The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024191	Klebsiella pneumoniae isolate KSB1_5D chromosome, complete genome	5296999	452038	524028	5296999	tRNA,integrase,portal,transposase,terminase,capsid,head,tail,protease	uncultured_Caudovirales_phage(55.0%)	72	469646:469663	486947:486964
WP_002919147.1|452038_452986_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|453000_453510_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|453638_454763_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|454734_455208_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|455233_455776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|455780_456353_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|456356_457175_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|457171_457429_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|457404_457959_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|463754_463976_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|464269_467380_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|467392_468532_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|468910_469561_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
469646:469663	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|469836_471063_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|471155_472097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595205.1|472278_472536_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_085955245.1|472538_473731_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004150969.1|473879_474659_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|475110_475380_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|475372_475561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|475553_475868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|475864_476233_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|476229_476595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|476594_478730_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|479072_479408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|479456_479969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|480232_481399_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|481450_482011_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|482012_483254_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|483250_483586_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|483582_483882_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|483881_484325_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|484600_484957_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|484940_486602_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|486604_486796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|486949_487246_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
486947:486964	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|487270_488236_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002918745.1|488593_489475_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918742.1|489486_490938_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|490927_491170_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|491280_492630_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|492640_493108_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|493130_493583_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|493806_494415_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918688.1|494414_495416_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918687.1|495644_495836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|496170_497362_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_002918653.1|499467_500511_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|500581_501574_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|501573_502062_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|502069_502651_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|502653_504123_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|504160_507958_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918642.1|508046_509492_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|509527_510457_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|510588_510792_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|510799_511732_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|511737_513705_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|513784_514060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918627.1|514110_514377_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918626.1|514475_514739_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|515114_515585_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|515999_516938_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|517074_518133_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918566.1|518220_519588_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|519761_520160_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|520350_521478_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|521743_522172_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|522187_522580_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|522637_522922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|522891_523530_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|523533_524028_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
NZ_CP024191	Klebsiella pneumoniae isolate KSB1_5D chromosome, complete genome	5296999	1993882	2050149	5296999	transposase,plate,protease	Staphylococcus_phage(20.0%)	50	NA	NA
WP_032425077.1|1993882_1994629_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_048289971.1|1995040_1996054_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004145488.1|1996885_1997008_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_023286625.1|1997625_1998567_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|1998660_1999650_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|1999675_2001007_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_032425074.1|2001034_2002243_+	propionate kinase	NA	NA	NA	NA	NA
WP_032425474.1|2002271_2004566_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_060614334.1|2004996_2006112_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|2006221_2007136_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060614333.1|2007145_2008432_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032425073.1|2008428_2009304_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|2009300_2010020_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|2010025_2010919_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|2011202_2012846_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|2012895_2013372_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020801827.1|2013470_2014397_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032425072.1|2014700_2015996_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_004175495.1|2016010_2016817_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020801945.1|2016791_2017691_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2017800_2018283_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|2018473_2019172_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|2019197_2019782_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2019851_2020181_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899025.1|2020749_2022090_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004184632.1|2022086_2022740_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032425071.1|2022743_2024441_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032425070.1|2024899_2027386_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032425069.1|2027409_2028741_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_032425473.1|2028785_2029709_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_032425068.1|2029830_2030340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2030336_2030843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614320.1|2031079_2031589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425067.1|2031882_2033238_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_004200304.1|2033238_2033748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|2033744_2034251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|2034296_2034527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317012.1|2034550_2035741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958629.1|2035764_2036070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614315.1|2036091_2036985_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.1e-13
WP_016946122.1|2037168_2038062_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004184615.1|2038237_2039131_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_004184614.1|2040331_2040673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|2040861_2041119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2041416_2041683_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032411808.1|2042832_2046243_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_099595213.1|2046376_2048140_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_060614316.1|2048139_2049186_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_021314026.1|2049160_2049703_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004175538.1|2049705_2050149_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP024191	Klebsiella pneumoniae isolate KSB1_5D chromosome, complete genome	5296999	2724034	2734921	5296999		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2724034_2727142_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2727196_2728462_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2728492_2729581_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2729667_2729928_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2730225_2731086_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2731106_2731868_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2732128_2733031_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2733042_2734308_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2734300_2734921_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP024191	Klebsiella pneumoniae isolate KSB1_5D chromosome, complete genome	5296999	2963127	3055363	5296999	terminase,transposase,integrase	uncultured_Caudovirales_phage(26.56%)	109	2953756:2953773	3063803:3063820
2953756:2953773	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
WP_004152576.1|2963127_2963994_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2963993_2964767_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2964763_2965960_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2965959_2966313_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2966314_2966968_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2967021_2967588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|2967630_2967813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|2967862_2968204_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|2968203_2969226_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|2969228_2969531_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|2969531_2970131_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2970130_2972134_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|2972123_2972276_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|2972311_2972737_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|2972740_2973181_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|2973191_2974337_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|2974340_2974781_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|2974875_2975262_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|2975261_2975768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2975764_2976184_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|2976152_2976434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|2976473_2977415_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|2977426_2977921_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|2977924_2979127_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|2979178_2979727_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|2979782_2981234_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|2981471_2982872_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|2982822_2983575_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|2983676_2983997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|2984231_2984621_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|2984617_2985148_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|2985150_2985399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|2985804_2986587_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|2986583_2987060_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|2987056_2988019_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|2988020_2989679_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|2990255_2990477_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|2990574_2991243_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|2991413_2991728_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|2991720_2991909_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|2992078_2992444_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|2992436_2992691_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|2992662_2992881_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|2992877_2993303_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|2993299_2993494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|2993490_2994318_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|2994422_2994941_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|2994946_2995657_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|2995646_2995871_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|2995867_2996080_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|2996076_2996556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|2996734_2996977_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|2996957_2998139_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|2998335_2998884_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152145.1|2999082_3000615_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3000831_3001593_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|3001701_3002616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|3002916_3003105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152142.1|3003175_3003484_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152141.1|3003651_3004521_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218007.1|3004599_3005802_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152139.1|3005874_3007011_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004152138.1|3007183_3008068_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152137.1|3008192_3009026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152136.1|3009256_3009643_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152135.1|3009810_3011427_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152134.1|3011612_3012320_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004152133.1|3012316_3013282_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152131.1|3013384_3013891_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_085666574.1|3013961_3014984_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901979.1|3015115_3016657_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_002901977.1|3016829_3018143_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_071531198.1|3018274_3019156_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152127.1|3019245_3020307_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002901917.1|3020303_3021701_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002901915.1|3021803_3022022_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901913.1|3022050_3022410_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901911.1|3022409_3022634_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901908.1|3022689_3023358_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002901905.1|3023525_3024500_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901901.1|3024490_3025882_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901900.1|3025907_3027077_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004152126.1|3027248_3029558_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004171423.1|3029536_3030367_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152124.1|3030477_3031383_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002901817.1|3031716_3033360_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002901816.1|3033356_3034322_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901815.1|3034526_3035198_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3035384_3036212_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3036287_3037553_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3037554_3037974_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3038053_3039538_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152765.1|3039963_3041448_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3042345_3042768_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3043360_3044065_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|3044241_3045006_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004152787.1|3045389_3045530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|3045512_3046013_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3046140_3046980_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3046973_3047321_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3047484_3048276_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_015057121.1|3048421_3049381_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|3049271_3049976_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_081541247.1|3050034_3050439_+	regulator	NA	M9NYX4	Enterobacteria_phage	78.9	2.6e-58
WP_004151899.1|3050435_3051098_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3051305_3052493_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3052669_3053560_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|3053559_3054552_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3054553_3055363_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3063803:3063820	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
>prophage 5
NZ_CP024191	Klebsiella pneumoniae isolate KSB1_5D chromosome, complete genome	5296999	3432597	3527209	5296999	tRNA,integrase,portal,transposase,lysis,terminase,capsid,plate,head,tail,protease	Salmonella_phage(57.63%)	94	3489784:3489802	3527284:3527302
WP_002898139.1|3432597_3433890_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3433980_3435324_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3435332_3435944_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3436066_3440320_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3440455_3440950_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3441455_3442451_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3442565_3444332_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3444332_3446054_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3446098_3446800_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3447153_3447372_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3447492_3449772_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3449802_3450120_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3450445_3450667_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3450743_3452684_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3452680_3453796_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_000608644.1|3454098_3455361_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_002896437.1|3455603_3457262_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3457681_3458377_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3458492_3459392_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3459535_3461188_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3461198_3462167_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3462378_3462813_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3462964_3464683_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3464721_3465723_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3465733_3467176_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3467263_3468277_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3468273_3469104_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3469135_3470275_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3471152_3471668_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3471894_3472623_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3472643_3473375_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3473381_3474098_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3474097_3474766_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3474949_3475681_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3475723_3477196_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3477192_3477909_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3477987_3479115_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3479156_3479645_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3479702_3480548_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3480544_3481498_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3481508_3482642_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3482805_3483918_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3484266_3484746_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3484834_3485737_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3486558_3486846_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3487048_3487312_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3487318_3487702_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3487968_3489654_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3489784:3489802	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3489873_3490092_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3490183_3491284_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3491280_3491766_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3491762_3494390_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3494382_3494502_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3494516_3494816_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3494868_3495384_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3495393_3496566_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3496704_3497781_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3497810_3498014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3498010_3498742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3498745_3501697_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3501698_3502298_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3502290_3503199_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3503185_3503548_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3503544_3504117_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3504211_3504904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3504900_3505347_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3505339_3505771_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3505866_3506295_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3506291_3506675_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3506679_3507189_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3507169_3507385_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3507388_3507592_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3507591_3508056_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3508151_3508802_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3508805_3509864_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3509880_3510714_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3510856_3512623_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3512622_3513648_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3513709_3515452_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3515727_3516405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3516519_3516753_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3516763_3516952_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3517105_3519520_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3519516_3520374_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3520370_3520598_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3520597_3520831_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3520898_3521240_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3521203_3521404_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3521411_3521921_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3521953_3522175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3522320_3523199_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3523210_3524155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3524253_3525738_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3526156_3527209_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3527284:3527302	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 6
NZ_CP024191	Klebsiella pneumoniae isolate KSB1_5D chromosome, complete genome	5296999	4179463	4191117	5296999	integrase	Enterobacteria_phage(70.0%)	13	4179913:4179927	4202970:4202984
WP_004144574.1|4179463_4180567_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4179913:4179927	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4180577_4181831_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4182183_4183374_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4183361_4184312_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4184311_4184737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4185305_4185872_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4185889_4186135_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4186131_4186869_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4187410_4187677_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4187673_4188231_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4188227_4188455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4188451_4188772_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4188783_4191117_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4202970:4202984	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP024192	Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence	221606	24187	50033	221606	transposase	Escherichia_phage(38.46%)	33	NA	NA
WP_125551036.1|24187_24884_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	4.7e-132
WP_000056203.1|25024_25243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001909178.1|25612_25999_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_019706045.1|26072_26894_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101710.1|26893_28054_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000128596.1|28095_29091_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000792636.1|29090_29624_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210549.1|30595_30937_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	7.3e-62
WP_001067855.1|30973_31678_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|31683_31824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|32309_33047_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|33043_33268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|33366_33678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|33851_34637_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|34640_35822_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|35870_36143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099595285.1|36878_38378_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.7	1.5e-10
WP_099595287.1|38364_39105_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.9	2.7e-32
WP_000939033.1|39325_39469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|39787_40165_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000044824.1|40157_40439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|40413_41088_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_005507681.1|41155_41587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595289.1|41571_41895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|41897_43090_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_000647189.1|43218_43719_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_000936896.1|43722_45150_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268551.1|45149_45806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362482.1|46011_46230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464631.1|46323_46941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542259.1|47152_47452_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
WP_000468105.1|47543_48032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|48841_50033_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
>prophage 2
NZ_CP024192	Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence	221606	111477	132108	221606	transposase,integrase	Salmonella_phage(33.33%)	18	114743:114756	131371:131384
WP_099595296.1|111477_112551_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_001337692.1|112558_112960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|113073_113799_+	hypothetical protein	NA	NA	NA	NA	NA
114743:114756	attL	ATCACATCACCCTG	NA	NA	NA	NA
WP_000427620.1|117645_118650_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_099595303.1|118728_121701_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
WP_001162012.1|121703_122261_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_002075255.1|122566_123580_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_015060105.1|123732_124473_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|124704_125037_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|125163_125718_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|125812_126445_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|126601_126949_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|126942_127782_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_004883563.1|127909_128182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120329.1|128363_129368_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|129595_130801_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|130811_131117_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|131343_132108_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
131371:131384	attR	CAGGGTGATGTGAT	NA	NA	NA	NA
>prophage 3
NZ_CP024192	Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence	221606	135446	189343	221606	transposase,integrase	Escherichia_phage(28.57%)	57	136215:136274	195227:195363
WP_001067855.1|135446_136151_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
136215:136274	attL	GTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG	NA	NA	NA	NA
WP_000557454.1|136383_137244_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|137256_137799_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|138280_138472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|138477_138723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|138773_139910_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|140024_141395_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_099595305.1|143368_143764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125551038.1|143760_144198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595307.1|144194_144707_+	trimethoprim-resistant dihydrofolate reductase DfrA35	NA	A0A076GDN3	Bacillus_phage	41.2	4.4e-26
WP_000259031.1|145058_145898_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_004883563.1|146025_146298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032430842.1|146479_147433_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652302.1|148053_148764_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652303.1|148765_149971_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652304.1|149967_151119_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|151115_151724_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032430842.1|151911_152865_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|153283_153613_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|153593_153875_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_016947617.1|154152_155133_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_087893729.1|155438_156712_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_001752509.1|156785_157286_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|157612_158317_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|158363_159668_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|159706_160414_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|160410_160647_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|160643_161006_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|161023_162718_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001447540.1|162769_163192_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|163227_163503_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|163516_163867_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|163938_164373_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_047359309.1|164451_165456_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_099595309.1|166264_166516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595311.1|167196_167454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043006371.1|168028_168313_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_008652077.1|168337_168847_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_034053978.1|168932_169421_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_074423286.1|169425_170958_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.6	4.1e-51
WP_034054008.1|171525_171966_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_004099020.1|173425_173797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844627.1|175410_175653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|175684_176362_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|176440_177640_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000427620.1|178243_179248_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000414383.1|179347_179782_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_001294666.1|179853_180204_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732290.1|180219_180495_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000149288.1|180566_182252_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000761850.1|182266_182905_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|183016_183382_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087810.1|183378_183615_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001276635.1|183611_184601_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_053821786.1|184730_185291_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	87.9	1.3e-50
WP_053821785.1|185293_188260_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427620.1|188338_189343_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
195227:195363	attR	CTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTG	NA	NA	NA	NA
>prophage 1
NZ_CP024193	Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence	147945	1727	64517	147945	transposase,protease,integrase	uncultured_Caudovirales_phage(27.78%)	59	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|7416_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11193_13191_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33115_34012_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34051_34432_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34436_35366_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35420_36101_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36097_37498_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37714_38149_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40302_40812_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41690_42017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42735_43281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43356_43719_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46184_46610_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46622_47912_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47959_49711_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49728_50091_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50140_50491_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53920_54403_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57803_58766_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62846_63416_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63450_63732_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|63975_64239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|64253_64517_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP024194	Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed3, complete sequence	89345	6364	67876	89345	transposase	Escherichia_phage(44.83%)	53	NA	NA
WP_000227969.1|6364_7441_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|8153_8858_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509965.1|9394_10000_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001067855.1|10601_11306_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|11449_12004_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|12134_12965_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|13596_14301_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|14407_15268_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|15280_15823_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|17016_17721_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|18998_19703_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000368714.1|20790_21996_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_012600007.1|21992_22970_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|23051_24323_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|24322_24754_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004152765.1|25162_26647_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776120.1|27116_27548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|27580_28108_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001166628.1|28367_28823_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200999.1|28894_29260_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|29275_29551_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|29578_30004_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|30042_31728_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|31745_32111_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|32107_32344_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_050558936.1|32327_32411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|32479_33184_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386481.1|34056_34701_-	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_087759376.1|39683_40804_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_020324562.1|40901_41606_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_071549088.1|41630_42143_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|42147_42354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|42735_44169_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|44202_45417_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|45677_46442_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|46584_46851_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001067855.1|47385_48090_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201232.1|48886_49573_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_004201234.1|49710_50448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201235.1|50967_52437_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001067855.1|52682_53387_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|55708_56041_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|56087_56963_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|57218_58481_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|59044_59602_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|59784_60645_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|60854_61394_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|61365_62202_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|62201_63005_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|63065_63881_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|64210_64387_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|64568_65573_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|67171_67876_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
