1|2545568_2546981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190396.1|2546977_2547976_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000568822.1|2547939_2549751_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001047031.1|2549767_2550244_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000653195.1|2550323_2550827_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001988464.1|2552267_2553293_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.1	5.7e-25
>prophage 9
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	2636296	2647966	3999012	capsid,terminase	Acinetobacter_phage(30.0%)	14	NA	NA
WP_000433906.1|2636296_2636686_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	96.9	1.1e-64
WP_001068512.1|2636836_2637823_+	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	31.7	5.7e-14
WP_001990242.1|2637883_2638882_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_001990240.1|2638878_2639370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000060043.1|2639373_2639844_-	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	41.8	8.1e-19
WP_000653192.1|2639862_2641062_-	DUF2213 domain-containing protein	NA	A0A2I7R2U8	Vibrio_phage	28.5	2.0e-21
WP_059262697.1|2641115_2641748_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	24.5	1.6e-06
WP_000032786.1|2641788_2641977_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001273094.1|2642056_2642869_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	42.1	2.7e-54
WP_000852322.1|2642813_2644148_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	40.0	3.7e-85
WP_001086349.1|2644156_2645647_-|terminase	phage terminase large subunit	terminase	I3PGT7	Xanthomonas_phage	41.2	1.4e-88
WP_000113266.1|2645624_2646107_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	85.8	2.2e-67
WP_001004672.1|2646854_2647199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138417.1|2647507_2647966_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.6	2.0e-30
>prophage 10
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	2659737	2666715	3999012	transposase	Acinetobacter_phage(50.0%)	9	NA	NA
WP_002002847.1|2659737_2660670_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	3.2e-59
WP_000072673.1|2660895_2661111_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000015965.1|2661629_2662247_+	LysE family translocator	NA	NA	NA	NA	NA
WP_001019681.1|2662313_2662859_-	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	72.9	2.7e-74
WP_000427182.1|2662896_2663286_-	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	73.6	1.1e-48
WP_000016213.1|2663453_2663651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185369.1|2663886_2664558_+	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	1.1e-64
WP_000636785.1|2664712_2664946_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001283235.1|2665452_2666715_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	22.1	6.6e-15
>prophage 11
NZ_CP024418	Acinetobacter baumannii strain A388 chromosome, complete genome	3999012	2720632	2800780	3999012	transposase,integrase,tail,terminase,tRNA	Acinetobacter_phage(37.93%)	84	2723334:2723354	2801241:2801261
WP_000199457.1|2720632_2723269_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
2723334:2723354	attL	TATGGCATTAATCGTTCAAAA	NA	NA	NA	NA
WP_001219079.1|2723557_2724763_+|integrase	site-specific integrase	integrase	A0A0R6PDI8	Moraxella_phage	51.8	3.1e-107
WP_000852816.1|2724796_2725009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171266119.1|2725141_2725960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002002847.1|2725927_2726860_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	3.2e-59
WP_000235280.1|2727397_2727940_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001280978.1|2727943_2728639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497693.1|2728613_2729105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766533.1|2729235_2730006_-	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	98.4	1.7e-151
WP_001279704.1|2730002_2730290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000894311.1|2730411_2730630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627452.1|2730622_2731318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030336.1|2731317_2732130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776264.1|2732203_2732635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000025567.1|2732750_2736581_-	DEAD/DEAH box helicase family protein	NA	A0A1Y0T2N3	Pseudomonas_phage	43.5	1.4e-201
WP_000209674.1|2736656_2738168_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	43.1	4.0e-83
WP_000114189.1|2738167_2740120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863716.1|2740193_2740847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000098518.1|2740846_2742382_-	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	9.4e-32
WP_000852568.1|2742540_2742735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852828.1|2742762_2743533_-	hypothetical protein	NA	G4WT79	Acinetobacter_phage	80.0	3.8e-82
WP_000190166.1|2743532_2743931_-	hypothetical protein	NA	G4WT78	Acinetobacter_phage	69.7	7.8e-47
WP_001013743.1|2743931_2754281_-	DUF1983 domain-containing protein	NA	A0A126DKX0	Acinetobacter_phage	27.2	1.4e-83
WP_001167468.1|2754290_2755184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240944.1|2755183_2755633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187719.1|2755632_2756280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001098597.1|2756396_2756675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067780.1|2756737_2757505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005136819.1|2757526_2758822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151781.1|2758939_2759227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000718482.1|2759231_2759855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000217397.1|2759917_2761696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959490.1|2761903_2762149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121108.1|2762194_2762497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000934747.1|2762496_2763042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272162.1|2763031_2764162_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	32.0	1.1e-21
WP_001243275.1|2764163_2764442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000996679.1|2764456_2765995_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001162226.1|2766067_2768059_-|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_000014220.1|2768078_2768591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130711.1|2768602_2768803_-	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	42.4	2.2e-05
WP_001108875.1|2768795_2769599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157191.1|2769601_2770507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001239775.1|2770579_2770807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183519.1|2770818_2771277_-	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	1.8e-10
WP_000371256.1|2771355_2771970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000176707.1|2771957_2773403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633139.1|2773383_2773722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001166851.1|2773721_2774078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000535154.1|2774277_2775219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000274053.1|2775416_2775833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001259764.1|2775904_2776804_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	42.9	3.8e-41
WP_000801068.1|2776868_2777810_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	29.6	5.4e-06
WP_000172885.1|2778138_2779194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001991758.1|2779207_2781496_-|tail	tail tape measure protein	tail	NA	NA	NA	NA
WP_000172662.1|2781578_2781842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101401.1|2781957_2782794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001085639.1|2782807_2783494_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000592658.1|2783494_2784184_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_002002847.1|2785235_2786168_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	3.2e-59
WP_059262755.1|2786197_2786650_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	67.8	5.0e-50
WP_000991091.1|2787105_2787639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994864.1|2787635_2788400_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	1.0e-63
WP_000124475.1|2788396_2789440_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_001055561.1|2789443_2790922_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.3	9.7e-135
WP_002029044.1|2790918_2791305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000606802.1|2791310_2792285_-	phosphoadenosine phosphosulfate reductase family protein	NA	A4JX51	Burkholderia_virus	47.7	2.7e-77
WP_000218440.1|2792281_2792920_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	39.9	9.0e-29
WP_000200145.1|2793368_2793554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290739.1|2793550_2793751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|2793784_2794159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172739.1|2794194_2794398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001108434.1|2794533_2795298_+	S24 family peptidase	NA	A0A0P0I8E0	Acinetobacter_phage	63.0	1.6e-77
WP_000794429.1|2795301_2795586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183423.1|2795780_2796119_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	39.3	1.6e-13
WP_001072361.1|2796199_2796529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856471.1|2796525_2796897_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.0	6.4e-11
WP_057694975.1|2797071_2797752_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000805204.1|2797764_2798793_+	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_000986116.1|2798933_2799224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464381.1|2799224_2799404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609003.1|2799396_2799933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578498.1|2799929_2800439_+	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	85.1	1.1e-32
WP_001038586.1|2800435_2800780_+	hypothetical protein	NA	A0A0P0IYD2	Acinetobacter_phage	78.8	7.4e-38
2801241:2801261	attR	TATGGCATTAATCGTTCAAAA	NA	NA	NA	NA
