The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	1846099	1857374	4801841		Tupanvirus(12.5%)	10	NA	NA
WP_001618440.1|1846099_1847122_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.0	2.6e-86
WP_058107095.1|1847190_1848192_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001606067.1|1848210_1849332_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.4	1.3e-128
WP_001618438.1|1849335_1850298_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.1	6.4e-87
WP_001606059.1|1850307_1850754_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001606058.1|1850763_1852158_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.2	7.4e-60
WP_058107096.1|1852260_1853025_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.7	1.3e-10
WP_058111913.1|1853021_1854392_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.9e-32
WP_000043532.1|1854564_1855971_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
WP_001606027.1|1856207_1857374_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.0	1.2e-111
>prophage 2
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	1941152	1948418	4801841		Morganella_phage(33.33%)	8	NA	NA
WP_023229693.1|1941152_1941572_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.7	5.5e-35
WP_058111770.1|1941574_1942843_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|1943297_1943510_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1943520_1943709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023230392.1|1943967_1945179_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.5	2.0e-109
WP_000107430.1|1945827_1946127_+	membrane protein	NA	NA	NA	NA	NA
WP_001604595.1|1946218_1946914_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	9.5e-08
WP_001157302.1|1946987_1948418_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.5	3.5e-105
>prophage 3
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	2054363	2059875	4801841	tail	Salmonella_phage(66.67%)	8	NA	NA
WP_023230590.1|2054363_2055047_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	69.8	1.9e-29
WP_023230591.1|2055077_2055308_+	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	7.9e-28
WP_001050883.1|2055361_2055895_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2056151_2056319_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001532317.1|2056383_2056572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079985239.1|2057671_2059009_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	51.3	6.0e-75
WP_001529204.1|2058980_2059301_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	2.9e-44
WP_023229203.1|2059290_2059875_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	80.1	3.8e-82
>prophage 4
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	2613068	2655532	4801841	capsid,tail,holin,terminase,head,lysis,portal,plate,integrase,tRNA	Enterobacteria_phage(65.71%)	57	2612531:2612555	2648221:2648245
2612531:2612555	attL	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_077958110.1|2613068_2614004_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	47.6	9.3e-75
WP_058106648.1|2614093_2614405_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	5.4e-19
WP_001624303.1|2614499_2614778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001624304.1|2615012_2615336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058215087.1|2615408_2615651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070809214.1|2615656_2615860_+	LapA family protein	NA	NA	NA	NA	NA
WP_020844111.1|2615829_2616021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001624305.1|2616096_2616537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023207951.1|2616533_2616791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001624307.1|2616778_2617309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023170325.1|2617305_2617584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001624308.1|2617580_2618519_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	48.6	1.4e-65
WP_157763940.1|2618512_2619016_+	AsnC family protein	NA	NA	NA	NA	NA
WP_001624310.1|2619012_2619936_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	64.9	3.0e-118
WP_070809217.1|2619932_2622437_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	47.3	4.3e-175
WP_001624314.1|2622429_2622825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153260075.1|2622878_2623034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001624316.1|2623076_2623253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139145220.1|2623732_2624131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001624321.1|2624529_2624712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001624323.1|2625239_2625773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023229256.1|2625788_2626844_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.4	1.9e-153
WP_001624325.1|2626843_2628598_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	76.0	1.5e-262
WP_001624326.1|2628754_2629591_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.1	3.7e-99
WP_001624327.1|2629614_2630700_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	2.2e-136
WP_001644573.1|2630746_2631577_+|terminase	Small terminase subunit protein	terminase	A0A0A7NPX9	Enterobacteria_phage	68.9	7.2e-95
WP_001624329.1|2631678_2632173_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	59.5	3.8e-51
WP_000864914.1|2632172_2632373_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	80.0	1.3e-21
WP_024146654.1|2632402_2632741_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_001624331.1|2632737_2633181_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.2	2.4e-44
WP_001624332.1|2633187_2633679_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	43.1	6.9e-21
WP_001624333.1|2633665_2634142_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	51.0	1.1e-39
WP_001624334.1|2634138_2634774_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	57.9	8.0e-62
WP_023229255.1|2634770_2635361_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	69.9	1.7e-69
WP_000127183.1|2635357_2635726_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	71.3	2.9e-40
WP_001624454.1|2635712_2636609_+|plate	baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	69.1	1.2e-106
WP_023207929.1|2636601_2637129_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	61.2	1.4e-56
WP_070810448.1|2637134_2639126_+|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	50.2	7.8e-180
WP_001627829.1|2639137_2639809_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	63.3	3.8e-78
WP_000033281.1|2639918_2640293_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	6.2e-14
WP_000980424.1|2640312_2640801_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.5	1.5e-71
WP_099596340.1|2640814_2643775_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	50.7	4.1e-249
WP_001627826.1|2643761_2643920_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.4e-15
WP_033904327.1|2643925_2644225_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	1.7e-17
WP_000115856.1|2644324_2644837_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	7.6e-63
WP_000003578.1|2644837_2646025_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.7	1.1e-184
WP_099596341.1|2646183_2647329_+	hypothetical protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.3	1.5e-151
WP_024153979.1|2647374_2647656_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_023229131.1|2647868_2648009_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	71.7	3.1e-11
WP_001229266.1|2648365_2648665_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2648221:2648245	attR	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_023230626.1|2648669_2651057_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|2651072_2652056_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2652192_2652237_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2652357_2652714_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2652764_2652962_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001574431.1|2653057_2653600_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001144226.1|2653603_2655532_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
>prophage 5
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	2735336	2743605	4801841		Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2735336_2735576_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036548.1|2735786_2735951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2736448_2737258_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2737330_2737708_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158845.1|2737855_2738398_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_023229710.1|2738581_2739310_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.9	5.4e-62
WP_000275700.1|2739326_2739740_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	4.2e-19
WP_023212263.1|2740784_2741909_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444506.1|2742354_2743605_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.0e-19
>prophage 6
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	2978140	3058118	4801841	tail,capsid,holin,terminase,protease,head,portal,plate,integrase,tRNA	Salmonella_phage(32.76%)	86	2969861:2969877	3063644:3063660
2969861:2969877	attL	GCTTTATTACCTTTTTC	NA	NA	NA	NA
WP_000886699.1|2978140_2979433_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	7.3e-94
WP_000067786.1|2979691_2981035_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.9	1.3e-80
WP_001519746.1|2981044_2981656_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_099596414.1|2981798_2985836_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	3.8e-88
WP_000228469.1|2985970_2986465_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537406.1|2987011_2987980_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
WP_099596346.1|2988094_2989861_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	7.8e-22
WP_001202249.1|2989861_2991583_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.3	1.9e-12
WP_001241640.1|2991627_2992332_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001604059.1|2992332_2992716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040187.1|2992643_2992862_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597928.1|2992952_2993864_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809969.1|2993972_2994833_+	pirin family protein	NA	NA	NA	NA	NA
WP_000097893.1|2994852_2995530_+	hydrolase	NA	NA	NA	NA	NA
WP_000934064.1|2996136_2998413_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2998443_2998764_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2999087_2999309_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125898.1|2999438_3001385_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201745.1|3001381_3002500_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_001528818.1|3002645_3003596_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599770.1|3003592_3005251_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000491118.1|3005451_3006351_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458780.1|3006494_3008147_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178698.1|3008158_3009127_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815324.1|3009284_3011003_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.2	6.4e-29
WP_000566346.1|3011041_3012043_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_023258093.1|3012053_3013487_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000866902.1|3013582_3014596_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001202293.1|3014592_3015423_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
WP_001160725.1|3015419_3015743_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000497458.1|3016066_3016306_+	DinI family protein	NA	K7P6H1	Enterobacteria_phage	82.3	2.3e-30
WP_168172862.1|3016692_3018789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000564705.1|3018805_3019096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024153692.1|3020035_3020932_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_001643436.1|3021011_3021197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001643435.1|3021291_3021819_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	81.5	4.4e-74
WP_072209098.1|3021830_3022943_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	54.8	2.4e-138
WP_001643433.1|3022929_3023517_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	98.5	2.7e-112
WP_024153648.1|3023519_3024599_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	96.4	3.1e-199
WP_000605053.1|3024591_3025005_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	94.9	3.3e-72
WP_001273646.1|3025009_3025543_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.9	1.0e-94
WP_023229988.1|3025542_3026601_-|tail	phage tail protein	tail	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_099596348.1|3026597_3027938_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	98.7	2.0e-248
WP_001643422.1|3027971_3029900_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	96.0	0.0e+00
WP_000588852.1|3029984_3030311_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|3030307_3030664_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|3030663_3032160_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497739.1|3032149_3032314_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779215.1|3032317_3032878_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_001135696.1|3032874_3033387_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	99.4	1.7e-91
WP_000776846.1|3033358_3033763_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	98.5	2.7e-71
WP_000927251.1|3033759_3034083_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000766104.1|3034162_3035392_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	91.1	3.5e-207
WP_000003793.1|3035401_3036004_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_077909229.1|3035996_3037091_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.4	1.1e-178
WP_001643404.1|3037203_3037365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257218.1|3037361_3039092_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	1.5e-198
WP_070794285.1|3039091_3039529_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	4.6e-32
WP_001135222.1|3039680_3040031_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	96.6	1.0e-63
WP_001292891.1|3040091_3040394_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	97.0	5.1e-51
WP_000501908.1|3040470_3040758_-	TonB family protein	NA	H6WZK5	Escherichia_phage	50.0	7.6e-20
WP_070794284.1|3040935_3041481_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	46.6	1.4e-06
WP_024153643.1|3041477_3042104_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	79.2	2.3e-93
WP_001527046.1|3042106_3042451_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_024153641.1|3044294_3045098_-	antitermination protein	NA	F1C595	Cronobacter_phage	71.1	3.7e-104
WP_001643396.1|3045094_3045955_-	hypothetical protein	NA	F1C596	Cronobacter_phage	75.2	4.1e-125
WP_000844635.1|3045954_3046923_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	95.0	1.9e-179
WP_001177560.1|3046919_3048551_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	86.6	1.5e-282
WP_000105297.1|3049612_3050269_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	74.8	8.2e-94
WP_000560246.1|3050408_3050606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085336127.1|3050608_3050800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129880.1|3050873_3051068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155900.1|3051064_3051250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000267317.1|3051437_3051647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077909228.1|3051570_3051987_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	54.8	1.2e-26
WP_001088170.1|3051986_3052223_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	74.0	1.7e-25
WP_000886589.1|3052212_3052620_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	83.6	8.2e-60
WP_001099212.1|3052631_3053366_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	77.1	1.4e-102
WP_000586691.1|3053362_3053929_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	38.9	2.0e-27
WP_000687972.1|3053925_3054150_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	67.6	5.0e-19
WP_162096905.1|3054245_3054359_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	83.8	8.1e-10
WP_001030975.1|3054802_3054949_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	79.2	4.0e-17
WP_001193443.1|3054956_3055199_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.4	1.1e-22
WP_001555484.1|3055224_3056550_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	63.8	2.8e-165
WP_001270724.1|3056645_3057161_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027186.1|3057389_3058118_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
3063644:3063660	attR	GAAAAAGGTAATAAAGC	NA	NA	NA	NA
>prophage 7
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	3365292	3422984	4801841	tail,terminase,portal,integrase,tRNA	Enterobacteria_phage(45.45%)	66	3357369:3357386	3409610:3409627
3357369:3357386	attL	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
WP_085398049.1|3365292_3365760_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	74.2	2.7e-59
WP_085398048.1|3365840_3368183_-	hypothetical protein	NA	Q6K1H2	Salmonella_virus	62.2	3.9e-130
WP_085398047.1|3368226_3371622_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	75.7	0.0e+00
WP_023197193.1|3371684_3372332_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	79.1	4.2e-90
WP_058344979.1|3372229_3372967_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.4	6.8e-129
WP_023229841.1|3372973_3373672_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.2e-103
WP_023229840.1|3373681_3374011_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	9.6e-43
WP_099596361.1|3374013_3376989_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	58.2	3.7e-250
WP_085398044.1|3376960_3377299_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.3	6.0e-32
WP_000479606.1|3377295_3377691_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.1	6.6e-30
WP_023229837.1|3377741_3378485_-	gifsy-1 prophage VmtV	NA	A0A291AWU6	Escherichia_phage	76.1	4.8e-98
WP_001032971.1|3378495_3378897_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	65.4	1.6e-47
WP_000053598.1|3378893_3379478_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.1	3.4e-75
WP_000002964.1|3379481_3379757_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	42.9	6.0e-14
WP_001107911.1|3379749_3380073_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	63.2	1.0e-28
WP_099596362.1|3380161_3382276_-	peptidase S14	NA	K7PGT6	Enterobacteria_phage	72.3	5.8e-274
WP_023229836.1|3382193_3383729_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	62.9	1.1e-176
WP_000196422.1|3383725_3383932_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
WP_024160274.1|3383928_3386037_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.4	2.1e-292
WP_085398042.1|3386023_3386515_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	57.5	4.5e-44
WP_024160273.1|3386570_3386762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023230004.1|3386796_3388089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079932680.1|3388085_3388508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079932705.1|3388630_3389167_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	71.8	8.0e-55
WP_023230002.1|3389190_3389730_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	75.7	1.0e-81
WP_001525456.1|3389707_3390010_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024153641.1|3391858_3392662_-	antitermination protein	NA	F1C595	Cronobacter_phage	71.1	3.7e-104
WP_023229023.1|3392746_3393739_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	51.8	5.1e-71
WP_023229022.1|3393782_3394178_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_099596363.1|3394174_3396316_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.6	1.1e-192
WP_023228480.1|3396326_3396974_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.0	3.6e-33
WP_023228479.1|3396966_3397350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228478.1|3397439_3397745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229020.1|3397741_3398494_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	77.8	4.3e-30
WP_023228476.1|3398486_3398840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228475.1|3398832_3399060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228474.1|3399052_3399223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228473.1|3399215_3399614_-	DNA primase	NA	A0A286SGR4	Klebsiella_phage	54.2	1.1e-11
WP_001293161.1|3399606_3399768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229019.1|3399760_3400048_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_023229018.1|3400238_3400571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023229017.1|3400635_3401286_-	Bro-N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	47.1	8.3e-22
WP_000083329.1|3401387_3401585_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.3	5.1e-07
WP_130559586.1|3401804_3402239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000884168.1|3402235_3402541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229015.1|3402881_3404069_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.4	9.9e-122
WP_001603055.1|3404566_3405163_+	fimbria biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
WP_023229014.1|3405324_3405636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258105.1|3405654_3406377_+	fimbria biosynthesis regulator FimY	NA	NA	NA	NA	NA
WP_000801272.1|3406980_3407613_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_023229013.1|3407658_3408177_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_023229012.1|3408186_3409194_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_015406072.1|3409196_3411809_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
3409610:3409627	attR	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
WP_001519112.1|3411839_3412532_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000619614.1|3412575_3413109_-	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
WP_000681026.1|3413183_3413741_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729165.1|3414287_3415154_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
WP_000190278.1|3415155_3415368_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001038577.1|3416032_3416470_+	STM0539 family protein	NA	NA	NA	NA	NA
WP_000819116.1|3416466_3417291_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_023229011.1|3417334_3418720_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	2.5e-44
WP_000255991.1|3418892_3419387_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_023229010.1|3419389_3420112_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000098736.1|3420229_3420739_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815601.1|3420735_3421803_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000997740.1|3421898_3422984_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	3640585	3659592	4801841	plate	Shigella_phage(62.5%)	14	NA	NA
WP_023229784.1|3640585_3641335_-	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	77.8	9.2e-49
WP_099596373.1|3642705_3643263_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	47.8	2.7e-45
WP_023229799.1|3643253_3644336_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	51.8	3.8e-96
WP_023229798.1|3644336_3644774_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	55.0	5.0e-39
WP_023229797.1|3644766_3645396_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	46.6	1.2e-44
WP_023229796.1|3645388_3646513_-|plate	putative phage baseplate protein	plate	A0A0C4UQS1	Shigella_phage	48.2	1.8e-93
WP_099596374.1|3646520_3647888_-	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	31.7	3.0e-53
WP_000175471.1|3651089_3651380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099596375.1|3651465_3654129_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.3	4.4e-77
WP_023229789.1|3654496_3655399_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_001602331.1|3655385_3656210_+	protein of avirulence locus ImpE	NA	NA	NA	NA	NA
WP_000108007.1|3656206_3656701_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_023229788.1|3656716_3658600_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145238.1|3658596_3659592_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 9
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	3967048	4029474	4801841	tail,capsid,transposase,plate,integrase,tRNA	Burkholderia_virus(38.89%)	75	3961937:3961955	4036224:4036242
3961937:3961955	attL	CTTATCCGGCCTACAAATC	NA	NA	NA	NA
WP_001266763.1|3967048_3967735_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001541509.1|3968134_3968275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194359.1|3968370_3969087_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_023230604.1|3969353_3969668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000811635.1|3970052_3970724_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000482237.1|3971062_3971608_+	fimbrial protein SthA	NA	NA	NA	NA	NA
WP_000680522.1|3971678_3972362_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_023230606.1|3974963_3975521_+	fimbrial protein SthD	NA	NA	NA	NA	NA
WP_099596384.1|3975561_3976647_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_023137530.1|3976704_3978054_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_023230607.1|3978111_3979536_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	1.0e-08
WP_001187046.1|3979535_3980225_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_000875813.1|3980237_3980711_-	protein CreA	NA	NA	NA	NA	NA
WP_000371685.1|3980922_3981792_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942363.1|3981788_3982436_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000554311.1|3982484_3983000_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000192005.1|3983101_3983428_-	trp operon repressor	NA	NA	NA	NA	NA
WP_023230608.1|3983485_3985423_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
WP_000046770.1|3985631_3987299_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
WP_000093829.1|3987416_3988649_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.5	6.7e-89
WP_001029710.1|3988799_3990182_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132941.1|3990265_3991234_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_058111880.1|3991350_3991995_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_023230609.1|3992028_3993045_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_017441767.1|3993355_3994045_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_023230610.1|3994092_3994782_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_058111879.1|3994859_3995567_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_023230612.1|3995905_3996424_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	45.6	5.4e-32
WP_023230614.1|3997842_3998421_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	63.7	6.0e-64
WP_023230615.1|3998413_3999517_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	55.1	5.6e-111
WP_000859115.1|3999507_3999855_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_000929399.1|3999909_4000422_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	38.5	9.4e-21
WP_023230616.1|4000421_4001591_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.1	3.9e-86
WP_011410692.1|4001578_4001794_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.6e-17
WP_023230617.1|4001790_4002675_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	8.9e-51
WP_023230618.1|4002674_4005152_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	32.0	2.0e-100
WP_085710258.1|4005252_4005393_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023230620.1|4005355_4005670_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023230621.1|4005768_4006050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162837902.1|4006052_4006577_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.8	4.7e-68
WP_099596385.1|4006573_4008001_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	78.6	5.7e-217
WP_023229447.1|4007990_4008245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229448.1|4008241_4008706_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	3.7e-40
WP_023229449.1|4009153_4009510_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_023229450.1|4009520_4010474_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	42.7	1.4e-62
WP_023229451.1|4010487_4011585_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	49.6	1.3e-96
WP_024153829.1|4011799_4012258_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	4.9e-29
WP_023229453.1|4012260_4013082_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	60.8	4.9e-96
WP_023229454.1|4013062_4014559_-	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	59.6	5.5e-170
WP_023229455.1|4014558_4016082_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	1.3e-182
WP_023214055.1|4016078_4016624_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.0	2.7e-58
WP_006122433.1|4016623_4016935_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_000175096.1|4016927_4017260_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_023229456.1|4017256_4017910_-	putative lipoprotein	NA	A0A0S4L1H0	Pseudomonas_phage	30.7	1.1e-08
WP_023229457.1|4017899_4018622_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.3	2.2e-63
WP_023229458.1|4018624_4018975_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	6.9e-23
WP_023229459.1|4019107_4019554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024153834.1|4019721_4019991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229462.1|4020032_4021010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229464.1|4021518_4021707_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	67.7	6.7e-17
WP_023229465.1|4021759_4022065_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	59.0	1.6e-23
WP_023229466.1|4022074_4023010_+	hypothetical protein	NA	J9RW58	Pseudomonas_phage	44.8	9.7e-56
WP_023229467.1|4023002_4023266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023229468.1|4023262_4025056_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	52.8	4.9e-173
WP_023229469.1|4025066_4026233_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.6	6.3e-121
WP_023214064.1|4026235_4026505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023229470.1|4026522_4027134_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	9.4e-76
WP_023229471.1|4027212_4027401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023229472.1|4027397_4027670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023229473.1|4027685_4027982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023229474.1|4027968_4028238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024153840.1|4028237_4028465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024153841.1|4028454_4028670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029464108.1|4028659_4029088_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.9	1.1e-25
WP_023230177.1|4029084_4029474_+	phage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	53.4	2.9e-30
4036224:4036242	attR	GATTTGTAGGCCGGATAAG	NA	NA	NA	NA
>prophage 10
NZ_CP024165	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 chromosome, complete genome	4801841	4515000	4579928	4801841	tail,capsid,holin,terminase,protease,head,lysis,portal,plate,integrase	Salmonella_phage(55.81%)	75	4544857:4544903	4575303:4575349
WP_000208240.1|4515000_4515531_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4515540_4516872_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139639.1|4516938_4517868_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4517960_4518446_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4518667_4518907_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4519305_4520151_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_023230501.1|4520171_4521680_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250624.1|4521791_4522802_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796303.1|4522898_4523645_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155237.1|4523751_4524180_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802241.1|4524280_4524877_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216335.1|4524989_4525757_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001609375.1|4525848_4526613_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4526622_4526913_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|4526995_4527871_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090739.1|4527899_4528922_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4528950_4529952_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4529948_4530992_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4530985_4532521_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4532776_4533736_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4533822_4535415_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173083.1|4535428_4535779_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001535809.1|4536277_4537000_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557882.1|4537062_4538103_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646489.1|4538112_4539072_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001609359.1|4539082_4540417_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750757.1|4540679_4541435_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4541535_4542525_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4542728_4543691_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077322.1|4543875_4544778_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4544857:4544903	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468356.1|4545064_4545472_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	100.0	1.6e-71
WP_000468311.1|4545522_4545741_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_023139995.1|4545818_4546988_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	99.5	4.3e-210
WP_016505047.1|4546984_4547470_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	99.4	3.9e-85
WP_023139996.1|4547482_4549924_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	98.9	0.0e+00
WP_085984508.1|4549916_4550072_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001749787.1|4550068_4550404_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	98.2	5.2e-52
WP_001207675.1|4550466_4550985_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_023139997.1|4551000_4552188_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.7	3.4e-223
WP_023139998.1|4552322_4552871_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	99.5	1.7e-100
WP_099596400.1|4552883_4554998_-|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	76.6	2.2e-236
WP_001000068.1|4555008_4555539_-|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	9.2e-104
WP_000246677.1|4555531_4556440_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	100.0	2.6e-162
WP_000127148.1|4556446_4556794_-|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	100.0	2.5e-57
WP_001534860.1|4556790_4557432_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	99.1	1.6e-113
WP_001293096.1|4557500_4557950_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
WP_023135436.1|4557942_4558410_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	4.2e-84
WP_099596401.1|4558372_4558618_-|holin	holin	holin	S4TNY4	Salmonella_phage	98.8	3.7e-39
WP_023230504.1|4558517_4558931_-|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	97.8	2.4e-43
WP_023230505.1|4558927_4559425_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	98.8	1.5e-92
WP_000134660.1|4559411_4559708_-|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_010835754.1|4559711_4559915_-	phage Tail protein X	NA	S4TTA0	Salmonella_phage	100.0	6.1e-32
WP_000214255.1|4559914_4560421_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_023230506.1|4560514_4561264_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	98.0	9.0e-129
WP_001247243.1|4561267_4562335_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_001085932.1|4562411_4563266_-|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	100.0	9.9e-148
WP_023140008.1|4563431_4565201_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	98.6	0.0e+00
WP_000517958.1|4565200_4566247_+|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_017441879.1|4566594_4567479_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_023140009.1|4567548_4569048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023230508.1|4569402_4571688_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	93.0	0.0e+00
WP_000027664.1|4571677_4571953_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|4571949_4572174_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277958.1|4572173_4572476_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_000557701.1|4572475_4572700_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217670.1|4572763_4573264_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4573433_4573706_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4573842_4574136_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4574205_4575186_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|4575371_4575872_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4575303:4575349	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4576022_4576721_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4576717_4578091_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133441.1|4578141_4578537_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559229.1|4578548_4579238_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4579307_4579928_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 1
NZ_CP024167	Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_02, complete sequence	92392	21962	50808	92392	integrase,transposase,protease	Escherichia_phage(30.0%)	30	18219:18234	40518:40533
18219:18234	attL	CACGGATTTTTCTGGC	NA	NA	NA	NA
WP_085398067.1|21962_22658_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.1	8.5e-41
WP_023229215.1|23054_23996_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.3	4.2e-75
WP_099596449.1|24027_24741_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_085398051.1|24994_25483_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_099596450.1|25605_26274_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_130559608.1|26707_27133_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_139815156.1|27237_27408_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_024160213.1|27371_28094_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_024160212.1|28519_28843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023229415.1|28923_29568_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_024160211.1|29570_30539_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	46.8	5.7e-75
WP_023229413.1|30841_31270_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.5	1.1e-30
WP_023229412.1|31269_32541_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.8	7.8e-157
WP_024136783.1|32755_33094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511282.1|33185_33827_-	ParA family protein	NA	NA	NA	NA	NA
WP_085398053.1|34364_35228_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	46.6	4.3e-66
WP_023229695.1|35461_36244_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.4	1.1e-52
WP_001266178.1|36788_37079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159874.1|37080_37386_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813642.1|37387_37606_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000368362.1|38316_38562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023229666.1|38566_39529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023229667.1|39562_39907_+	hypothetical protein	NA	Q1MVE9	Enterobacteria_phage	55.4	4.0e-31
WP_157763945.1|42283_42952_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
40518:40533	attR	CACGGATTTTTCTGGC	NA	NA	NA	NA
WP_024160220.1|43144_44548_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_095472368.1|44642_44960_+|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_085398027.1|45100_46834_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	34.8	1.3e-32
WP_085398026.1|46899_48222_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099596453.1|48273_49596_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_085398024.1|49767_50808_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	87.3	2.0e-182
